ID: 1115777237

View in Genome Browser
Species Human (GRCh38)
Location 14:36729047-36729069
Sequence CAGACTGAAGGGCCTTTTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 5, 3: 17, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115777237_1115777241 8 Left 1115777237 14:36729047-36729069 CCTATAAAAGGCCCTTCAGTCTG 0: 1
1: 0
2: 5
3: 17
4: 141
Right 1115777241 14:36729078-36729100 CACAGAGTGACTTTATCCCAAGG 0: 1
1: 0
2: 1
3: 6
4: 147
1115777237_1115777242 9 Left 1115777237 14:36729047-36729069 CCTATAAAAGGCCCTTCAGTCTG 0: 1
1: 0
2: 5
3: 17
4: 141
Right 1115777242 14:36729079-36729101 ACAGAGTGACTTTATCCCAAGGG 0: 1
1: 0
2: 0
3: 14
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115777237 Original CRISPR CAGACTGAAGGGCCTTTTAT AGG (reversed) Intronic
904420451 1:30387543-30387565 CACACTGAGGGGCCTTATGTAGG + Intergenic
906565999 1:46801514-46801536 CTGTCTGAAGGGCCTTCTCTTGG + Intronic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
907888533 1:58616559-58616581 CAAACTGAATTGCCTTTAATTGG - Intergenic
908893144 1:68868330-68868352 CAGACAAAAGAGCCTTCTATTGG - Intergenic
918009083 1:180569721-180569743 CAGCCTGAAGGGACTTCCATGGG + Intergenic
920966807 1:210707778-210707800 CACATTGATGGCCCTTTTATAGG - Intronic
924197767 1:241625973-241625995 CAGAGTGTTTGGCCTTTTATTGG - Intronic
1069722601 10:70559376-70559398 CAGACTGTGGGGCCTTTTCTGGG + Intronic
1075585922 10:123658167-123658189 CAGACTGAAGGATGTATTATTGG - Intergenic
1079132874 11:17759019-17759041 CAGATTAAACGGCCTTCTATTGG - Intronic
1079755280 11:24251502-24251524 CAGACAGAAGTGCATTTTCTGGG + Intergenic
1083185104 11:61012923-61012945 GAGAATGAAGTGCCTTTTGTAGG + Intronic
1085257166 11:75181671-75181693 CAGACAGGAGGGCCTTCCATGGG + Intronic
1086854293 11:91848048-91848070 CAGAATGAAAGGAATTTTATAGG - Intergenic
1087272994 11:96130695-96130717 AAGACTGAAGGACCATTTGTAGG - Intronic
1089721710 11:120430800-120430822 CATACTGTATGGCCTTGTATAGG - Intronic
1089753276 11:120667101-120667123 CAGACTGAAGGGGGTCTTAGAGG - Intronic
1090707280 11:129350011-129350033 CAAACTGAAGAAGCTTTTATCGG - Intergenic
1096855765 12:54481410-54481432 AAGACTGTATGGCCTTTTAAGGG + Intergenic
1097206558 12:57326685-57326707 TAGACAAAAGAGCCTTTTATTGG + Intronic
1098145981 12:67498423-67498445 CAGCCAGAAGGGCCTATTCTTGG - Intergenic
1100209202 12:92383798-92383820 CAGGCTGAAGGGTCTTTTGGAGG - Intergenic
1100470227 12:94885438-94885460 CAAATTGAAGGGGCTCTTATTGG - Intergenic
1101477712 12:105066219-105066241 CAGACTGAAGAGGCGTTTCTGGG + Intronic
1104058704 12:125249998-125250020 CAGAGTGCAGGGCGTTTTATTGG + Intronic
1105583948 13:21726654-21726676 CTGTCTGAAGGACCTTTTCTGGG - Intergenic
1107439534 13:40413004-40413026 CAGACTGTGGGGACCTTTATAGG - Intergenic
1108776413 13:53770549-53770571 CAGACAGAATAGCCTTATATTGG - Intergenic
1109647443 13:65276632-65276654 CAGACTTAACTGGCTTTTATTGG - Intergenic
1110358211 13:74593843-74593865 CATACAGAAAGGCCTTTTAAAGG - Intergenic
1111273929 13:85923520-85923542 TAGACTGAAGAGCCTTTTATTGG - Intergenic
