ID: 1115790403

View in Genome Browser
Species Human (GRCh38)
Location 14:36871258-36871280
Sequence CCTCACATGGTGAAAGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 460
Summary {0: 1, 1: 1, 2: 14, 3: 74, 4: 370}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115790403_1115790406 -9 Left 1115790403 14:36871258-36871280 CCTTGCTCTTTCACCATGTGAGG 0: 1
1: 1
2: 14
3: 74
4: 370
Right 1115790406 14:36871272-36871294 CATGTGAGGACACAGCAAGAAGG 0: 269
1: 876
2: 1855
3: 2757
4: 3452
1115790403_1115790407 9 Left 1115790403 14:36871258-36871280 CCTTGCTCTTTCACCATGTGAGG 0: 1
1: 1
2: 14
3: 74
4: 370
Right 1115790407 14:36871290-36871312 GAAGGCACCCTTTATGAACCAGG 0: 1
1: 4
2: 42
3: 184
4: 380
1115790403_1115790409 16 Left 1115790403 14:36871258-36871280 CCTTGCTCTTTCACCATGTGAGG 0: 1
1: 1
2: 14
3: 74
4: 370
Right 1115790409 14:36871297-36871319 CCCTTTATGAACCAGGAAACAGG 0: 1
1: 0
2: 38
3: 237
4: 702

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115790403 Original CRISPR CCTCACATGGTGAAAGAGCA AGG (reversed) Intronic
900874175 1:5329802-5329824 CCTCACATGGTGGAAGGGGAAGG + Intergenic
901382848 1:8886413-8886435 CCTCACATGGCAGAAGAGAAAGG - Intergenic
902893878 1:19465312-19465334 CCTCACATGGTGGAAGGGGCTGG - Intronic
902998344 1:20245560-20245582 CATAACATGGTGGAAGATCAAGG + Intergenic
903533919 1:24053880-24053902 CGTCACATGGTGAGAGAGCATGG + Intergenic
905434669 1:37948306-37948328 CTTCACTTGGGGAAAGAGGAAGG - Intergenic
905701087 1:40014983-40015005 CCACAGAAGGAGAAAGAGCATGG + Intergenic
906534940 1:46546189-46546211 AGTCCCATGGTGAAAGATCACGG - Intronic
906760945 1:48377972-48377994 CTTCACATGGTGGAAGATGATGG - Intronic
907272874 1:53300977-53300999 CCTCACAAGGTGAGAGTGAAAGG + Intronic
907768609 1:57437128-57437150 CTTCAGATGGTGAAAGTGAATGG + Intronic
908267358 1:62392579-62392601 CCTCAAATGGTGGAAGGGTAAGG - Intergenic
908390596 1:63680005-63680027 CCACTCATGGTGGAAGATCAAGG - Intergenic
909589901 1:77335939-77335961 ACTCACATGGTGAAAGGGACAGG + Intronic
909858438 1:80572298-80572320 CCTCACATGTTGAAAGAATGAGG + Intergenic
909909731 1:81246286-81246308 CCGCAAAGGGTGAAGGAGCAGGG - Intergenic
910414197 1:86981198-86981220 CCCCACATGTTGAGGGAGCAAGG - Intronic
911168146 1:94743476-94743498 CCTCACATAGTAGAAGGGCAAGG - Intergenic
911805041 1:102195131-102195153 TTTCACATGAGGAAAGAGCAAGG - Intergenic
912942256 1:114055778-114055800 CCTCACACAGAGACAGAGCAGGG - Intergenic
913050289 1:115111658-115111680 CCTCACATGGTAGAAGGGGAAGG - Intergenic
913317570 1:117565763-117565785 CCACACATGGGGAGAGAACAAGG + Intergenic
913348218 1:117829138-117829160 CCTTACATGGTGAAAGAACAAGG + Intergenic
913430659 1:118787687-118787709 CCTCACATGGTGTAAGAAATGGG - Intergenic
915979805 1:160413157-160413179 CCTCCCATGGGCACAGAGCAAGG - Intronic
918095145 1:181328239-181328261 CCTCACATGGTGGAAAGGTAAGG + Intergenic
918631206 1:186720510-186720532 CTTCACATGGTGGAAGGTCAAGG - Intergenic
920985192 1:210882309-210882331 CCTCAAATGGAGATTGAGCAAGG + Intronic
