ID: 1115788565

View in Genome Browser
Species Human (GRCh38)
Location 14:36854364-36854386
Sequence ACTTTTCCCCAGATGGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 2, 3: 58, 4: 362}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115788563_1115788565 -7 Left 1115788563 14:36854348-36854370 CCTTGAAGGATGAGAGACTTTTC 0: 1
1: 0
2: 2
3: 19
4: 218
Right 1115788565 14:36854364-36854386 ACTTTTCCCCAGATGGAGCTAGG 0: 1
1: 0
2: 2
3: 58
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115788565 Original CRISPR ACTTTTCCCCAGATGGAGCT AGG Intronic
900402474 1:2478203-2478225 ACTCCTCCCCAGATGGTCCTGGG - Intronic
902286728 1:15411998-15412020 ATTTTCCCCCAGAAGGACCTTGG - Intronic
903107780 1:21098930-21098952 ACTTTTCCCCATTTGAGGCTAGG - Intronic
903311940 1:22465616-22465638 ACTTTGCTCCAGATTGAGATCGG + Intronic
903518925 1:23932625-23932647 ACTTTTCAACAAATGGGGCTGGG + Intergenic
905027045 1:34857793-34857815 ATTTTTCCACAGATGGGGGTTGG + Intronic
905998259 1:42401034-42401056 ATTTTTCCACAGATGGGGGTGGG + Intronic
907287036 1:53388169-53388191 ACTTTTCCGCAAATGGTGCTGGG + Intergenic
907949458 1:59167708-59167730 TCTTTTCAACAGATGGTGCTGGG + Intergenic
908567588 1:65374014-65374036 TCTTTTCCATAGATGGTGCTGGG - Intronic
908930557 1:69312343-69312365 GCTTTTCCCCTGCTGGAGCCGGG - Intergenic
909303069 1:74038110-74038132 GCTTTTCCCCTGATGGAGCCAGG + Intronic
910518347 1:88088559-88088581 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
913541183 1:119822461-119822483 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
914753434 1:150550360-150550382 ACTTTTCCAGAGAGGGAGCCAGG + Intronic
916849034 1:168684035-168684057 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
916910762 1:169343341-169343363 TCTTTTCAACAGATGGTGCTAGG - Intronic
917024888 1:170631199-170631221 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
917045550 1:170856015-170856037 TCTTTCCCCCAGAGAGAGCTGGG - Intergenic
917060581 1:171033120-171033142 GCTTTTCCCCTGCTGGAGCCAGG - Intronic
917356455 1:174131306-174131328 ACTTTTCCCCTGCTGGGGCCAGG - Intergenic
917582388 1:176391927-176391949 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
917879500 1:179320265-179320287 TCTTTTCAACAAATGGAGCTGGG - Intronic
918168714 1:181975108-181975130 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
918234487 1:182566340-182566362 TCTTTTCCACAAATGGAGGTGGG - Intergenic
918697339 1:187560509-187560531 GCTTTTCCCCTGCTGGAGTTAGG - Intergenic
918802273 1:188986832-188986854 ACTTTTCCCCTGCTGGAGCCAGG - Intergenic
918943156 1:191027166-191027188 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
919586643 1:199447976-199447998 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
920198703 1:204245989-204246011 ATCTTTCCCCTGAGGGAGCTCGG - Intronic
920580127 1:207098580-207098602 ACTTTTCCACGGATGGGGGTGGG + Intronic
920937452 1:210448857-210448879 TCTATTCCCTAGATGGAGCGGGG + Intronic
920943009 1:210501634-210501656 ATTTTTCCCCAGGAGCAGCTGGG - Intronic
921151863 1:212409139-212409161 ATTTTTCCACAGATGGAGGTTGG - Intronic
921442768 1:215207404-215207426 ACTTTTCCACGGACAGAGCTGGG - Intronic
922781417 1:228256049-228256071 ATTTTTCCACAGATGGGGGTTGG - Intronic
1063736635 10:8763213-8763235 TCTTTTTCCAAGATGGAGATTGG - Intergenic
1067415761 10:46101070-46101092 AATTTTCCACAAATGAAGCTGGG - Intergenic
1067435806 10:46276178-46276200 AATTTTCCACAAATGGAGCTGGG - Intergenic
1068114881 10:52725871-52725893 ACTTTTCAACAAATGGTGCTGGG + Intergenic
1068165297 10:53323684-53323706 ACTTTTCCCGAAATGGATATTGG + Intergenic
1069370918 10:67746928-67746950 ATTTTTCCCCTGCTGGTGCTGGG + Intergenic
1070056634 10:72941324-72941346 ACTTTTCCCCAGATGGACTTGGG - Exonic
1071323992 10:84493718-84493740 ACTTTTCCACAGATGGGGAGAGG + Intronic
1072056050 10:91756957-91756979 ATTTTTCCACAGATGGGGATGGG + Intergenic
1072142131 10:92598327-92598349 GCTTTTCACCAAATGGTGCTGGG - Intronic
