ID: 1115772736

View in Genome Browser
Species Human (GRCh38)
Location 14:36683234-36683256
Sequence ATGGCAGCCGGTTTTTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115772731_1115772736 -5 Left 1115772731 14:36683216-36683238 CCGATTCTCCCTGTGGGAATGGC 0: 1
1: 0
2: 1
3: 21
4: 190
Right 1115772736 14:36683234-36683256 ATGGCAGCCGGTTTTTTTGTGGG 0: 1
1: 0
2: 0
3: 5
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115772736 Original CRISPR ATGGCAGCCGGTTTTTTTGT GGG Intronic