ID: 1115789254

View in Genome Browser
Species Human (GRCh38)
Location 14:36860368-36860390
Sequence GAAGCCTCCAAGACCATGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115789252_1115789254 4 Left 1115789252 14:36860341-36860363 CCTTGGAAACAGAATATCAGATT 0: 1
1: 0
2: 3
3: 23
4: 295
Right 1115789254 14:36860368-36860390 GAAGCCTCCAAGACCATGTAGGG 0: 1
1: 0
2: 2
3: 4
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115789254 Original CRISPR GAAGCCTCCAAGACCATGTA GGG Intronic
900763979 1:4491569-4491591 GAAGCCTGCAAGACCTTCGAGGG - Intergenic
900803808 1:4754522-4754544 CAAGCTTCCCAGACCATGGATGG + Intronic
905101170 1:35523288-35523310 GTAACCTCCAGGACCATGTTTGG + Intronic
909584543 1:77275091-77275113 GAAGCCACCAGGGCCATGTTAGG + Intergenic
913593036 1:120347845-120347867 GCAGCCTCCAAGATCCTATAGGG + Intergenic
914094223 1:144531141-144531163 GCAGCCTCCAAGATCCTATAGGG - Intergenic
914304304 1:146402747-146402769 GCAGCCTCCAAGATCCTATAGGG + Intergenic
914597752 1:149170063-149170085 GCAGCCTCCAAGATCCTATAGGG - Intergenic
919949475 1:202349149-202349171 GACGCCTCTAAGACCAAGAAAGG - Intronic
922049484 1:221976320-221976342 GAAGCCCCCTAGACCATTCACGG - Intergenic
924382551 1:243477779-243477801 GAAGCTTGGAAGACCATGTTGGG - Intronic
924709909 1:246523245-246523267 GAAGCCCCCCACACCCTGTATGG - Intergenic
1075946468 10:126437529-126437551 AAAGCCTCAAAACCCATGTAGGG - Intronic
1076603310 10:131673452-131673474 GAACTCTCCAGGACCATGCAAGG - Intergenic
1077076192 11:703262-703284 GAACCATCCAAAACCATCTATGG - Exonic
1077556916 11:3230355-3230377 GAAGCCGCTAAGACCAGCTATGG - Intronic
1080072698 11:28108569-28108591 GAGGCCTCCAAGAAGTTGTAGGG + Intronic
1080926832 11:36766282-36766304 GAAGCCTCCAAAAATATATAGGG - Intergenic
1093854349 12:24081894-24081916 AAAGCCTCCAGCACCATTTATGG + Intergenic
1103885297 12:124195925-124195947 CAAGACTCCAAGACGATATACGG - Intronic
1104285756 12:127423173-127423195 GAAGCCGACAAGCCCATGGAAGG + Intergenic
1104386424 12:128355244-128355266 GAAGGGTCCCAGACCATGGAGGG + Intronic
1113461096 13:110482683-110482705 GATGCCACCATGACCAGGTAAGG - Intronic
1113758420 13:112830902-112830924 AAAACCTACAATACCATGTAAGG - Intronic
1115789254 14:36860368-36860390 GAAGCCTCCAAGACCATGTAGGG + Intronic
1122626404 14:103087498-103087520 GCAGCCTCAAAGACCTTGAACGG + Intergenic
1124244408 15:28057420-28057442 GAAGCCTCCATGCCCTTGTCAGG + Intronic
1124462249 15:29903135-29903157 GAAGCCGCCAAGTGTATGTATGG - Intronic
1126308301 15:47286702-47286724 GAGACCTCCAAGACCATTTCAGG - Intronic
1127351996 15:58162409-58162431 GAAGCCTCCAACTTCATGTAAGG + Intronic
1132435866 15:101802094-101802116 GCATCCTCCACCACCATGTAAGG + Intergenic
1133912914 16:10082142-10082164 GGAGCCTCCAAAACATTGTATGG + Intronic
1141477852 16:84285703-84285725 AAAGCCCTCAAAACCATGTATGG + Intergenic
1141792928 16:86248972-86248994 GAACCCTTCAAGACCAGGGATGG + Intergenic
1142388029 16:89779259-89779281 GAGGCCACGAGGACCATGTAAGG + Intronic
1145881996 17:28358977-28358999 GAAGCCTCCACGGGTATGTAAGG + Exonic
1151654835 17:75491012-75491034 GAAGTCTGCAAGGCCATTTAGGG - Intronic
1156509023 18:37619886-37619908 GGAACCTACAAGAGCATGTAGGG - Intergenic
1156722281 18:40084747-40084769 GGAGCTTCCAAGCCCATTTATGG + Intergenic
1158722090 18:59934430-59934452 AGAGCCTCCAAAACAATGTAGGG - Intergenic
1160240501 18:77119227-77119249 GAAGCCACCAGGACCCTGTGGGG + Intronic
1160496431 18:79378725-79378747 GAGGCCTCCAAGAACAGGCATGG - Intergenic
1164840673 19:31390120-31390142 GAGGCCTCCAAGCCCACGCATGG - Intergenic
1165668816 19:37656631-37656653 GAATATTCCAAGACCAGGTATGG - Intronic
1166762241 19:45232203-45232225 GAAGCCTCCAAGGCCAGGTAAGG - Intronic
926087065 2:10027249-10027271 GAAGCCTCCAAGCCCAATGAGGG + Intergenic
941254976 2:163217558-163217580 GAGGCCTCTCAGACCATGCATGG - Intergenic
941724826 2:168849775-168849797 GGAGACTCCAAGGCCATGTGGGG - Intronic