1072380502 10:94864287-94864309 CCTTTTCAACAGATGGTGCTGGG - Intergenic
1072815306 10:98502458-98502480 ACTTTTCAACAAATGGTGCTAGG + Intronic
1073682498 10:105719421-105719443 ATTTTTCCACAGATGGAGGTGGG + Intergenic
1075172392 10:120127829-120127851 ATTTTTCCCCTGCTGGAGCCAGG - Intergenic
1076007928 10:126962958-126962980 TCTTTTCCACAAATGGTGCTGGG - Intronic
1076201312 10:128560848-128560870 ATTTTTCCCCAGATGGCGGAGGG + Intergenic
1076314218 10:129529316-129529338 ACTTTTCCACAGATGGGAGTGGG + Intronic
1079311712 11:19372446-19372468 TATTTTCTTCAGATGGAGCTTGG + Intronic
1079800263 11:24860092-24860114 GCTTTTCCCCTGCTGGAGCCAGG + Intronic
1080242876 11:30147241-30147263 ATTTTTCCACAGATGGGGGTGGG + Intergenic
1081045876 11:38272391-38272413 TCTTTTCCCATGATGGTGCTAGG - Intergenic
1081340167 11:41917928-41917950 ACTTTTCCCCTGCTGAAGCCAGG - Intergenic
1085655982 11:78315433-78315455 ACTTTTCAGCAAATGGTGCTGGG + Intronic
1085783214 11:79428251-79428273 ACATTTCCCCAGTTTGAGGTGGG + Intronic
1088084468 11:105960484-105960506 GCTTTTCCCCTGCTGGAGCCAGG - Intronic
1088697704 11:112382681-112382703 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1088777667 11:113101031-113101053 CCTTGTCCCCAGAAGGAGCCTGG + Intronic
1089326363 11:117660219-117660241 TCTTCTCCCCACCTGGAGCTCGG - Intronic
1089517108 11:119040148-119040170 TCTTTTCCCCACAGGTAGCTGGG + Intergenic
1091755327 12:3047612-3047634 ATTTTTCCACGGATGGAGCGGGG - Intergenic
1092948316 12:13476723-13476745 ATTCTTCCCCAGTTGGGGCTGGG + Intergenic
1093522482 12:20067051-20067073 CCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1095103528 12:38205560-38205582 CCTGTTCCCCAGATGGAACCAGG - Intergenic
1095733108 12:45526800-45526822 ACTTTTCAACAAATGGTGCTGGG + Intergenic
1096345884 12:50846372-50846394 ACTTTTCAATAGATGGTGCTGGG - Intronic
1097748938 12:63330892-63330914 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1098689521 12:73469116-73469138 ACTATTCAACAGATGGTGCTGGG - Intergenic
1100028104 12:90153462-90153484 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1100941074 12:99723302-99723324 ACTTTTCCCCTGCTGGAGCCAGG + Intronic
1100970824 12:100068256-100068278 ACTTTTCAACAAATGGTGCTGGG + Intronic
1101051017 12:100864260-100864282 ACTTGCCCCCATTTGGAGCTGGG + Intronic
1101066525 12:101027509-101027531 GCTTTTCCCCTGCTGGAGCCAGG + Intronic
1102302392 12:111780292-111780314 TCTTTCCCCCAGATGTGGCTTGG + Intronic
1105668484 13:22586688-22586710 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
1108160382 13:47632616-47632638 ACTTTTCCCCTGTTGGAGCCAGG + Intergenic
1108957770 13:56182686-56182708 ACTTTTCCCCTGCTGGAGCCAGG + Intergenic
1109346630 13:61122868-61122890 ACTTTTCAACAAATGGTGCTGGG + Intergenic
1110175404 13:72549871-72549893 ATTTTTCCCCAGAGGGATCTTGG - Intergenic
1111861636 13:93714730-93714752 GCTTCTCCACAGATGGAGCAAGG + Intronic
1112245023 13:97725428-97725450 ACTTTTTCTCAGATTGAGATGGG - Intergenic
1113610623 13:111642398-111642420 CCCTTTCCTCAGGTGGAGCTGGG + Intronic
1114576606 14:23719989-23720011 ATTTTTCCACAGATGGAGCAGGG - Intergenic
1114705953 14:24726816-24726838 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1115788565 14:36854364-36854386 ACTTTTCCCCAGATGGAGCTAGG + Intronic
1116617013 14:47153170-47153192 TCTCTTCTCCAGAAGGAGCTAGG - Intronic
1118478880 14:66143959-66143981 GCTTTTCCCCTGTTGGAGCCAGG + Intergenic
1118722071 14:68601437-68601459 ACTTTTCCCTAAAGGGGGCTGGG + Intronic
1119353712 14:73988103-73988125 TCTTTTCCCAAGATGTGGCTGGG + Exonic
1119804983 14:77476630-77476652 ACGTTTCCCGAGGTGGAGATGGG - Intronic
1120288935 14:82541915-82541937 ACTTTTCAACAAATGGTGCTGGG - Intergenic
1121644348 14:95507572-95507594 GTTTTTACCCAGATGGAGGTGGG + Intergenic
1121905713 14:97741112-97741134 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
1122431867 14:101656134-101656156 ATGCTTCCCCTGATGGAGCTAGG + Intergenic
