ID: 1115776188

View in Genome Browser
Species Human (GRCh38)
Location 14:36717851-36717873
Sequence TCCTCTCTTTATAAGGTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 169}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115776188_1115776191 16 Left 1115776188 14:36717851-36717873 CCATCAACCTTATAAAGAGAGGA 0: 1
1: 0
2: 0
3: 13
4: 169
Right 1115776191 14:36717890-36717912 AGTGTGAGCGTCAGGAAAAATGG 0: 1
1: 0
2: 0
3: 21
4: 249
1115776188_1115776193 21 Left 1115776188 14:36717851-36717873 CCATCAACCTTATAAAGAGAGGA 0: 1
1: 0
2: 0
3: 13
4: 169
Right 1115776193 14:36717895-36717917 GAGCGTCAGGAAAAATGGAAGGG 0: 1
1: 0
2: 2
3: 16
4: 239
1115776188_1115776190 8 Left 1115776188 14:36717851-36717873 CCATCAACCTTATAAAGAGAGGA 0: 1
1: 0
2: 0
3: 13
4: 169
Right 1115776190 14:36717882-36717904 ATCAACTGAGTGTGAGCGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 75
1115776188_1115776192 20 Left 1115776188 14:36717851-36717873 CCATCAACCTTATAAAGAGAGGA 0: 1
1: 0
2: 0
3: 13
4: 169
Right 1115776192 14:36717894-36717916 TGAGCGTCAGGAAAAATGGAAGG 0: 1
1: 0
2: 0
3: 15
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115776188 Original CRISPR TCCTCTCTTTATAAGGTTGA TGG (reversed) Intronic
902659531 1:17891556-17891578 TCCTCTCCCTATCAGATTGAGGG - Intergenic
903916385 1:26767643-26767665 TCCTACCTTCATAAGGTTGAAGG - Intronic
904437199 1:30506626-30506648 TCCTCTCCTTCCAGGGTTGAGGG - Intergenic
905729866 1:40289937-40289959 TTCTCTCTGTAAAAGGGTGAAGG - Intronic
912149339 1:106838129-106838151 CCATCTCTTCTTAAGGTTGAGGG - Intergenic
917328507 1:173858172-173858194 TCCTCACTATATTATGTTGATGG - Exonic
919223766 1:194666255-194666277 TCCTCCCTGAATAAGGTTAAAGG + Intergenic
919651038 1:200148826-200148848 TCCTGTCCTTATAAGGGTGGAGG + Intronic
922092126 1:222406071-222406093 TCCTCTCTTCATGATGATGAAGG - Intergenic
922548976 1:226480073-226480095 CCCTCCCTTTAGAATGTTGAAGG + Intergenic
923969619 1:239185289-239185311 TCATCTTTTTATAAGGTGGATGG + Intergenic
1062994969 10:1857253-1857275 TCCTCTTTTCAAAAGGTTGTGGG + Intergenic
1063426574 10:5954941-5954963 TCAACTGTTTATAAGGTTTATGG + Intronic
1065048250 10:21763724-21763746 ACATCTTTTTATAAGGTGGAAGG - Intronic
1067211613 10:44264304-44264326 TCCTCTGTTTATAACAGTGATGG - Intergenic
1068680875 10:59818475-59818497 TCCTTTTATTATAATGTTGACGG + Intronic
1073520904 10:104128216-104128238 TCCTCTCTTAATACTGTTCATGG - Intergenic
1078738790 11:14047345-14047367 TCCCTTCTTTATCATGTTGAAGG + Intronic
1080092628 11:28366558-28366580 TCCTCTCTTCTTATGGGTGAAGG - Intergenic
1080910982 11:36598307-36598329 TTCTTTCTTTAGATGGTTGAGGG + Intronic
1082123419 11:48404431-48404453 TCCTCTCATTATGAGGTAGCTGG - Intergenic
1084027734 11:66463058-66463080 TCCTGTCTATAGAAGTTTGAGGG - Intronic
1086048476 11:82561021-82561043 TCCTGTCTGTATAGGGATGAGGG - Intergenic
