ID: 1115762173

View in Genome Browser
Species Human (GRCh38)
Location 14:36585394-36585416
Sequence TTCTAGAACCAGGAGCTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115762173_1115762178 6 Left 1115762173 14:36585394-36585416 CCCTGTAGCTCCTGGTTCTAGAA No data
Right 1115762178 14:36585423-36585445 GCAGCTTACCTGCTTCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115762173 Original CRISPR TTCTAGAACCAGGAGCTACA GGG (reversed) Intergenic
No off target data available for this crispr