1122728157 14:103774051-103774073 TCTTTTCACCAAATGGTGCTGGG + Intronic
1123433566 15:20238332-20238354 AATTTTCCCCAGGTGAGGCTGGG - Intergenic
1125437708 15:39665115-39665137 AATTTTCCCTGGATGCAGCTGGG - Intronic
1126553012 15:49953554-49953576 ACTTTTCCCCTGCTGGAGCCAGG - Intronic
1126778868 15:52121104-52121126 ACTCTTCCAGAGCTGGAGCTGGG - Exonic
1127687725 15:61364962-61364984 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
1128093122 15:64932400-64932422 GCTTTTCCCCTGACAGAGCTGGG + Intronic
1132145606 15:99427479-99427501 ACCTCTCCCCGGATGGAGTTTGG + Intergenic
1133580117 16:7136710-7136732 AATTTTCCCTAGATGGGGCCAGG - Intronic
1133891199 16:9880677-9880699 ACTCTTCTCCAGATGGGCCTTGG + Intronic
1133977311 16:10608492-10608514 ATTTTTCCACAGATGGGGGTTGG - Intergenic
1136540473 16:30925302-30925324 AGTTTACCCCAGATTGAGGTTGG + Intronic
1139100344 16:63759418-63759440 ACTTTTCTACAAATGGTGCTGGG + Intergenic
1139139917 16:64248865-64248887 ACTTGTCCTCAGCAGGAGCTTGG + Intergenic
1139808462 16:69590782-69590804 ACTCTACCCCAGATGGGGCGGGG - Intronic
1141617270 16:85217113-85217135 CCGTTTCCCCATATGGAGCGTGG + Intergenic
1142619436 17:1155317-1155339 TCTTTTCACCAAATGGTGCTGGG + Intronic
1142911557 17:3097824-3097846 ACTTTTCCCCTGCCGGAGCCTGG + Intergenic
1143520851 17:7443426-7443448 CCTTTTCCTGAGATGGCGCTGGG + Exonic
1145018236 17:19412508-19412530 CCTTTCCCCAAGTTGGAGCTAGG + Exonic
1146954465 17:36929157-36929179 TCTTTTCTCCACATGGATCTTGG - Intergenic
1147628073 17:41912750-41912772 ATTTGTGCCCAGATGGAGCCTGG + Intronic
1148251012 17:46080349-46080371 TTTTTTCCCCAAATGGAGGTAGG - Intronic
1149111406 17:53035711-53035733 GCTTTTCCCCAGATATTGCTAGG + Intergenic
1149133314 17:53334905-53334927 ACTTTTCGTCAAATGGTGCTGGG - Intergenic
1149229719 17:54518989-54519011 GCTTTTCCCCTGCTGGAGCTAGG - Intergenic
1149231865 17:54544379-54544401 ATTTTTCCCCTGCTGGAGCTGGG + Intergenic
1149242181 17:54663344-54663366 ACTTTTCCCCTGCAGGAGCCAGG - Intergenic
1149377961 17:56064577-56064599 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
1152173976 17:78774512-78774534 ACTTTTTACAAGATGGAACTTGG + Intronic
1155008877 18:21755170-21755192 CCATTTCCTCAGATGGAACTAGG + Intronic
1155091936 18:22520667-22520689 ACTTATGCCCACATGGAGGTTGG + Intergenic
1155762876 18:29588819-29588841 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1155847782 18:30731224-30731246 ACTTTTCCCCTGCTGGAGCCAGG + Intergenic
1156778463 18:40821935-40821957 ACTTTTCCCCTGCTGGAGCTGGG + Intergenic
1156827841 18:41453854-41453876 TCTTTTCAGCAAATGGAGCTGGG + Intergenic
1161286476 19:3471096-3471118 ACTTTTCCCCTGAAGGAGGTGGG + Intergenic
1161976284 19:7609573-7609595 ATTTTTCCACAGATGGAGGCAGG + Intronic
1162182491 19:8879733-8879755 ACTTTTCCCCTGCTAGAGCCGGG + Intronic
1163872145 19:19830981-19831003 ACTTTTCCCCTGCTAGAGCCAGG + Intergenic
1163886150 19:19966434-19966456 ACTTTTCCCCTGCTAGAGCCAGG - Intergenic
1163888318 19:19989044-19989066 ACTTTTCCCCTGCTAGAGCCAGG + Intergenic
1163952721 19:20605221-20605243 TTTTTTTCCCAGATGAAGCTGGG - Intronic
1164163877 19:22650764-22650786 GCTTTTCCCCTGCTGGAGCCAGG - Intronic
1164881752 19:31738733-31738755 ATTGCTCCCCAGATGGGGCTGGG - Intergenic
1165951917 19:39478912-39478934 ACTCTTCCTCACGTGGAGCTGGG - Intergenic
925075200 2:1010640-1010662 ACTTTTTTTCAGATGGTGCTTGG + Intronic
925433204 2:3814887-3814909 GCTTTTCCCCTGATGGAGCCAGG - Intronic
926176422 2:10596237-10596259 AGTTTTCCACAGATGGTGGTGGG + Intronic
926594447 2:14775010-14775032 ATTTTTCCCCAGCAAGAGCTGGG - Intergenic
927185618 2:20480045-20480067 AGTTATCCCCAGCTGGAGCATGG - Intergenic
928757592 2:34545515-34545537 ACTTTTCCCCTGCTGGAGCCAGG - Intergenic
929370905 2:41222921-41222943 ACTTTTACCCTGCTGGAGCCAGG + Intergenic
930318615 2:49827412-49827434 ACTTTTTCCCTGATGGAGTCAGG - Intergenic
930734523 2:54762898-54762920 CCTTTTCAGCAGATGGAGCTGGG + Intronic
931993278 2:67812466-67812488 CCTTTTCAACAGATGGTGCTGGG + Intergenic
