ID: 1115759995

View in Genome Browser
Species Human (GRCh38)
Location 14:36570500-36570522
Sequence AACTTCCAGAAGAAGAACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115759995_1115759996 16 Left 1115759995 14:36570500-36570522 CCATAGTTCTTCTTCTGGAAGTT No data
Right 1115759996 14:36570539-36570561 TTGCAAACATGCATAATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115759995 Original CRISPR AACTTCCAGAAGAAGAACTA TGG (reversed) Intergenic
No off target data available for this crispr