ID: 1115755072

View in Genome Browser
Species Human (GRCh38)
Location 14:36521061-36521083
Sequence CCCCGCGCCTTGAGGGTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115755064_1115755072 10 Left 1115755064 14:36521028-36521050 CCTGTCTGCGCGTTCCCAGGCTT 0: 1
1: 0
2: 0
3: 6
4: 66
Right 1115755072 14:36521061-36521083 CCCCGCGCCTTGAGGGTCCTTGG 0: 1
1: 0
2: 0
3: 2
4: 149
1115755067_1115755072 -4 Left 1115755067 14:36521042-36521064 CCCAGGCTTCAAGTGTGGGCCCC 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1115755072 14:36521061-36521083 CCCCGCGCCTTGAGGGTCCTTGG 0: 1
1: 0
2: 0
3: 2
4: 149
1115755068_1115755072 -5 Left 1115755068 14:36521043-36521065 CCAGGCTTCAAGTGTGGGCCCCG 0: 1
1: 0
2: 0
3: 15
4: 141
Right 1115755072 14:36521061-36521083 CCCCGCGCCTTGAGGGTCCTTGG 0: 1
1: 0
2: 0
3: 2
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115755072 Original CRISPR CCCCGCGCCTTGAGGGTCCT TGG Intronic
900867366 1:5277874-5277896 CCGGGCCCCTTGTGGGTCCTCGG + Intergenic
901089219 1:6630232-6630254 CCCCGAGCTCTGAGGGTTCTTGG + Intronic
901404393 1:9036588-9036610 CCCAGCACTTTGAGGGGCCTAGG + Exonic
901670169 1:10851486-10851508 CGCCCCGCCTTTCGGGTCCTGGG - Intergenic
901859993 1:12068230-12068252 CCTGGAGGCTTGAGGGTCCTTGG + Intronic
902813596 1:18903193-18903215 CCCCGCGCCTGGAGGGTAGGTGG - Intronic
902828696 1:18995626-18995648 CCTCGCCCCTTGAGTTTCCTGGG - Intergenic
905580870 1:39081927-39081949 CCCAGCGCCCTGTCGGTCCTCGG + Intronic
906557041 1:46722128-46722150 TCCCTGGCCTTGAGGGTCCCGGG - Intergenic
906666039 1:47622770-47622792 CCCAGAGCCTAGAGCGTCCTGGG + Intergenic
907185003 1:52602646-52602668 CCGCGCGGCTGGAGCGTCCTCGG - Intronic
911067772 1:93806987-93807009 CCCAGCTACTTGAGGGGCCTAGG + Intronic
911285826 1:95991139-95991161 CCCAACGCTTTGGGGGTCCTAGG + Intergenic
915411814 1:155706840-155706862 CCCAGCGCTTTGAGAGGCCTAGG + Intronic
915677585 1:157546195-157546217 CCCAGCGCTTTGAGAGGCCTAGG + Intronic
915912705 1:159924524-159924546 CCCCGCGCCCTGTGCCTCCTGGG - Intronic
917648214 1:177049207-177049229 TCCTGTGCCTTGGGGGTCCTGGG - Intronic
917981379 1:180271756-180271778 CCGCCCGCCTAGGGGGTCCTGGG + Intronic
923698775 1:236281220-236281242 CCCTGCGCCTGGCGGGGCCTCGG + Intronic
1065993719 10:31036785-31036807 CCCAGCACTTTGAGAGTCCTAGG + Intergenic
1067551026 10:47236647-47236669 CCCAGTGCCCTGAGGGTTCTGGG - Intergenic
1071336106 10:84601530-84601552 CCCCCCACCTTGAGGGTGCAAGG - Intergenic
1073185871 10:101614720-101614742 AACAGAGCCTTGAGGGTCCTGGG - Intronic
1073363286 10:102917643-102917665 CCTCGCGCCTCGAGACTCCTAGG - Intergenic
1076153135 10:128179899-128179921 CCCAGCACCTTGAGGGGCCGAGG - Intergenic
1076317947 10:129556108-129556130 CCCAGCGCCATCAGGGTCCAAGG - Intronic
1078741095 11:14066923-14066945 CCCAGCACTTTGAGGGGCCTAGG + Intronic
1081401889 11:42653288-42653310 CCCAGCACTTTGGGGGTCCTAGG - Intergenic