932013454 2:68000750-68000772 ACTTTTCCCCTGCTGGAGCCAGG + Intergenic
932874190 2:75433331-75433353 ACTTTTCCCTGGCTGGAGCCAGG + Intergenic
933056998 2:77683133-77683155 ATTTTTCCACAGATGGGGCACGG + Intergenic
933237599 2:79882556-79882578 GCTTTTCCCCTGCTGGAGCCAGG - Intronic
933927130 2:87104276-87104298 ATTTTTCCACAGATGGGGCACGG + Intergenic
935123049 2:100198779-100198801 ACTATCTCCCAGATGGGGCTGGG + Intergenic
935428450 2:102946380-102946402 GTCTTTCCCCAGATGCAGCTAGG + Intergenic
936849101 2:116874059-116874081 ACTTTTCCCCTGCTGGAGCCAGG - Intergenic
937893982 2:126963461-126963483 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
937931491 2:127208653-127208675 ACTTTTCCCCTGCTGGAGCCAGG + Intronic
938136838 2:128765947-128765969 ACTTTTCTCCTGCTGGAGCCAGG - Intergenic
939610591 2:144305334-144305356 TCTTTTCAACAGATGGTGCTGGG - Intronic
939655245 2:144816571-144816593 AATTTTCCTAAGAAGGAGCTAGG + Intergenic
940273402 2:151915320-151915342 ACTTTTTCCCTGCTGGAGCCAGG - Intronic
940410715 2:153360517-153360539 ACTTTTCCCCTGCTGGAGCCAGG + Intergenic
940948463 2:159645381-159645403 ATTTTCCCACAGATGGAGCAAGG + Intergenic
941694389 2:168535061-168535083 GCTTTTCCCCTGCTGGAGCCAGG - Intronic
941935296 2:170976988-170977010 ATTTTTCCCCAGGTGGGTCTTGG + Intergenic
942376110 2:175339647-175339669 ATTTTTCCCCTGCTGGAGCCAGG - Intergenic
942842995 2:180386675-180386697 ACTTTTCAACAAATGGTGCTGGG - Intergenic
943216536 2:185044406-185044428 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
943648839 2:190435068-190435090 ATTTTTCCTCAGATGGAGAGGGG - Intronic
944069463 2:195653020-195653042 ATTTTTCCACAGATGGGGGTGGG - Intronic
944895460 2:204159312-204159334 ACCTTCTCCCAAATGGAGCTTGG + Intergenic
946989625 2:225313766-225313788 ACTTTTTCCCAGAAGGTGCTTGG - Intergenic
948539806 2:238682525-238682547 ATTTTTCCACAGATGGGGCTGGG + Intergenic
1168870993 20:1128262-1128284 CCTTTTCAGCAGATAGAGCTAGG + Intronic
1168920773 20:1533816-1533838 CCTCATCCCCAGCTGGAGCTTGG - Intergenic
1168933545 20:1644408-1644430 GCTTTTCCCCTGCTGGAGCCAGG - Intronic
1170496587 20:16930935-16930957 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1173050101 20:39550990-39551012 ACTTTTCCACTGATGGCACTGGG - Intergenic
1173091331 20:39974972-39974994 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
1173532028 20:43777266-43777288 TCTTCTCCCCAGATGTAGCAGGG - Intergenic
1173640462 20:44598238-44598260 AGGTTTCCCCAGAGAGAGCTAGG + Intronic
1175397360 20:58675547-58675569 CCTCGTCCCCAGATTGAGCTTGG + Intronic
1177005088 21:15662341-15662363 TCTTTTCTCCAGAGCGAGCTAGG - Intergenic
1177511393 21:22091884-22091906 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
1177878948 21:26669432-26669454 ACTTTTCTCCTGCTGGAGCCAGG - Intergenic
1178474842 21:32928743-32928765 GCTTGCCCCCAGATGGAGCTTGG - Intergenic
1179806493 21:43841401-43841423 TCTTTTCAACAGATGGTGCTGGG - Intergenic
1179948146 21:44694142-44694164 TCTCTTCCCCAAATGGTGCTGGG + Intronic
1181809623 22:25395475-25395497 ACTTTTCCCCAGAGAGAACTTGG - Intronic
1182618543 22:31604966-31604988 CTTGTTCCCCAGCTGGAGCTTGG - Intronic
1182938949 22:34255287-34255309 ACTTTTCCCCTGCTGGAGCCAGG - Intergenic
1183503663 22:38196443-38196465 ACTTTTCCACAGATGAGGGTGGG + Intronic
1183714774 22:39527245-39527267 CCTTTTCCCCACAAGCAGCTGGG + Intergenic
1183716934 22:39538562-39538584 CCTTGTCCACAGATGGAGCAGGG - Intergenic
1184706306 22:46215943-46215965 ATTTTTCCACAGATGGGGGTGGG - Intronic
1185321708 22:50203625-50203647 ACTTTTCAACAAATGGTGCTGGG + Intronic
949434410 3:4013048-4013070 ATTTTTCCCCATATGGAGGTGGG + Intronic
949592719 3:5510613-5510635 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
949602389 3:5614195-5614217 ACTGTTCCACAGATAGAGCAGGG - Intergenic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
950591986 3:13943409-13943431 CCTTTTCCACAAATGGTGCTGGG - Intronic