921102330 1:211940026-211940048 CCACACCTGGTAAAAGAACAAGG + Intergenic
921751266 1:218796702-218796724 TCTCACATGGCTGAAGAGCAAGG + Intergenic
923773969 1:236961737-236961759 CATCACATGGTGACAGAGGAAGG - Intergenic
924669770 1:246111777-246111799 CCTCACATGGTGAAGTAGTCTGG - Intronic
924690747 1:246347701-246347723 CATCACATGGTGGAAGGGCCAGG - Intronic
924814050 1:247427154-247427176 CCTTACATGGTGAAGAGGCAAGG + Intronic
1064531181 10:16311841-16311863 GATAACATGGTGAGAGAGCAAGG + Intergenic
1065388406 10:25157007-25157029 CCTCACATGGTGGCAAGGCATGG - Intergenic
1065966834 10:30777557-30777579 CCTCACATGGCAGAAGAGCCAGG + Intergenic
1067050204 10:43011583-43011605 CCTCACATGGTGGAAGGGACAGG - Intergenic
1067367340 10:45645256-45645278 CCTTACATGTTTAAAGGGCATGG - Intronic
1068296867 10:55081634-55081656 ACTCACATAGCGAAAGGGCAAGG - Intronic
1070068604 10:73063316-73063338 CCTCACATGGTGAAGGCTGAAGG + Intronic
1070336484 10:75459800-75459822 CATCGCATGGTGGAAGTGCAAGG + Intronic
1071071152 10:81696031-81696053 TCTCACATGGTGAAAGGGGTAGG + Intergenic
1071725340 10:88192950-88192972 GCTGCCTTGGTGAAAGAGCATGG + Intergenic
1072894936 10:99358721-99358743 CCTCACATGAGGAACGAGCTCGG + Intronic
1073447591 10:103590673-103590695 CCTCAGATGGGGAAAGATTAGGG - Exonic
1073765305 10:106675859-106675881 CCTCACGTGGTGGAAGGGCAAGG - Intronic
1073952100 10:108821622-108821644 GATCACATGGTGAAAAAGGAAGG + Intergenic
1074022988 10:109603910-109603932 TGTCACATGGTGGAAAAGCATGG + Intergenic
1075955960 10:126523247-126523269 TCTCTCCTGGTGACAGAGCAGGG + Intronic
1077728401 11:4701342-4701364 CATCACATGGCAAAAGGGCAAGG - Intergenic
1078018106 11:7632703-7632725 CCTTGCATCTTGAAAGAGCAAGG + Intronic
1078195818 11:9135852-9135874 CCACACATGGTGGAAGAGGAAGG - Intronic
1078717621 11:13854847-13854869 CATCACATGGTGGAAGAGAGAGG - Intergenic
1078723518 11:13906203-13906225 CCACTCATGGTGAAAGGGGAAGG + Intergenic
1080257346 11:30305849-30305871 CCTCACATGGTGAAAGGCAATGG + Intergenic
1080671954 11:34388295-34388317 CCTCACATGAAAAAAAAGCAGGG - Intergenic
1081610733 11:44561714-44561736 CATCACATGGTGAGAGGGCAAGG - Intergenic
1083828327 11:65215610-65215632 GCTCACATGTAGAAAGACCAGGG - Intergenic
1085046532 11:73356845-73356867 CCCCTCGGGGTGAAAGAGCAGGG - Intronic
1085128864 11:74020589-74020611 CCTGTCATGCTGAAAGAGCTAGG - Intronic
1085681192 11:78576665-78576687 CATCACATGGCAAAAGAGGAAGG - Intergenic
1085713196 11:78848775-78848797 CCTCAGCTTGGGAAAGAGCAAGG + Intronic
1086191399 11:84083673-84083695 CATCCCTTGGTGAAAGGGCAGGG - Intronic
1086900450 11:92361510-92361532 CCTCATATGGCAGAAGAGCAGGG - Intronic
1088355434 11:108938736-108938758 CCTCCAGTGGTGAAAGAGAATGG + Intronic
1088781275 11:113136429-113136451 CTTCGCATGGTGCAGGAGCAAGG + Intronic
1088991167 11:114954754-114954776 CCTTACATGGTGGAAGAGAATGG + Intergenic
1089313081 11:117572865-117572887 CCCCACATTCTGAGAGAGCAGGG - Intronic
1090174128 11:124632704-124632726 CCTCACGTGGTAGAAGAGGAAGG + Exonic
1091142660 11:133249273-133249295 CATCCCATGGTGAGAGAGGAAGG + Intronic
