ID: 1115755478

View in Genome Browser
Species Human (GRCh38)
Location 14:36523272-36523294
Sequence GAGTTTCCCTGCGGCCACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115755478_1115755484 20 Left 1115755478 14:36523272-36523294 CCAGCGTGGCCGCAGGGAAACTC No data
Right 1115755484 14:36523315-36523337 ACTTTGCGAGACAAGAACAGAGG No data
1115755478_1115755485 21 Left 1115755478 14:36523272-36523294 CCAGCGTGGCCGCAGGGAAACTC No data
Right 1115755485 14:36523316-36523338 CTTTGCGAGACAAGAACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115755478 Original CRISPR GAGTTTCCCTGCGGCCACGC TGG (reversed) Intergenic
No off target data available for this crispr