951260274 3:20499465-20499487 ACTTTTCAACAAATGGTGCTGGG - Intergenic
951553621 3:23899024-23899046 ATTTTTCCACAGATGGAGATGGG - Intronic
952503802 3:33989303-33989325 ACTTTTCCCCTGCTGGAGCCAGG - Intergenic
952957137 3:38564405-38564427 ACTCTTCCCCACATGGAGGAAGG - Intronic
952973105 3:38668320-38668342 ACTTTTCAACAAATGGTGCTGGG - Intergenic
953115644 3:39989854-39989876 GCTTTTCCCCTGCTGGAGCTGGG - Intronic
953465221 3:43113994-43114016 CCTTTTCCCAAGAGGGAGGTGGG + Intergenic
955143409 3:56292259-56292281 AATTTTCCCCAAATTGTGCTTGG - Intronic
956335819 3:68162270-68162292 ATTTTTCCACAGATGGGGTTGGG + Intronic
957291328 3:78281579-78281601 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
957394725 3:79622482-79622504 GCTTTTCCCCTGCTGGAGCCAGG + Intronic
957434144 3:80152117-80152139 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
957630099 3:82707245-82707267 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
958503757 3:94946711-94946733 GCTTTTCCCCTGATGCAGCCAGG - Intergenic
958654866 3:96987627-96987649 AGTTTTACCCAGATGGATTTGGG + Exonic
959418386 3:106104396-106104418 GATTTTCCCCTGGTGGAGCTGGG - Intergenic
959452696 3:106523161-106523183 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
960077824 3:113508041-113508063 TCTTTTCAACAGATGGTGCTGGG + Intronic
960233429 3:115254922-115254944 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
961518381 3:127452674-127452696 ACTTGTCCCAGGACGGAGCTGGG + Intergenic
961563936 3:127750048-127750070 ACTTTTACCCCGAGGGAGGTGGG + Intronic
963461261 3:145617330-145617352 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
964007782 3:151852126-151852148 GCTTTTCCCCTGGTGGAGCCAGG - Intergenic
964224306 3:154379676-154379698 ACTTTTCAACAAATGGTGCTGGG - Intronic
964594437 3:158408141-158408163 ACTTTTCCCCATACTGAGATTGG + Intronic
964725611 3:159811516-159811538 TCTTTTCAACAGATGGTGCTGGG - Intronic
964861498 3:161207344-161207366 TCTATTCCCCAGATGGCCCTGGG + Intronic
966009544 3:175057543-175057565 TCTGTTCCCCAGATGGTGCAGGG - Intronic
966128534 3:176608459-176608481 AAAATTCCCAAGATGGAGCTAGG + Intergenic
966539647 3:181075205-181075227 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
967579844 3:191139238-191139260 ACTTTTCCCTAAATGGATCCTGG + Intergenic
967813636 3:193781102-193781124 AATTTTCCCCAGACGGGGCATGG + Intergenic
970019536 4:11551874-11551896 ACTTTTCAATAGATGGTGCTAGG - Intergenic
970494282 4:16609502-16609524 GCTTTTCCCCTGCTGGAGCCAGG + Intronic
970666520 4:18343049-18343071 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
970952754 4:21775798-21775820 GCTTTTCCCCTGCTGGAGCCAGG - Intronic
971853157 4:32010339-32010361 TCTTTTCCCCTGCTGGAGCCAGG + Intergenic
972249766 4:37287442-37287464 ACTTTTACCCTGCTGGAGCCAGG + Intronic
972789339 4:42355958-42355980 AGGTTTCCCCTGATGAAGCTGGG - Intergenic
974144810 4:57934076-57934098 ATTTGTCCCCAGGTGGAGCAAGG - Intergenic
974191629 4:58511948-58511970 ACTTTTCCCCAGGTAAAGCAAGG - Intergenic
974741630 4:66014352-66014374 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
974760344 4:66266336-66266358 ACTTTTCCCCTGTTGGGGCCAGG + Intergenic
974885214 4:67809668-67809690 ACTTTACCCCTGCTGGAGCCAGG + Intergenic
975279017 4:72538922-72538944 TCTTTTCAACAAATGGAGCTTGG + Intronic
975472054 4:74781188-74781210 TTTATTCCCCAAATGGAGCTTGG - Intronic
976240564 4:82951881-82951903 ACTTTTCAACAAATGGTGCTGGG + Intronic
976858384 4:89631106-89631128 ACCTTTAGCCAGATGGAGCTTGG - Intergenic
978234059 4:106436596-106436618 ACCTTTCTCCAGAAAGAGCTAGG - Intergenic
979197851 4:117941644-117941666 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
979590073 4:122468435-122468457 TCTTTTCAACAGATGGTGCTTGG + Intergenic
979775421 4:124583361-124583383 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
980184637 4:129446389-129446411 ACTTTTCCCCTGCTGGAGCCAGG + Intergenic
980193136 4:129551306-129551328 ATTTTTCCGCGGATGGACCTGGG - Intergenic
