ID: 1115755484

View in Genome Browser
Species Human (GRCh38)
Location 14:36523315-36523337
Sequence ACTTTGCGAGACAAGAACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115755478_1115755484 20 Left 1115755478 14:36523272-36523294 CCAGCGTGGCCGCAGGGAAACTC No data
Right 1115755484 14:36523315-36523337 ACTTTGCGAGACAAGAACAGAGG No data
1115755480_1115755484 -2 Left 1115755480 14:36523294-36523316 CCTTTCTCTCCCTCCAGTGTCAC No data
Right 1115755484 14:36523315-36523337 ACTTTGCGAGACAAGAACAGAGG No data
1115755479_1115755484 11 Left 1115755479 14:36523281-36523303 CCGCAGGGAAACTCCTTTCTCTC No data
Right 1115755484 14:36523315-36523337 ACTTTGCGAGACAAGAACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115755484 Original CRISPR ACTTTGCGAGACAAGAACAG AGG Intergenic
No off target data available for this crispr