1086594961 11:88559760-88559782 TCCTCTCTTTAATAAGTTCATGG + Intronic
1088815912 11:113420685-113420707 TCCTCTCTTGATAAGCTAGATGG - Intronic
1089925887 11:122256933-122256955 ATCTCTCTTTATGAGGCTGAGGG + Intergenic
1093029729 12:14277088-14277110 TTCTCTCTTACTAAGGTTGCAGG + Intergenic
1093670076 12:21863202-21863224 TCATTTCTTAATAAGGTTGGTGG - Intronic
1098670903 12:73230104-73230126 TCTTCTCTTTTTAATTTTGATGG - Intergenic
1099622626 12:85024277-85024299 TCCTGCTTTTATAAGGTTTATGG - Intronic
1099973899 12:89526089-89526111 TCCTCTCTTTACAGGGCTGGCGG - Exonic
1100783215 12:98051378-98051400 TTCTCTCTTTTTAATGTTGCTGG + Intergenic
1101163208 12:102000586-102000608 GACACTCTTTATCAGGTTGAGGG + Intronic
1101787426 12:107897142-107897164 TATTTTATTTATAAGGTTGATGG + Intergenic
1102213398 12:111143494-111143516 TCCTGTCTTGGCAAGGTTGATGG + Intronic
1103205125 12:119123083-119123105 TCCTCTCTTTAGAAGCTTCTTGG - Intronic
1105543624 13:21336477-21336499 TGCTCTCTTTATAAGGGACAGGG - Intergenic
1107711845 13:43158293-43158315 TCCCCTCTTTATAGGCTTAATGG + Intergenic
1109031362 13:57193876-57193898 TCCTATCTTTAGAAGGTCGCTGG - Intergenic
1112150592 13:96757061-96757083 TCCTCTGTTTTCAGGGTTGATGG + Intronic
1112445623 13:99461989-99462011 ACCTCTCTTTAGAAGGATAAGGG + Intergenic
1112457143 13:99573318-99573340 TCCTTTCTTTTGAAGGTTTAAGG + Intergenic
1112950990 13:104996657-104996679 CCCTCTCTTTATAAAGGTAAGGG + Intergenic
1113766519 13:112884297-112884319 TCTTCTATTTTTAAGGCTGAAGG - Exonic
1114469500 14:22949684-22949706 TACTCTCTGTATAAGCTTGGAGG - Intronic
1114469673 14:22951308-22951330 TACTCTCTATATAAGCATGAAGG + Intronic
1115776188 14:36717851-36717873 TCCTCTCTTTATAAGGTTGATGG - Intronic
1116010809 14:39349612-39349634 TCTTCTCTTTTTAAAGTTAAAGG + Intronic
1117556533 14:56891790-56891812 TCCTTGTTTTATAAGGTGGAGGG - Intergenic
1122168284 14:99848656-99848678 TTCTGTCTTTAAAAGTTTGAAGG + Intronic
1124643638 15:31418236-31418258 TTCTCTCTTTTTATGTTTGAAGG - Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1131039602 15:89251532-89251554 TGCTATCTTTATGAGGTTTAAGG - Intronic
1133619024 16:7508369-7508391 GTCTCTCTTTCCAAGGTTGAAGG + Intronic
1133876909 16:9743622-9743644 TTCTCTCTTCATATGCTTGATGG - Intergenic
1134333263 16:13269825-13269847 TCCCCTATTTATAAGATAGATGG - Intergenic
1138931399 16:61661672-61661694 TCTTCTTTTTATATGGCTGATGG - Intronic
1139826554 16:69762094-69762116 CCCTGCCTCTATAAGGTTGATGG + Intergenic
1141780287 16:86155060-86155082 TCCCCTCTTTATGAGGTTTTGGG - Intergenic
1142749002 17:1976436-1976458 TTCTCTCTGCATGAGGTTGAGGG + Intronic
1144314365 17:14045970-14045992 TCCTCTTTTTAAGAGGCTGAGGG + Intergenic
1144360117 17:14484167-14484189 TCCTCTCTTTACCAGGAGGAAGG + Intergenic
1145772026 17:27500140-27500162 TGCACTCTTTATAAGCTTGCTGG - Intronic
