ID: 1115755139

View in Genome Browser
Species Human (GRCh38)
Location 14:36521353-36521375
Sequence TGCCTCCAAGACACCCGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115755132_1115755139 -3 Left 1115755132 14:36521333-36521355 CCCCGGCCGGCCCCGGCAGGTGC No data
Right 1115755139 14:36521353-36521375 TGCCTCCAAGACACCCGCGCTGG No data
1115755127_1115755139 22 Left 1115755127 14:36521308-36521330 CCAGGGGCTGGGAGGGCGGAGCG No data
Right 1115755139 14:36521353-36521375 TGCCTCCAAGACACCCGCGCTGG No data
1115755134_1115755139 -5 Left 1115755134 14:36521335-36521357 CCGGCCGGCCCCGGCAGGTGCCT No data
Right 1115755139 14:36521353-36521375 TGCCTCCAAGACACCCGCGCTGG No data
1115755135_1115755139 -9 Left 1115755135 14:36521339-36521361 CCGGCCCCGGCAGGTGCCTCCAA No data
Right 1115755139 14:36521353-36521375 TGCCTCCAAGACACCCGCGCTGG No data
1115755133_1115755139 -4 Left 1115755133 14:36521334-36521356 CCCGGCCGGCCCCGGCAGGTGCC No data
Right 1115755139 14:36521353-36521375 TGCCTCCAAGACACCCGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115755139 Original CRISPR TGCCTCCAAGACACCCGCGC TGG Intergenic
No off target data available for this crispr