ID: 1115772739

View in Genome Browser
Species Human (GRCh38)
Location 14:36683253-36683275
Sequence TGGGTAGGCGTCCTGAAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115772733_1115772739 6 Left 1115772733 14:36683224-36683246 CCCTGTGGGAATGGCAGCCGGTT 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1115772739 14:36683253-36683275 TGGGTAGGCGTCCTGAAGTGAGG 0: 1
1: 0
2: 1
3: 8
4: 110
1115772731_1115772739 14 Left 1115772731 14:36683216-36683238 CCGATTCTCCCTGTGGGAATGGC 0: 1
1: 0
2: 1
3: 21
4: 190
Right 1115772739 14:36683253-36683275 TGGGTAGGCGTCCTGAAGTGAGG 0: 1
1: 0
2: 1
3: 8
4: 110
1115772734_1115772739 5 Left 1115772734 14:36683225-36683247 CCTGTGGGAATGGCAGCCGGTTT 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1115772739 14:36683253-36683275 TGGGTAGGCGTCCTGAAGTGAGG 0: 1
1: 0
2: 1
3: 8
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115772739 Original CRISPR TGGGTAGGCGTCCTGAAGTG AGG Intronic