ID: 1115764131

View in Genome Browser
Species Human (GRCh38)
Location 14:36605268-36605290
Sequence CATTATGACCAGATTGTTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115764129_1115764131 19 Left 1115764129 14:36605226-36605248 CCTTTTTCATAGGACAAGAATAT No data
Right 1115764131 14:36605268-36605290 CATTATGACCAGATTGTTTTAGG No data
1115764128_1115764131 28 Left 1115764128 14:36605217-36605239 CCAGTCAGTCCTTTTTCATAGGA No data
Right 1115764131 14:36605268-36605290 CATTATGACCAGATTGTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115764131 Original CRISPR CATTATGACCAGATTGTTTT AGG Intergenic
No off target data available for this crispr