1081676949 11:44975567-44975589 CCACCAGCCTTGAGGGGCCTGGG - Intergenic
1083616243 11:64028078-64028100 CCCCGCATCCTGAGAGTCCTGGG - Intronic
1083727661 11:64636922-64636944 CCCCTCCCCTTTGGGGTCCTAGG - Intronic
1083964778 11:66036664-66036686 CCCAGCACTTTGAGGGTCCAAGG + Intergenic
1085506977 11:77066511-77066533 CCCTGGCCCTTGCGGGTCCTCGG + Intergenic
1087424879 11:97973005-97973027 CCCAGTGCCTTCAGGGTGCTGGG - Intergenic
1088360701 11:108986012-108986034 CCTCTCTCTTTGAGGGTCCTGGG + Intergenic
1090799146 11:130159902-130159924 CCCCGCGCCCTGCGGGCCATGGG + Exonic
1094870266 12:34595744-34595766 CCCTGGGCCTTGGGGATCCTGGG + Intergenic
1096598657 12:52714305-52714327 CCCCGCGCCAGGGGCGTCCTCGG - Intergenic
1102066732 12:109982894-109982916 CCCAGCACTTTGAGGGTCCAAGG - Intronic
1105011997 12:132762058-132762080 CCCCGCGCCTCGCCGGTCCCAGG - Intergenic
1112508283 13:99988539-99988561 CCCCGCACCTGAAGGGGCCTCGG - Intergenic
1115755072 14:36521061-36521083 CCCCGCGCCTTGAGGGTCCTTGG + Intronic
1117617160 14:57545322-57545344 CCCCACCCCTTGAGCTTCCTGGG + Intergenic
1119380624 14:74225947-74225969 CCCCGCGCACTGTGGGTGCTGGG - Intergenic
1122208451 14:100159876-100159898 CCCCGCGCATCGAGGGACCCAGG - Exonic
1123710026 15:22980294-22980316 CGCGGCGGCTTGGGGGTCCTGGG + Exonic
1133902112 16:9986512-9986534 CCCAGCACCTTGAGGGGCCAAGG + Intronic
1143478047 17:7214225-7214247 CCCCGCGCCCTGAAGTTACTTGG + Intronic
1144955836 17:19018362-19018384 CCCCGAGCCTTGAGGGGCATGGG - Intronic
1145237676 17:21220568-21220590 CCCAGCACCTTGAGGGGCCAAGG - Intergenic
1146566912 17:33921491-33921513 CCCCTTGCCTTGAAGCTCCTTGG - Intronic
1150227504 17:63531879-63531901 CCCTGCTCCATGTGGGTCCTAGG + Intronic
1151930898 17:77230664-77230686 CGACGGTCCTTGAGGGTCCTTGG + Intergenic
1152645272 17:81465749-81465771 CCCCCAGCCTTGAGCCTCCTGGG - Exonic
1153885690 18:9463591-9463613 CCCAGCACTTTGAGAGTCCTAGG + Intergenic
1158743337 18:60168241-60168263 CCCCTACCCTTGAGGGTCCCTGG + Intergenic
1160799186 19:959958-959980 GGCAGCGGCTTGAGGGTCCTAGG + Intronic
1160966306 19:1748390-1748412 CCCCGCCCCGGGAGGGTCCGAGG - Intergenic
1162964850 19:14150915-14150937 CCCCAGGCCTTGAGGGGCCAGGG - Exonic
1164174664 19:22760492-22760514 CCCAGCACCTTGAGAGGCCTAGG + Intronic
1165464584 19:35966072-35966094 CCCCGGGCCTCCAGGGTCCCTGG - Intergenic
1165749964 19:38253513-38253535 CCACCCACCTTGAGGGGCCTCGG - Intronic
1166931620 19:46304676-46304698 TCCCCCGCTTTCAGGGTCCTGGG - Intronic
1167048797 19:47066795-47066817 CCCCCCGCGTTGGGAGTCCTCGG + Exonic
1168635065 19:57989800-57989822 CCCAGCACTTTGAGAGTCCTAGG + Intronic
927230866 2:20823057-20823079 CCGCTCTCCCTGAGGGTCCTGGG + Exonic
928180628 2:29065894-29065916 CCCAGCACTTTGAGAGTCCTAGG + Intronic
928654467 2:33435600-33435622 CACCGCGCCTGGCCGGTCCTTGG + Intergenic
929508484 2:42547579-42547601 CCCAGCGCTTTGAGAGGCCTTGG - Intronic
