ID: 1115772734

View in Genome Browser
Species Human (GRCh38)
Location 14:36683225-36683247
Sequence AAACCGGCTGCCATTCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 88}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115772734_1115772737 -10 Left 1115772734 14:36683225-36683247 CCTGTGGGAATGGCAGCCGGTTT 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1115772737 14:36683238-36683260 CAGCCGGTTTTTTTGTGGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 115
1115772734_1115772739 5 Left 1115772734 14:36683225-36683247 CCTGTGGGAATGGCAGCCGGTTT 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1115772739 14:36683253-36683275 TGGGTAGGCGTCCTGAAGTGAGG 0: 1
1: 0
2: 1
3: 8
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115772734 Original CRISPR AAACCGGCTGCCATTCCCAC AGG (reversed) Intronic