ID: 1115768535

View in Genome Browser
Species Human (GRCh38)
Location 14:36647508-36647530
Sequence GGCCCCAGTCGAGGGCGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115768535_1115768540 0 Left 1115768535 14:36647508-36647530 CCTGCGCGCCCTCGACTGGGGCC No data
Right 1115768540 14:36647531-36647553 CGCTCCAGCAGTGAAGACCCAGG No data
1115768535_1115768542 11 Left 1115768535 14:36647508-36647530 CCTGCGCGCCCTCGACTGGGGCC No data
Right 1115768542 14:36647542-36647564 TGAAGACCCAGGCCCTTCCCTGG No data
1115768535_1115768546 18 Left 1115768535 14:36647508-36647530 CCTGCGCGCCCTCGACTGGGGCC No data
Right 1115768546 14:36647549-36647571 CCAGGCCCTTCCCTGGGCCGTGG No data
1115768535_1115768550 28 Left 1115768535 14:36647508-36647530 CCTGCGCGCCCTCGACTGGGGCC No data
Right 1115768550 14:36647559-36647581 CCCTGGGCCGTGGCTGCTCTTGG No data
1115768535_1115768543 12 Left 1115768535 14:36647508-36647530 CCTGCGCGCCCTCGACTGGGGCC No data
Right 1115768543 14:36647543-36647565 GAAGACCCAGGCCCTTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115768535 Original CRISPR GGCCCCAGTCGAGGGCGCGC AGG (reversed) Intergenic
No off target data available for this crispr