1155632992 18:27917373-27917395 TCCTCTGTTTTTACAGTTGAAGG - Intergenic
1157608786 18:48942964-48942986 ACCTGTCTTTAAAAGGATGAAGG - Intronic
1163894699 19:20048132-20048154 TCCTAGCTATATAAGGTTGTTGG - Intergenic
1164505454 19:28856989-28857011 TATTATCTTTATAAGGTGGACGG - Intergenic
1164692359 19:30220747-30220769 TCCTCACTTAATATTGTTGATGG + Intergenic
1165907855 19:39204464-39204486 GTCTCTCTTTATAATGTTGTTGG - Intergenic
1167623059 19:50569284-50569306 TCTTCTCTTCATGAGGTGGAGGG - Intergenic
925701262 2:6640703-6640725 TCCTTTCTATAGAAGCTTGAAGG - Intergenic
925804538 2:7635161-7635183 GCCTCTTTAGATAAGGTTGATGG + Intergenic
930385003 2:50683309-50683331 TGCTCTCTTAATAAGGGAGAAGG + Intronic
931600313 2:63996374-63996396 TCCTCAGCTTATAAGGATGATGG - Intronic
933120611 2:78532484-78532506 TCCTCTCTCTGTATGGTTAAAGG + Intergenic
935343548 2:102081807-102081829 TCCTCTCTTGATTACGTTGGTGG + Intronic
936279790 2:111128273-111128295 TCCTTCCTTTTTAAGGCTGAAGG + Intronic
939797061 2:146658149-146658171 TCCTTTCTTTAGAAGGTAAAGGG - Intergenic
941388019 2:164877262-164877284 CCTTCTCTTTGAAAGGTTGAGGG - Intergenic
941590426 2:167414009-167414031 TCCTTTCTCTATTAGGTTCATGG + Intergenic
941810153 2:169747660-169747682 TCCTCACATTATAACGTAGAAGG - Intronic
946936810 2:224730418-224730440 TTCTCTCTTTCCAAGGGTGAAGG + Intergenic
947782045 2:232776583-232776605 TCCTCTGTTTATAATGTTGTGGG + Intronic
948278311 2:236727172-236727194 ATTTCTCTTTATCAGGTTGAGGG + Intergenic
948542031 2:238697910-238697932 TCCCCTCTTTGGAAGGTTGCAGG + Intergenic
1170153757 20:13251197-13251219 TCCTCTCCTTCTGATGTTGAAGG + Intronic
1171125330 20:22597422-22597444 TCCTCTCTCAGTAAGGTGGAGGG + Intergenic
1172952507 20:38730976-38730998 TCCCGTCTTTAAAAGGTCGAAGG + Intergenic
1173336693 20:42117813-42117835 TCCTTTCTTTTTAAGATGGAAGG + Intronic
1178854844 21:36241908-36241930 TCCTGTCTTTATAAGGCTCCTGG + Intronic
1179586047 21:42374943-42374965 TCCTCACTTAATACGGTTGATGG - Intronic
1182053891 22:27334561-27334583 TCCTCTCTTTATAAGGACACTGG + Intergenic
949214144 3:1545152-1545174 TCATTTCTTTATGATGTTGATGG + Intergenic
949293091 3:2488269-2488291 TCATTTCCTTATAAGTTTGAGGG + Intronic
949390920 3:3561299-3561321 TCCTCTCTTTATTAGAGTTATGG - Intergenic
949653969 3:6194904-6194926 ACCTCCCTTTAAAAGGTTAATGG + Intergenic
956649990 3:71495954-71495976 TCCTCACTTTATCAGCTTCAAGG + Intronic
957195730 3:77064877-77064899 TCATTTTTTCATAAGGTTGATGG + Intronic
957513180 3:81216036-81216058 TCCCCCCTTTATATGGGTGAAGG - Intergenic
960816973 3:121683816-121683838 TCTTCTCTTTCTAAGGCTAATGG - Intronic
961070537 3:123919956-123919978 TCTTCTCTTTAAAATGTTCAGGG + Intronic
964682199 3:159354416-159354438 GCCTCTCTTTATAATATTCAGGG - Intronic
967604312 3:191426037-191426059 TCTTCTCTTCATAAAGTTGAAGG - Intergenic