1115373364 14:32644847-32644869 AAGACTGAAGGGAATTTTATTGG - Intronic
1115777237 14:36729047-36729069 CAGACTGAAGGGCCTTTTATAGG - Intronic
1117140277 14:52784010-52784032 CAGCCTGAAGGGCCTAATTTTGG - Intronic
1118807846 14:69253192-69253214 CAGACTGATGGGCCTTTTGATGG + Intergenic
1118904833 14:70016194-70016216 CAGACAGAAGGGATTTTTACAGG + Intronic
1123476907 15:20597053-20597075 CGGACTGCAGGGCATTTTAGGGG + Intergenic
1123641104 15:22403311-22403333 CGGACTGCAGGGCATTTTAGGGG - Intergenic
1125081734 15:35682186-35682208 CAAACTGAAGGGTCTTTTATGGG + Intergenic
1127778675 15:62291625-62291647 CAGAAAGAAGGGCCTTTTCTGGG - Intergenic
1129050923 15:72781300-72781322 GATTGTGAAGGGCCTTTTATGGG - Intronic
1129486806 15:75881475-75881497 CACAAAGAAGGGCCTTTTCTGGG + Intronic
1130266582 15:82410256-82410278 CAGAAAGAAGGGCCTTTTCTGGG + Intergenic
1130505446 15:84536629-84536651 CAGACAGAAGGGCCTTTTCTGGG - Intergenic
1133527084 16:6616103-6616125 CAAACTGAAGAATCTTTTATAGG + Intronic
1137227215 16:46524636-46524658 CAGAAGGAAGGGGCCTTTATCGG + Intergenic
1138337619 16:56265656-56265678 CTGACTGAAAGGCCTGTTCTTGG - Intronic
1140626160 16:76796830-76796852 CAGATTCAAAAGCCTTTTATCGG + Intergenic
1144490048 17:15700504-15700526 GAGACTGAAGGGCTTGGTATGGG + Intronic
1146096941 17:29939508-29939530 CAGACTAAACAGCCTTCTATTGG - Intronic
1150418549 17:65007677-65007699 CAGAATGAAGGGCTTTCTCTTGG - Intergenic
1152643065 17:81457209-81457231 CAGCCTGAAGGGATTTGTATGGG - Intronic
1153012658 18:553647-553669 CAGATTGAAGAGCATTTTACAGG + Intergenic
1155170157 18:23261017-23261039 AAGTCTAAAGGGCCCTTTATGGG - Intronic
1156047203 18:32890146-32890168 CAGCCACAAGGCCCTTTTATAGG - Intergenic
1156673371 18:39497864-39497886 GAAAGTGAAGGGCCTTTCATTGG + Intergenic
1158135478 18:54203261-54203283 AATACTGAAGCCCCTTTTATAGG + Intronic
1162881253 19:13661415-13661437 CTGAATTAAGGGCCTTTTAGAGG - Intergenic
1165531310 19:36404209-36404231 CAGACTGAAGGACCCTCTTTTGG + Intronic
1167959773 19:53096499-53096521 CAGAATTTAGGGTCTTTTATTGG - Intronic
1167963573 19:53126340-53126362 CAGAATTTAGGGTCTTTTATTGG - Intronic
926517676 2:13869462-13869484 CAGAGTGAAGAGCATTTTCTAGG - Intergenic
931895318 2:66722381-66722403 TAGACAGAAGAGCCTTCTATTGG + Intergenic
937034001 2:118765540-118765562 GAGACAGAAGGGCCTTTTCTTGG + Intergenic
940996359 2:160154414-160154436 CACACAGCAGGGCCTGTTATGGG + Intronic
942888163 2:180954123-180954145 CTGACTTAATGGCCTTTTCTAGG - Intergenic
943516552 2:188894667-188894689 AAGACTAAAGGACTTTTTATTGG - Intergenic
943521398 2:188955030-188955052 CAGGCTGAAGGGGCTCTGATTGG - Intergenic
943573993 2:189609317-189609339 CAGACTGAAGCAACTTTTACGGG - Intergenic
943765002 2:191651162-191651184 CTGCCTGAAGGGGCTTTTAGGGG + Intergenic
944150552 2:196553902-196553924 CTGACTGAAGAGTTTTTTATTGG - Intronic
946185127 2:217976498-217976520 CAGACAGATGGGCTTTGTATAGG - Intronic
947458162 2:230276161-230276183 TAGACTAAACGGCCTTTTATTGG + Intronic
1168761842 20:354727-354749 CAGCCTGAAGGGCCTCCTAGGGG + Exonic
1169867392 20:10216899-10216921 CATACTCAAGAGACTTTTATTGG + Intergenic
