ID: 1115762962

View in Genome Browser
Species Human (GRCh38)
Location 14:36594009-36594031
Sequence CTGAGTGCACAGCTTCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115762956_1115762962 6 Left 1115762956 14:36593980-36594002 CCTCTATTGGGTATGGTCCTCCT No data
Right 1115762962 14:36594009-36594031 CTGAGTGCACAGCTTCAGGAGGG No data
1115762955_1115762962 9 Left 1115762955 14:36593977-36593999 CCTCCTCTATTGGGTATGGTCCT No data
Right 1115762962 14:36594009-36594031 CTGAGTGCACAGCTTCAGGAGGG No data
1115762950_1115762962 28 Left 1115762950 14:36593958-36593980 CCCTTGACTGAAGACAGGTCCTC No data
Right 1115762962 14:36594009-36594031 CTGAGTGCACAGCTTCAGGAGGG No data
1115762951_1115762962 27 Left 1115762951 14:36593959-36593981 CCTTGACTGAAGACAGGTCCTCC No data
Right 1115762962 14:36594009-36594031 CTGAGTGCACAGCTTCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115762962 Original CRISPR CTGAGTGCACAGCTTCAGGA GGG Intergenic
No off target data available for this crispr