930053335 2:47233983-47234005 CCCTGCTCCTTCAGGGTCTTTGG + Intergenic
930177497 2:48315173-48315195 AGCCGAGCCCTGAGGGTCCTTGG - Intronic
933857262 2:86427995-86428017 CCCAGCACTTTGAGGGTCCAAGG + Intergenic
935249901 2:101252399-101252421 CCCAGCACTTTGAGAGTCCTAGG - Intronic
936147001 2:109986849-109986871 CCCCGCGCCCTGATGGGGCTGGG - Intergenic
936197691 2:110384634-110384656 CCCCGCGCCCTGATGGGGCTGGG + Intergenic
938381168 2:130837287-130837309 CCCCGCACCTGGACCGTCCTGGG + Intronic
939748624 2:146011377-146011399 CCCAGCACTTTGAGGGTCCAAGG + Intergenic
1171524579 20:25798945-25798967 CACCACGCCTTGAGGGCCATGGG - Intronic
1171552248 20:26056938-26056960 CACCACGCCTTGAGGGCCATGGG + Intergenic
1171793381 20:29548230-29548252 CACCACGCCTTGAGGGCCATGGG + Intergenic
1172580197 20:36041398-36041420 CCCCTCACCTTCAGGCTCCTGGG + Intergenic
1174179242 20:48664649-48664671 CCTCTCCCCTTGAAGGTCCTGGG - Intronic
1174554928 20:51387429-51387451 CCCTGAGCCATCAGGGTCCTGGG - Exonic
1175243576 20:57567684-57567706 CCCCGCCCCTTGGGGGCCTTTGG + Exonic
1179293943 21:40044010-40044032 CCCCGCACCTTGAGCTTCATGGG - Intronic
1180617192 22:17136113-17136135 CCCAGCGCTTTGAGGGGCCAAGG + Intergenic
1180617242 22:17136427-17136449 CCCAGCGCTTTGAGGGGCCAAGG + Intergenic
1181834127 22:25588047-25588069 CCCAGCGCTTTGAGGGGCCGAGG - Intronic
1183591450 22:38781439-38781461 CCCAGCTCCTGGAGGGCCCTGGG + Intronic
1184413589 22:44339477-44339499 GCCCTCGCCTGGAGGCTCCTGGG - Intergenic
1184602401 22:45551423-45551445 CCCCGCGACCTGAGGGTCAGTGG + Intronic
954296610 3:49677768-49677790 CCCCGCTCCCTGAGGATGCTGGG - Intronic
962103193 3:132364091-132364113 CCCAGCACCTTGAGAGTCCGAGG + Intronic
968230899 3:197003826-197003848 CCCCGCTCCCTCAGGGTTCTGGG + Intronic
969055279 4:4397718-4397740 CCTCGAGGCTTGGGGGTCCTGGG - Intronic
982435838 4:155383117-155383139 CCCCTGACCTTGAGGGTGCTGGG - Intergenic
983923326 4:173370763-173370785 CCCCGCGCCATGAGGGACGGAGG - Intronic
985569475 5:637045-637067 CCCCGGGTCTTGTGTGTCCTGGG + Intronic
992629373 5:78665921-78665943 CCTCTCGCCTTGATGGGCCTTGG - Intronic
993902467 5:93593900-93593922 CCCCGCGGCTTTGGAGTCCTTGG - Exonic
997564157 5:134874455-134874477 CCCCGCGTCATGCGGCTCCTCGG + Exonic
997830380 5:137144646-137144668 CCCTGAGCCTTGAGGCTGCTAGG - Intronic
1000334445 5:160231644-160231666 CCCAGCTCCTTGAGGGCCCGAGG - Intronic
1000770432 5:165346807-165346829 CCCAGCACCTTGAGGGGCCAAGG + Intergenic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1011931340 6:92718152-92718174 CCCAGCACTTTGAGGGTCCAAGG - Intergenic
1013147405 6:107407947-107407969 CCCAGCGCTTTGGGAGTCCTAGG - Intronic
1018904758 6:168069213-168069235 CCCCTGGCTCTGAGGGTCCTTGG - Intronic
1019613658 7:1949096-1949118 CCCTGCTCCTTGAGGCTCCAGGG + Intronic
1023056796 7:36297116-36297138 CTTCGAGCCTTGAGGGTTCTTGG - Exonic
1023945178 7:44797108-44797130 GTCCGCGCCTTGAGAGTCGTTGG + Intronic