968310869 3:197682180-197682202 TCTTCTCTTTCTAAGATAGATGG - Intronic
971080053 4:23199609-23199631 TCCTCTCTCTAAAGAGTTGAAGG - Intergenic
971536734 4:27761701-27761723 TCCTCTCCTTATATGGGTGTCGG + Intergenic
971946969 4:33291035-33291057 TCCTGTCTTCTAAAGGTTGAAGG + Intergenic
972849393 4:43030344-43030366 TACTCTCTGTATAAGGTGGCAGG - Exonic
974517316 4:62934845-62934867 ATCTCTCTTTATAAAATTGAAGG - Intergenic
976825050 4:89251193-89251215 TCATCTTTTCATAAGCTTGATGG - Intronic
977349624 4:95865306-95865328 TATTCTCTTTATAAAGTGGAGGG + Intergenic
978982573 4:114967051-114967073 TCCTATCTTGATACTGTTGATGG + Intronic
980055432 4:128074469-128074491 TCCTGCCTTTATAATTTTGAGGG - Exonic
982188583 4:152828825-152828847 TGCTCTCTTTATGAGCTTTATGG + Intronic
984348048 4:178556993-178557015 ACCTGTCTTCATAAGGTTCATGG + Intergenic
985106415 4:186504480-186504502 TGCTTTCTTTATACCGTTGATGG + Intronic
987207608 5:15643681-15643703 TTCTCTCAATACAAGGTTGATGG + Intronic
987561039 5:19520325-19520347 TTCTCTCTTAATGAGGTTGATGG - Intronic
987596108 5:20001481-20001503 TCTGTTCTTTATGAGGTTGATGG - Intronic
987731371 5:21776999-21777021 TCATTTCATTATAAGGTTAATGG + Intronic
989773327 5:45171430-45171452 TCCTCCCTTTATAAAAGTGAAGG + Intergenic
990266349 5:54081006-54081028 TCCTCATTTGATAGGGTTGATGG - Intronic
990768359 5:59213630-59213652 GCATCTCTTTAAAAGGCTGATGG - Intronic
992401834 5:76418775-76418797 TCCTCTCTTTATAAAGCTTATGG + Intronic
993314344 5:86380930-86380952 TCTTCTTTTTATAGGGTTTATGG - Intergenic
993583951 5:89699892-89699914 TCCTCTCCTTATAAACTTGCAGG + Intergenic
993874329 5:93288750-93288772 TCCTCTTCTTATAAGGATGCCGG + Intergenic
995594008 5:113729550-113729572 TCCTCAGTTTATGAGGATGACGG + Intergenic
1000846091 5:166281951-166281973 TCCTACTTTTATAAAGTTGATGG + Intergenic
1001673502 5:173493375-173493397 TCCTCTCTTTAGAAAGATGCAGG - Intergenic
1002793799 6:454395-454417 TCCTCTTTTCTTAAGGTGGAAGG + Intergenic
1004492726 6:16130957-16130979 TCTTGTCTTTATAAACTTGATGG + Intronic
1011141770 6:84165561-84165583 TCTTCTCTTTATTAGGCTGAAGG + Intronic
1013137376 6:107295547-107295569 TTCTCTCTTTATCAGGTTGTTGG - Intronic
1013513271 6:110862789-110862811 TTCTCTCTCTTTAATGTTGAAGG + Intronic
1014461556 6:121702907-121702929 TCATGTCTTTTTAAGGTGGAAGG - Intergenic
1014953332 6:127585475-127585497 TCCTCTCTATAAAAGATCGAAGG - Intronic
1015508079 6:134009842-134009864 TTCTCTCTTTATTGGGGTGAGGG - Intronic
1016657738 6:146541465-146541487 TTCTCTATCTATAAAGTTGAGGG - Intergenic
1017177816 6:151521177-151521199 TACTCTCTTTATTAAATTGAGGG + Intronic
1017542888 6:155421304-155421326 TACTTACTTTATAAGGTTGTTGG + Intronic
1018475003 6:164131797-164131819 TCCTCTGTTTATTAGGTGAAGGG - Intergenic
1021783321 7:24128225-24128247 TCCTCTTTTTTTAATGTTCATGG + Intergenic