1170854334 20:20036875-20036897 CAGACTCAAGGGGCTTAGATTGG - Intronic
1172753652 20:37268542-37268564 CAAACAGAAGGGCCTGTGATTGG + Intergenic
1174258462 20:49277083-49277105 CAGACTGAAGTGTTTTTTTTTGG + Intronic
1175529178 20:59662475-59662497 CAGACTCATGGGCCTTTCGTTGG - Intronic
1175762602 20:61571641-61571663 CCCACTGAAGGACCTTCTATAGG + Intronic
1177337206 21:19745251-19745273 CAGTTTGAAGGGGTTTTTATTGG + Intergenic
1182170946 22:28228773-28228795 GACACTGAAGATCCTTTTATTGG + Intronic
1182894582 22:33848682-33848704 CAGAATGAGGGGTCTTTAATTGG - Intronic
1184161208 22:42698391-42698413 CAGCTTGGAGGGCCTTTTCTAGG - Intronic
1184574825 22:45355103-45355125 CAGACTGTAGAGCCTATTATGGG + Exonic
1184978384 22:48079257-48079279 CTGACTGAAGCCCCTATTATGGG + Intergenic
953544096 3:43849506-43849528 CATACACAAGGGCCTTTTGTGGG + Intergenic
956491911 3:69781607-69781629 CAGAGTTAATGGCCCTTTATCGG - Intronic
957384707 3:79481017-79481039 CAGATTTTATGGCCTTTTATTGG + Intronic
957674682 3:83351173-83351195 TAGACTGAAGTGCTTTTTTTTGG + Intergenic
958891774 3:99791619-99791641 CACACTGAGGGGCATTTTGTTGG - Intronic
959013364 3:101104871-101104893 CAAAAGGAAGGTCCTTTTATTGG - Intergenic
962275349 3:134009112-134009134 CAGACTGTAGGGCTTTTTAATGG + Intronic
962672620 3:137724829-137724851 TAGACAGAAGGATCTTTTATTGG - Intergenic
966364117 3:179164319-179164341 CTGACTGAAAGGTCTATTATGGG - Intronic
969005237 4:4013651-4013673 CACACACAGGGGCCTTTTATGGG - Intergenic
969402109 4:6962559-6962581 CCCACTGAAGGGCCCTTTGTTGG + Intronic
971356873 4:25903033-25903055 CAGCCTGAAAAGCCTTTTATTGG + Intronic
974416394 4:61612728-61612750 CAGAATAAAGGGCCATTTATAGG + Intronic
975657404 4:76655406-76655428 AGGACTGAAGGTCCTCTTATTGG - Intronic
976612644 4:87045872-87045894 CAAACTGAACAGCCTTTTATAGG - Intronic
976682747 4:87775264-87775286 TAAACTGAGAGGCCTTTTATCGG + Intergenic
978324630 4:107538422-107538444 CTGCTTGAAGTGCCTTTTATAGG + Intergenic
981436103 4:144723822-144723844 CATGCTGAATGGACTTTTATAGG - Intronic
982678115 4:158399514-158399536 CAGGCTGAAGGGCCATTCCTGGG - Intronic
988757376 5:34271310-34271332 TAGACAAAACGGCCTTTTATTGG + Intergenic
990343798 5:54851464-54851486 TCTACTGAAGGGGCTTTTATGGG - Intergenic
990686499 5:58308762-58308784 CAGACACCAGGGCCTGTTATGGG + Intergenic
991153274 5:63397884-63397906 AAGACTGAAGGGCCTGTACTTGG + Intergenic
993209238 5:84926811-84926833 CAGTCTCAAGGGCCTTTCACTGG - Intergenic
993572661 5:89561165-89561187 CAGACTGAAGGCTGTATTATTGG - Intergenic
994061075 5:95477071-95477093 CATATTGAAGGGCATGTTATAGG + Intronic
994863819 5:105236964-105236986 AAAATTGAAGGCCCTTTTATAGG + Intergenic
1000979052 5:167797218-167797240 CAGACTGAAGGGCCTTGGGATGG - Intronic
1002599085 5:180344085-180344107 CACACAGCAGGGCCTTTTACAGG + Intronic
1004113033 6:12739052-12739074 CAGTTTGAAGGGGCTTATATGGG - Intronic
1004755592 6:18607414-18607436 CAGACTGAAAGTTCTTTTACCGG + Intergenic
1007357331 6:41331354-41331376 CAGACAGTAGGGCCTTCTCTTGG + Intergenic
1008373404 6:50763006-50763028 CTGACTGAAGGGCTATTCATAGG - Intronic