980489391 4:133505824-133505846 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
980864826 4:138542492-138542514 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
982089426 4:151867558-151867580 AATGTTGCACAGATGGAGCTGGG + Intergenic
982896920 4:160942005-160942027 AGTTTTCCACAGATGGGGGTGGG + Intergenic
983726921 4:170940548-170940570 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
983786514 4:171737548-171737570 ACTTTTCCCCATGTGGATGTAGG - Intergenic
984092096 4:175387376-175387398 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
984334994 4:178379253-178379275 ACTTTTCCCCTGCTGGAGCCAGG + Intergenic
984609289 4:181819594-181819616 AATTTTCCACAGATGGAGGGTGG + Intergenic
984626127 4:182009571-182009593 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
985349080 4:189038497-189038519 ACCTTTCCCCAAAAGCAGCTGGG + Intergenic
986492416 5:8306611-8306633 ACTTTTCCGCTGCTGGAGCCAGG + Intergenic
987134977 5:14892002-14892024 ATTTTTCCGCAGATGGAGTAGGG - Intergenic
988059489 5:26148854-26148876 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
989092030 5:37743569-37743591 ATTTTTCCCCTGCTGGAGCCAGG + Intronic
989390203 5:40892418-40892440 TCTTTTCAACAGATGGTGCTGGG + Intergenic
990139099 5:52682530-52682552 ACTTTTTCCCTGCTGGAGCCAGG - Intergenic
990243944 5:53843721-53843743 CCTTTTCCACAAATGGTGCTTGG + Intergenic
990275311 5:54189552-54189574 TCTTTTCAACAGATGGTGCTAGG + Intronic
990650836 5:57897867-57897889 ATTTTTCCACGGATGGAGGTTGG + Intergenic
991066235 5:62427759-62427781 ATTTTTCCACAGATGGGGCAGGG - Intronic
991625242 5:68594299-68594321 ATTTTTCCACAGATGGGGGTGGG - Intergenic
992862818 5:80929365-80929387 AATGTGCCACAGATGGAGCTAGG + Intergenic
993117273 5:83733823-83733845 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
993253414 5:85556682-85556704 ATTTTTCCCCTGTTGGAGCCAGG + Intergenic
993807896 5:92436105-92436127 ACTTTTCCCCTGGTGGAACCAGG + Intergenic
993855261 5:93066379-93066401 ATTTTTCCACAGATGGGGGTTGG - Intergenic
993883486 5:93390339-93390361 ACTTTTCAACAAATGGTGCTGGG - Intergenic
994344519 5:98668893-98668915 ACTTTTCCCCTGCTGGAGCCAGG + Intergenic
994953781 5:106500032-106500054 ACTATTCACCAAATGGTGCTGGG - Intergenic
995340942 5:111058481-111058503 ATTTTTCCCCTGCTGGAGCTAGG - Intergenic
995594228 5:113731078-113731100 ACTTTTCTCCTGATGGAGCCAGG - Intergenic
996527257 5:124492227-124492249 ACTTTTCCCTTGATGCAGCTGGG - Intergenic
996705173 5:126490664-126490686 ACCTTTCCTCAGAGGCAGCTGGG + Intronic
996893818 5:128456095-128456117 GCTTTTCCCCTGCTGGAGCCAGG + Intronic
997096928 5:130923849-130923871 ACTTTTCCTCTGCTGGAGCCAGG + Intergenic
997620823 5:135292392-135292414 TCTTTTCCACAAATGGTGCTGGG - Intronic
998917536 5:147031804-147031826 TCTTTTCCACAAATGGTGCTGGG + Intronic
999775678 5:154811403-154811425 CCTCTTCCCCAGTTGGACCTGGG + Intronic
1000105484 5:158055115-158055137 ACTGTTCCCCAGCTAGAGTTAGG - Intergenic
1000419100 5:161016833-161016855 ACTCTTCCACAAATGGTGCTAGG - Intergenic
1001788812 5:174437084-174437106 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1001853799 5:174993164-174993186 AGCTTTCCTCAGATGGAGGTTGG + Intergenic
1003658681 6:8039964-8039986 ACTTTTCACCATGTGGTGCTCGG - Intronic
1003948456 6:11096178-11096200 ATTTTTCCACAGACGGAGCAGGG + Intronic
1004111179 6:12720475-12720497 GGTTTTCAGCAGATGGAGCTGGG + Intronic
1004373756 6:15074599-15074621 ATTTTTCCACAGATGGAGGGTGG + Intergenic
1004911782 6:20292744-20292766 ATTTTTCCCCAGATGGGACGGGG + Intergenic
1005625071 6:27654629-27654651 ACTTTTCAACAAATGGTGCTGGG + Intergenic
1007891312 6:45295249-45295271 ACTTTTCAACAAATGGTGCTGGG + Intronic
1008694139 6:54014414-54014436 ATTTTTCCACAGATGGGGCTAGG + Intronic
1008773670 6:55009236-55009258 ACTTTTCCCCTTCTGGAGCCAGG - Intergenic
1008819102 6:55609330-55609352 ACTTTTCCTCTGCTGGAGCCGGG + Intergenic
1010483227 6:76379313-76379335 ACTTTTCCCCTGCTGGAGCCAGG - Intergenic