1024535364 7:50426636-50426658 CTCCTCGCCTTGAGGGTGTTTGG - Intergenic
1026213646 7:68328982-68329004 CCCAGCGCCTTGGGAGGCCTAGG - Intergenic
1026312452 7:69198870-69198892 CCCCCAGCCTTGGGAGTCCTGGG - Intergenic
1027237803 7:76308247-76308269 CCCAGCACCTTGGGGGGCCTAGG + Intergenic
1033570338 7:142621657-142621679 CCCACCGCCATGAAGGTCCTTGG - Intergenic
1036170412 8:6479012-6479034 CCCAGCACTTTGAGGGTCCCAGG + Intronic
1041278807 8:56190805-56190827 CCCTGTGCCTTGATGGTCTTTGG - Intronic
1041378249 8:57224073-57224095 CCCAGCACTTTGAGGGCCCTGGG + Intergenic
1044658237 8:94570679-94570701 CCCAGCACCTTGAGGGGCCCAGG + Intergenic
1045163397 8:99574911-99574933 CCCAGCACTTTGAGAGTCCTAGG + Intronic
1049305341 8:141899872-141899894 CCCCGCTCCTGGAGGATCCATGG - Intergenic
1049544409 8:143222895-143222917 CCTCGCTCCTTCAGGATCCTTGG + Intergenic
1051027013 9:12625002-12625024 CCCACCACCTTGAGGGTCCATGG + Intergenic
1053287961 9:36862049-36862071 CCCCGCTCCGTGAGTGCCCTTGG - Intronic
1053792904 9:41699438-41699460 CACCACGCCTTGAGGGCCATGGG - Intergenic
1054152274 9:61615387-61615409 CACCACGCCTTGAGGGCCATGGG + Intergenic
1054181315 9:61911459-61911481 CACCACGCCTTGAGGGCCATGGG - Intergenic
1054472045 9:65546530-65546552 CACCACGCCTTGAGGGCCATGGG + Intergenic
1054656279 9:67669683-67669705 CACCACGCCTTGAGGGCCATGGG + Intergenic
1055234247 9:74100483-74100505 CCCAGCGCTTTGGGGGTCCAAGG - Intergenic
1056107578 9:83362531-83362553 CCCTGCCCCTTCAGGGTGCTTGG + Intronic
1057261874 9:93589078-93589100 CCCTGGACCTTGAGGGTCCTGGG - Intronic
1057605894 9:96497343-96497365 CCCAGCGCCTCGGGGGTCCCTGG - Intronic
1060303202 9:122388294-122388316 CCCAGCACCTTGAGAGGCCTAGG - Intronic
1062277915 9:135739395-135739417 CCCCTCGCCCTGATGTTCCTTGG + Intronic
1062501434 9:136853676-136853698 CCACGAGCCTTGGGGGTCCAGGG - Intronic
1203760921 EBV:12769-12791 CCCCGCGCCTGGCGCCTCCTCGG + Intergenic
1203761850 EBV:15841-15863 CCCCGCGCCTGGCGCCTCCTCGG + Intergenic
1203762779 EBV:18913-18935 CCCCGCGCCTGGCGCCTCCTCGG + Intergenic
1203763708 EBV:21985-22007 CCCCGCGCCTGGCGCCTCCTCGG + Intergenic
1203764637 EBV:25057-25079 CCCCGCGCCTGGCGCCTCCTCGG + Intergenic
1203765566 EBV:28129-28151 CCCCGCGCCTGGCGCCTCCTCGG + Intergenic
1203766495 EBV:31201-31223 CCCCGCGCCTGGCGCCTCCTCGG + Intergenic
1203767424 EBV:34273-34295 CCCCGCGCCTGGCGCCTCCTCGG + Intergenic
1195345031 X:103940971-103940993 CCCCACCCCTTGAGCTTCCTGGG + Intronic
1196832131 X:119784011-119784033 CCCAGCACTTTGAGGGGCCTAGG - Intergenic
1197654497 X:129102028-129102050 CCCAGCACCTTGGGAGTCCTAGG + Intergenic
1200162184 X:154015279-154015301 CCAGGCTCCTTGGGGGTCCTTGG - Intronic
1202245107 Y:22811928-22811950 CCCAGCGCTTTGAGGGGCCGAGG - Intergenic
1202398097 Y:24445674-24445696 CCCAGCGCTTTGAGGGGCCGAGG - Intergenic
1202472684 Y:25224412-25224434 CCCAGCGCTTTGAGGGGCCGAGG + Intergenic