1011554270 6:88558167-88558189 CATACTGCAGGGCCTGTTCTGGG + Intergenic
1012119372 6:95345037-95345059 TAGACTAAACAGCCTTTTATTGG - Intergenic
1012299370 6:97565320-97565342 CAGCTTGAAGGGCCTTTGAGTGG + Intergenic
1012519422 6:100103214-100103236 CAGACTAAAGAGCCTGTGATTGG - Intergenic
1016773714 6:147880914-147880936 CATTCTCAAGGGCCTTTTCTTGG + Intergenic
1021101964 7:16594526-16594548 CAGACTGACAGGCCTTTGTTGGG + Intergenic
1022411721 7:30143672-30143694 CAGACAGAAGGCCCTTTCGTGGG + Intronic
1027924268 7:84440482-84440504 CTGGCTGAAGTGACTTTTATGGG + Intronic
1028059736 7:86297413-86297435 CAGATTGAAGGGGATTTGATAGG - Intergenic
1030619708 7:111775633-111775655 CCGACTAAAGGGACTTTTCTTGG - Intronic
1034035569 7:147817097-147817119 CAGAATGAAGGACATTTTATAGG + Intronic
1034118711 7:148607953-148607975 GAGATTGAAGGCCATTTTATCGG - Intronic
1034796313 7:154016806-154016828 CAAAATGAAGTGGCTTTTATTGG - Intronic
1035378091 7:158420264-158420286 AAGACTGAGGGGCCTTTTCGCGG - Intronic
1042091490 8:65164516-65164538 CAGACTGAAGAGCCATATTTTGG - Intergenic
1042532686 8:69832188-69832210 CAGACTGTAGCGCCTTTCAATGG + Exonic
1042977168 8:74482099-74482121 CAAACTGAAGGGTTTTTTTTTGG + Intronic
1043982885 8:86660921-86660943 CAGAAAGAAGGGCCTTTTCTGGG - Intronic
1044430363 8:92101618-92101640 CAAACTGAAAGGCCTTTTGGGGG + Intronic
1044522797 8:93218957-93218979 TAGCCTGAAGGGACTTTTTTAGG - Intergenic
1044575751 8:93767691-93767713 CAACTTGAAGGGACTTTTATTGG - Intronic
1046897115 8:119485145-119485167 CAGTTTGAAGGGCTTTTTAGTGG - Intergenic
1051222495 9:14864665-14864687 CAGAATGAAGGGCATGATATGGG - Intronic
1053132581 9:35625589-35625611 CAAACTAAACAGCCTTTTATTGG + Intronic
1056073605 9:83015381-83015403 CAGCCTGAAAGACCTTTTAAGGG - Intronic
1056081922 9:83103949-83103971 GGGAGTGAAGGGCCTTTGATTGG - Intergenic
1056395168 9:86175279-86175301 CAGACAGAGGTACCTTTTATTGG - Intergenic
1056454428 9:86746296-86746318 CATACTGAAGGGGCCTTGATGGG - Intergenic
1056643616 9:88390933-88390955 CACATTGAAGGTCCTCTTATTGG + Intronic
1058340282 9:103887108-103887130 CAGACTGAAGGTTGTATTATAGG - Intergenic
1058711870 9:107686091-107686113 CAAAAGGAAGGGCCTATTATGGG + Intergenic
1060195057 9:121618094-121618116 CAGAGTGAAAGGGATTTTATGGG + Intronic
1060652361 9:125339360-125339382 CAGCCTGAAGGGGCTCTCATTGG - Intronic
1187276399 X:17819843-17819865 GAGCCTGAAGGGCCTTTTCTGGG + Intronic
1191689253 X:63923123-63923145 CAGGCCCAAGGGGCTTTTATTGG - Intergenic
1193683790 X:84553106-84553128 CAGAAGGAAGGGGCTTTTTTTGG + Intergenic
1198617494 X:138475417-138475439 CAGACTGAATGGACTTCTCTTGG - Intergenic
1199117005 X:144004579-144004601 CAGGCTGAAGGGCTCTTTCTTGG + Intergenic
1200257030 X:154588224-154588246 CAGAAAGCAGGGCCTTTTAAAGG + Intergenic
1200260739 X:154616178-154616200 CAGAAAGCAGGGCCTTTTAAAGG - Intergenic
1200266865 X:154651070-154651092 CAGAAAGCAGGGCCTTTTAAAGG - Intergenic
1201526601 Y:14942942-14942964 CATACTGAAGGTCATTTGATTGG + Intergenic
1202364508 Y:24147993-24148015 CAGACAGAAGGGCCTTTTCTGGG + Intergenic
1202506273 Y:25522129-25522151 CAGACAGAAGGGCCTTTTCTGGG - Intergenic