1010877149 6:81120763-81120785 ACTTTTCCACAGATGGGGTGTGG - Intergenic
1011328677 6:86179399-86179421 CCTTTTCCACAAATGGTGCTGGG - Intergenic
1012315041 6:97775109-97775131 ATTTTTCCCCTGCTGGCGCTGGG + Intergenic
1012332178 6:98006158-98006180 TCTTTTCAACAAATGGAGCTGGG - Intergenic
1012758787 6:103268450-103268472 AGTTTTCCCCAAATGGAGATAGG - Intergenic
1012923149 6:105240488-105240510 CCTTTTCAACAGATGGTGCTGGG + Intergenic
1012950290 6:105511222-105511244 ACTGTTCCCCAAATCTAGCTGGG + Intergenic
1013461503 6:110378874-110378896 ACTTTTCCCCTGCTGGAGCCAGG + Intergenic
1014367596 6:120563439-120563461 ACTTTTCCCCTGCTGGAGCCAGG - Intergenic
1014527590 6:122519456-122519478 ATTTTTCCACAGACGGAGGTGGG - Intronic
1014864001 6:126505853-126505875 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1015135767 6:129868222-129868244 ATTTTTCCCCAGTTGGAGCCTGG - Intergenic
1015553885 6:134440919-134440941 ATTTTTCCACAGATGGGACTGGG - Intergenic
1015660197 6:135566420-135566442 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
1016126108 6:140406364-140406386 ACTTTTCAACAAATGGTGCTTGG - Intergenic
1016259328 6:142148812-142148834 ACTCTTTCCCAGATGGTGCAAGG - Intronic
1016678217 6:146796622-146796644 ACTTTTCAACAAATGGTGCTGGG + Intronic
1017207546 6:151819772-151819794 ATTTTTCCACAGATGGAACTGGG - Intronic
1018770650 6:166968577-166968599 ACTTTTCAGCAGATAGAGCTAGG + Intergenic
1018969678 6:168517734-168517756 CCTTTTCCTCAGCTGGGGCTGGG + Intronic
1019113543 6:169738148-169738170 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
1019837068 7:3398573-3398595 ACTTTTCCCCAGATGCATTTTGG + Intronic
1020621772 7:10527886-10527908 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1020676559 7:11191094-11191116 ACTTTTCCCCAGATTAACCTGGG - Intergenic
1021981371 7:26058804-26058826 GCCTTTCCCCAGATGCAGCATGG - Intergenic
1022212191 7:28222367-28222389 ACATTTCCACATATTGAGCTGGG - Intergenic
1023055090 7:36284625-36284647 TCCTTTCCCCAGGTGGCGCTAGG + Intronic
1023225607 7:37965818-37965840 TATTTTCCCCTGATGAAGCTGGG + Intronic
1023522869 7:41066274-41066296 TCTTTTCTGCAGGTGGAGCTTGG - Intergenic
1024099481 7:46015700-46015722 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1027747000 7:82088832-82088854 ATTTTTCCACAAATGGAGGTGGG + Intronic
1028177555 7:87675117-87675139 CCTTTTCCCCAGAAGATGCTGGG + Intronic
1029041443 7:97580374-97580396 ACTTTTCCCCTGCTGGAGCCAGG + Intergenic
1029220632 7:98986929-98986951 ACTTTTCAGCAAATGGTGCTGGG - Intronic
1030298437 7:107951929-107951951 ACTTTGCCCCAGTTAGAGCAAGG - Intronic
1030701583 7:112646941-112646963 ACTTTTCCCCTGCTGGAGCCAGG - Intergenic
1031269387 7:119627360-119627382 ACTTTTCTCCAAATGGTGTTAGG - Intergenic
1031804569 7:126292648-126292670 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1032051627 7:128653830-128653852 ACCCTTCTCCAGCTGGAGCTGGG + Intergenic
1032073395 7:128823833-128823855 ATTTTTCCACAGATGGAGAGGGG + Intergenic
1032768950 7:135028757-135028779 ACTATTCCTCTGATGGATCTGGG - Intronic
1033284229 7:140026787-140026809 ACCTGTCCCCAGATGGGGTTGGG - Intronic
1033608429 7:142943873-142943895 CCTCTTCCCCAGATACAGCTTGG - Exonic
1033879394 7:145862540-145862562 ACTTTTCCCCTGCTGGAGCCAGG + Intergenic
1034116244 7:148586264-148586286 CCTTTTCTCCAGATGAAGGTTGG + Intergenic
1036109382 8:5880446-5880468 ACTTTTCAACAAATGGTGCTGGG + Intergenic
1036617627 8:10400767-10400789 ACTTTTCAACAGATGGTGCTGGG + Intronic
1038243350 8:25830996-25831018 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
1039268772 8:35857522-35857544 ACTTTTCAGCAAATGGTGCTGGG + Intergenic
1039385671 8:37133743-37133765 ACTTTTCCTGGGAGGGAGCTTGG - Intergenic
1039594453 8:38778749-38778771 ACTTTTTCCCAGATGGGGAGAGG + Intronic
1039816220 8:41096772-41096794 ACTTTTTGCCAGAGGGAGTTTGG - Intergenic
1040100539 8:43498082-43498104 TCTTTTCCACAAATGGTGCTGGG - Intergenic