1169574103 20:6939330-6939352 GCACAATCCAAGACCATGTATGG - Intergenic
1171367419 20:24635112-24635134 GAAGCCTCCAAGACTTGGGAAGG + Intronic
1172822535 20:37750334-37750356 TAACCCTCCAAAACCATGTGAGG - Intronic
1173702357 20:45084233-45084255 GAAGCTTCCAAGACCATGGATGG + Intergenic
1178781696 21:35609451-35609473 GAAGACTCCAAGAACAAGTCTGG - Intronic
1181273597 22:21674916-21674938 GAAGGCCCCAAGACCCTGCAAGG - Intronic
1181500963 22:23315334-23315356 CAAGCCTCCAAGTCCATCTCAGG - Intronic
1182528621 22:30937913-30937935 GTAGGCTCCAGGACCAGGTAGGG + Exonic
1183722778 22:39572101-39572123 GCAGCCTCCAAGGCCCTGCAGGG - Intronic
1184260985 22:43316027-43316049 GATGCCTCCAAGACCTCGTGGGG - Intronic
1184655139 22:45937271-45937293 GAAGGCTCCAGGAGCATGTGTGG - Intronic
1185419373 22:50726986-50727008 GAAGCTTCCGAGCCCATGTCTGG + Intergenic
954943245 3:54393986-54394008 GAAGCATCCTAGACCCTGTATGG - Intronic
956158753 3:66325758-66325780 AGGGCCTCCAAGACCATGGAAGG + Intronic
962269755 3:133968801-133968823 AAAGCCTCTAAGACCACGTCTGG - Intronic
962778405 3:138686753-138686775 GAAACCACTAAGACTATGTAGGG + Intronic
963540373 3:146580077-146580099 GAAGCATTCAATACCATTTAAGG - Intronic
967174287 3:186848897-186848919 GAAGTTTCCAAGACCAAGAACGG - Intronic
970491903 4:16583485-16583507 GAAGCCTCCACGTCCATCTGAGG - Intronic
985816613 5:2132423-2132445 GGAGCCTCCAAGGCAATGGACGG - Intergenic
988688475 5:33548826-33548848 GAAGCCTCAGAGAGCATGTTAGG + Intronic
989776397 5:45212889-45212911 AAAGTCTCTAAGATCATGTAAGG - Intergenic
996117094 5:119631195-119631217 GAAGCCTCCAGGGCCATCTCTGG - Intronic
997243925 5:132330007-132330029 GAACCCTCCAAGAAGATGTCTGG + Intronic
1001547645 5:172580335-172580357 GAAGCCTCCAAGGCCTTTCATGG + Intergenic
1003983838 6:11416326-11416348 GAAGCCAGCAAGACCGTGAAAGG - Intergenic
1010163660 6:72889925-72889947 GAAACCTCCATGAATATGTAGGG + Intronic
1013693305 6:112670380-112670402 GAAGGCTCCATGATCATGAATGG - Intergenic
1015454248 6:133407455-133407477 GAAGGCTCCAAGAGCAAGGAAGG - Intronic
1017622451 6:156313374-156313396 GAGGTCTCCAAGACCACTTAAGG - Intergenic
1018397258 6:163387984-163388006 GCTGCCTGCAAGACCATGAAGGG + Intergenic
1019926846 7:4198563-4198585 GCAGCCTCCAACAACATGCACGG - Intronic
1019951720 7:4378520-4378542 GAAGCCTTCAGCACCATGCAAGG - Intergenic
1021000891 7:15328908-15328930 GATGCTTCCAAGACCTGGTATGG - Intronic
1021432827 7:20580819-20580841 GCAGCCTCCAAGATCATGTCTGG - Intergenic
1028823502 7:95241805-95241827 GAAGTTTCCACTACCATGTAGGG + Intronic
1029409957 7:100402912-100402934 AAATCCTCCATGTCCATGTAGGG + Intronic
1029657060 7:101933953-101933975 AAAGCCGGAAAGACCATGTATGG + Intronic
1030147619 7:106372379-106372401 GAAGCCACAAATACCCTGTATGG - Intergenic
1036179604 8:6572859-6572881 GAAGCCTCCCAAACCACGTAAGG + Intronic
1039077591 8:33706636-33706658 GCAGCCCCCAACACCAGGTATGG - Intergenic
1041524169 8:58787315-58787337 CAAGCCTCCAACTCCATGTGCGG - Intergenic
1043169109 8:76941685-76941707 CAAGCCTCCAAGAACATACATGG - Intergenic
1043549003 8:81347777-81347799 GAAGCCTCCAAGAATATTTCAGG - Intergenic
1045590721 8:103592596-103592618 GCAGTCTCCAAGACCATTTCAGG + Intronic
1049121048 8:140738208-140738230 GAAGCCTTCAAGGACATTTAAGG + Intronic
1049393618 8:142385218-142385240 GACACCTCCAAGACCCTGAAAGG + Intronic
1052301583 9:26958329-26958351 GAAGATTCCAAGACCAGTTATGG + Intronic
1060437189 9:123604102-123604124 GCAGCCTCCAAGGCCCTGGATGG + Intronic
1061513894 9:131077299-131077321 GAAGCCAGCAAGGCCAGGTACGG - Exonic
1189795875 X:44645518-44645540 AAGGCTTCCAAAACCATGTATGG + Intergenic
1192372132 X:70523034-70523056 GAAGCCTTCAAGTCCATTTGGGG + Intergenic
1195776343 X:108410143-108410165 TAGGCCTCCTAGACCATGTTTGG - Intronic
1196809185 X:119615056-119615078 GAAGCCTCCAGGCCTCTGTAAGG + Intergenic
1197093692 X:122570020-122570042 GAATCCTCCAAGAGAATGGAGGG + Intergenic