ID: 1115772731

View in Genome Browser
Species Human (GRCh38)
Location 14:36683216-36683238
Sequence GCCATTCCCACAGGGAGAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 190}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115772731_1115772735 -6 Left 1115772731 14:36683216-36683238 CCGATTCTCCCTGTGGGAATGGC 0: 1
1: 0
2: 1
3: 21
4: 190
Right 1115772735 14:36683233-36683255 AATGGCAGCCGGTTTTTTTGTGG 0: 1
1: 0
2: 0
3: 9
4: 118
1115772731_1115772739 14 Left 1115772731 14:36683216-36683238 CCGATTCTCCCTGTGGGAATGGC 0: 1
1: 0
2: 1
3: 21
4: 190
Right 1115772739 14:36683253-36683275 TGGGTAGGCGTCCTGAAGTGAGG 0: 1
1: 0
2: 1
3: 8
4: 110
1115772731_1115772737 -1 Left 1115772731 14:36683216-36683238 CCGATTCTCCCTGTGGGAATGGC 0: 1
1: 0
2: 1
3: 21
4: 190
Right 1115772737 14:36683238-36683260 CAGCCGGTTTTTTTGTGGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 115
1115772731_1115772736 -5 Left 1115772731 14:36683216-36683238 CCGATTCTCCCTGTGGGAATGGC 0: 1
1: 0
2: 1
3: 21
4: 190
Right 1115772736 14:36683234-36683256 ATGGCAGCCGGTTTTTTTGTGGG 0: 1
1: 0
2: 0
3: 5
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115772731 Original CRISPR GCCATTCCCACAGGGAGAAT CGG (reversed) Intronic