1040763086 8:50874305-50874327 ATTTTTCCACTGCTGGAGCTGGG + Intergenic
1040959752 8:53019210-53019232 ACTTTTCCCCTGCTGAAGCCAGG + Intergenic
1041211863 8:55559792-55559814 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
1044064953 8:87687945-87687967 CCTTTTCCACAGATGGGGGTTGG + Intergenic
1044315759 8:90748786-90748808 GCTTTTCCCCTGCTGGAGCCAGG + Intronic
1045054700 8:98359008-98359030 ACTTTTCCGAAGAAAGAGCTGGG + Intergenic
1045229783 8:100292963-100292985 ATTTTTCCACAGATGGAGGTGGG + Intronic
1045823678 8:106371878-106371900 GCTTTTCCCCTGCTGGAGCCAGG - Intronic
1045881346 8:107044497-107044519 ACTTTTCAACAAATGGTGCTGGG + Intergenic
1046452398 8:114411330-114411352 TCTTTTCCACAGATTAAGCTGGG - Intergenic
1050630084 9:7549535-7549557 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1050660727 9:7880169-7880191 GCTTTTCCCCTGCTGGAGCCAGG + Intronic
1052225298 9:26077986-26078008 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
1052369223 9:27645464-27645486 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1052546630 9:29888892-29888914 ACTTTTCCCCTGCTGGAGCCAGG + Intergenic
1052811403 9:33063794-33063816 ATTTTTCCACAGATGGTGGTGGG - Intronic
1052990299 9:34515043-34515065 ATTTTTCCTTAGATGGAGCCGGG - Intronic
1055501879 9:76909433-76909455 AATGTTCCAGAGATGGAGCTTGG - Intergenic
1055808727 9:80126301-80126323 TCTTTTCCTGAGATAGAGCTGGG + Intergenic
1055818849 9:80238365-80238387 ACTTTTCTCCTGCTGGAGCCAGG + Intergenic
1056394680 9:86170879-86170901 TCTTTTCAACAAATGGAGCTGGG - Intergenic
1056394785 9:86172016-86172038 TCTTTTCAACAAATGGAGCTGGG - Intergenic
1056515375 9:87344550-87344572 CATTTTCCCCAGATGGAGAGTGG - Intergenic
1056886660 9:90449610-90449632 ACCTTTCCCCAGATGAAGTCAGG - Intergenic
1057195435 9:93113717-93113739 GCTTTGCCCCAGAAGGTGCTGGG + Intergenic
1057518774 9:95743888-95743910 GCTTTTGCCCAGAGGGTGCTAGG - Intergenic
1057597134 9:96424087-96424109 ACCTTTCCACAGATGGAGAGAGG - Intergenic
1058263046 9:102860454-102860476 AATTTTCTCCAGGTGGAGATAGG + Intergenic
1061844220 9:133377730-133377752 ATTTTTCCACAGATGGAGGCGGG + Intronic
1186890577 X:13955568-13955590 ACTTCTCCAGAGAAGGAGCTGGG - Intergenic
1188092142 X:25977055-25977077 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1189457335 X:41204549-41204571 ACTCTTCCACAAATGGTGCTGGG - Intronic
1190414395 X:50166993-50167015 ACTTTTCTCCAGAAGGATCTGGG - Intergenic
1190529590 X:51361579-51361601 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1191161217 X:57331308-57331330 CCTTTTCCCCAGGTGTTGCTGGG + Intronic
1192026331 X:67456740-67456762 TCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1192716428 X:73647510-73647532 AATTTTCCCCTGCTGGAGCCAGG + Intronic
1192951926 X:76026413-76026435 GCTTTTTCCCTGCTGGAGCTGGG + Intergenic
1193091082 X:77494455-77494477 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1193365180 X:80623256-80623278 ATTTTTCCCCTGCTGGAGCTGGG - Intergenic
1193996543 X:88372338-88372360 ACATTTACCCACATGGAGTTAGG - Intergenic
1194058214 X:89163827-89163849 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
1194489668 X:94530683-94530705 ACTTTTTCCCTGTTGGAGCCAGG + Intergenic
1194596703 X:95867911-95867933 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1196054465 X:111340173-111340195 ACTTTTCCCTTGCTGGAGCCAGG + Intronic
1196465232 X:115965554-115965576 ACTTTTCAACAAATGGTGCTGGG + Intergenic
1196555875 X:117083972-117083994 GTTTTTCCCCTGTTGGAGCTGGG - Intergenic
1196947836 X:120845505-120845527 ACTTTTCAACAAATGGTGCTAGG - Intergenic
1197602164 X:128543474-128543496 ACTTTTCCCCTGCTGCAGCCAGG - Intergenic
1199691037 X:150309132-150309154 AGTTCTCCCCAGATGGTGCAGGG - Intergenic
1200742031 Y:6864287-6864309 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
1201979638 Y:19892881-19892903 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1202070326 Y:20985468-20985490 ACTTTTCCCCTGATGGAGACAGG - Intergenic