1024495014 7:50035819-50035841 TCCTCTCTTTAACATTTTGAGGG - Intronic
1024574072 7:50749756-50749778 CCCTCTCTTTATACTGTTAATGG - Intronic
1029123776 7:98284183-98284205 TCCTCTCTGGACAAGGTTGGGGG + Intronic
1029522641 7:101073731-101073753 TCTTCTCTGTGTAAGGTTGGTGG + Intergenic
1030281652 7:107782270-107782292 TCCTCTGCCTATAAGCTTGAGGG - Intronic
1030542813 7:110853404-110853426 TACTCTCTATAGAAAGTTGATGG - Intronic
1032916479 7:136495551-136495573 TGCTCTCTGCATAAGGCTGAAGG + Intergenic
1033057165 7:138067894-138067916 TCCAATTTTTACAAGGTTGAAGG - Intronic
1036781428 8:11650571-11650593 TCCTCTTCTTATAAGGATGCCGG + Intergenic
1037009490 8:13823000-13823022 TTCTCTCTTTAAAATGTTTAAGG + Intergenic
1037783402 8:21886691-21886713 TCCTCTCATTATAAGGACAATGG - Intergenic
1038060067 8:23902802-23902824 TCCTCTCTTTATAATAATTAGGG + Intergenic
1039717421 8:40125167-40125189 TGCTCTGTTTATATAGTTGAAGG - Intergenic
1041828864 8:62129632-62129654 TGCTCTGTTTAGAAGTTTGATGG - Intergenic
1042015094 8:64300228-64300250 TCCTATCTTTATAGAGTTCAAGG + Intergenic
1042366431 8:67942034-67942056 TCCTTTCTTTAATGGGTTGAAGG - Intergenic
1043107370 8:76131651-76131673 TCGTCTCTTTATTCTGTTGATGG + Intergenic
1045157104 8:99489050-99489072 TACTTTCTGTATAAGGTTTAAGG + Intronic
1047617350 8:126573657-126573679 CCCTGTCTTTATATGGTGGATGG - Intergenic
1047669485 8:127129058-127129080 TCTTCTCTTTTTGAGGTTGAGGG - Intergenic
1048018678 8:130519547-130519569 TCCCCTCTTTTTAAGGTTTGGGG + Intergenic
1049077150 8:140407547-140407569 CCCTTTCTTTAAAAGGTGGAGGG - Intronic
1049382152 8:142322266-142322288 GCCTCTCTGTATCAGGTTGAGGG - Intronic
1049626757 8:143626795-143626817 TCCTCTCTTTATAAGAATATCGG - Intergenic
1050740586 9:8814832-8814854 TCCCCTCTTATTAAGGTTAAGGG - Intronic
1050747080 9:8888947-8888969 TCCTTTCCTTATAAGGTTATTGG + Intronic
1055445411 9:76377466-76377488 TCCTCTCTGTAGGGGGTTGAGGG - Intergenic
1055899118 9:81214046-81214068 TTCTCTCCTTATAAGGTTACTGG - Intergenic
1057634821 9:96754875-96754897 TTCTATCTTTATTAGCTTGAAGG + Intergenic
1058799241 9:108529289-108529311 TGCTCTCTTTTTAAATTTGATGG + Intergenic
1059137748 9:111823221-111823243 TTCTCTCTTCATAACATTGAGGG - Intergenic
1062121637 9:134836926-134836948 TCATCCCTGTGTAAGGTTGATGG + Intronic
1185648923 X:1634603-1634625 TCCTCTCTTTAGAATGTGGAGGG + Intronic
1186666622 X:11723499-11723521 ACCTCTCTTTATAAAGTGAAGGG - Intergenic
1186917284 X:14237124-14237146 TCCTTCCTTGATAAGGCTGATGG - Intergenic
1187922362 X:24217500-24217522 CCCACTGTTTGTAAGGTTGAGGG - Intergenic
1194427550 X:93758213-93758235 TCATCTCATTATAAGGTTCTAGG + Intergenic
1196494674 X:116310626-116310648 TCTTCTCTCTATAAGGTGCAAGG - Intergenic
1197398115 X:125952910-125952932 TTATCTCTTTCTAAGGCTGAAGG - Intergenic
1198039052 X:132831217-132831239 TCCTCTCTTTGTCAGGTTTCTGG - Intronic