ID: 1115756962

View in Genome Browser
Species Human (GRCh38)
Location 14:36538065-36538087
Sequence TCCCATAGCTTACACTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115756962_1115756965 18 Left 1115756962 14:36538065-36538087 CCAGCCCAGTGTAAGCTATGGGA No data
Right 1115756965 14:36538106-36538128 TCATTCATTGCCTAGCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115756962 Original CRISPR TCCCATAGCTTACACTGGGC TGG (reversed) Intergenic
No off target data available for this crispr