ID: 1115764131 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:36605268-36605290 |
| Sequence | CATTATGACCAGATTGTTTT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1115764129_1115764131 | 19 | Left | 1115764129 | 14:36605226-36605248 | CCTTTTTCATAGGACAAGAATAT | No data | ||
| Right | 1115764131 | 14:36605268-36605290 | CATTATGACCAGATTGTTTTAGG | No data | ||||
| 1115764128_1115764131 | 28 | Left | 1115764128 | 14:36605217-36605239 | CCAGTCAGTCCTTTTTCATAGGA | No data | ||
| Right | 1115764131 | 14:36605268-36605290 | CATTATGACCAGATTGTTTTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1115764131 | Original CRISPR | CATTATGACCAGATTGTTTT AGG | Intergenic | ||
| No off target data available for this crispr | |||||