ID: 1115772737

View in Genome Browser
Species Human (GRCh38)
Location 14:36683238-36683260
Sequence CAGCCGGTTTTTTTGTGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115772734_1115772737 -10 Left 1115772734 14:36683225-36683247 CCTGTGGGAATGGCAGCCGGTTT 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1115772737 14:36683238-36683260 CAGCCGGTTTTTTTGTGGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 115
1115772731_1115772737 -1 Left 1115772731 14:36683216-36683238 CCGATTCTCCCTGTGGGAATGGC 0: 1
1: 0
2: 1
3: 21
4: 190
Right 1115772737 14:36683238-36683260 CAGCCGGTTTTTTTGTGGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 115
1115772733_1115772737 -9 Left 1115772733 14:36683224-36683246 CCCTGTGGGAATGGCAGCCGGTT 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1115772737 14:36683238-36683260 CAGCCGGTTTTTTTGTGGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115772737 Original CRISPR CAGCCGGTTTTTTTGTGGGT AGG Intronic