1092158734 12:6303271-6303293 CCTGGCACTGTGAAAGAGCAAGG + Intergenic
1092293484 12:7179901-7179923 CATCACATGGTGAAAGGGCAAGG + Intergenic
1093160831 12:15744292-15744314 TCTCATAGGGTGAAAGAGGAAGG - Intronic
1096349041 12:50878947-50878969 CCTTACGTGGTGGAAGGGCAAGG - Intronic
1097260346 12:57716310-57716332 CCTCCCTTGGTGATAGAGGAGGG + Intronic
1098191722 12:67956233-67956255 CCTCACATGGTTGAAGAGACAGG - Intergenic
1098410181 12:70173416-70173438 TTTCACTTGGTGAAAGAGAAAGG - Intergenic
1098607380 12:72408078-72408100 CATCACATTGTGACAGAGCAAGG + Intronic
1099094017 12:78350629-78350651 TCTCACATGCTGAAAGTGCTTGG + Intergenic
1099969241 12:89483484-89483506 CCTCACATGGTGAGAGGCAAGGG + Intronic
1100097947 12:91066736-91066758 CCTCACATGGCGGAAGAGATGGG - Intergenic
1100785519 12:98073916-98073938 CCTCACAGGGGCAAAGACCAGGG - Intergenic
1101540490 12:105660549-105660571 CCTCACATGGCAGAAGAGCAAGG + Intergenic
1102414322 12:112747305-112747327 CCTCACATGGTGGAAGGGCAAGG - Intronic
1104207913 12:126657821-126657843 CCTCGCATGGTGGAAGGGAAAGG - Intergenic
1104435913 12:128756496-128756518 CATCACATGAAGACAGAGCAGGG + Intergenic
1105290009 13:19047637-19047659 CCTCAGCTGGTGACAGAGCCAGG + Intergenic
1105948928 13:25212452-25212474 CCTCACAGGGTCAGAGAGCCAGG + Intergenic
1106805563 13:33303032-33303054 CCTCACAGGCTGTGAGAGCAGGG - Intronic
1107006716 13:35620378-35620400 ACTCTCTTGGGGAAAGAGCATGG + Intronic
1107065389 13:36209523-36209545 TCTCACATGGTGGAGAAGCAAGG + Intronic
1107196540 13:37659311-37659333 CATCACAGGGGGAAAGAGGAAGG - Intronic
1107425120 13:40284873-40284895 CCTTAACTGGTGAAACAGCATGG - Intergenic
1107754324 13:43603210-43603232 CATGACATATTGAAAGAGCATGG - Intronic
1107869920 13:44736871-44736893 CCTCACATGGTGGAAGGGAGAGG + Intergenic
1110521979 13:76490546-76490568 ACAATCATGGTGAAAGAGCAAGG - Intergenic
1111990172 13:95108575-95108597 CCTCACATGGTGGAAGGTGAAGG - Intronic
1112071519 13:95856309-95856331 CCTCACATGGCTAAAGAGTATGG - Exonic
1112182926 13:97103170-97103192 CATCACATGATGAGAGAGAAAGG + Intergenic
1112216540 13:97435936-97435958 CCACTCATTTTGAAAGAGCAAGG + Intronic
1112234251 13:97621387-97621409 CCCCAAAGGGTGAAAGAGAATGG + Intergenic
1112874789 13:104023954-104023976 CATCACATGGTGAAAGAGGGAGG + Intergenic
1113631654 13:111892210-111892232 GCTCACAGGGTGACAGAGGAAGG - Intergenic
1114909798 14:27176535-27176557 CCTCACATTGGGAGAGAGGAAGG + Intergenic
1114986091 14:28230655-28230677 CCTCTCATGGTGAAACTGCTAGG - Intergenic
1115534364 14:34358631-34358653 AGTCACACGGTGAGAGAGCAGGG - Intronic
1115790403 14:36871258-36871280 CCTCACATGGTGAAAGAGCAAGG - Intronic
1115904575 14:38191641-38191663 CCACTCAGGGTGAAAGAGAAGGG - Intergenic
1116091520 14:40313166-40313188 CCTTACATGGCAGAAGAGCAAGG - Intergenic
1116503192 14:45646006-45646028 CCTCACATGGTAGAAGAGCAAGG - Intergenic
1116586304 14:46709199-46709221 CCTCAAATGGGAAAAGAGAAAGG - Intergenic
1116631406 14:47339645-47339667 CCACTCATGGTGAAAGAGGAAGG - Intronic
1116756717 14:48957746-48957768 GCACACAGGGTGAAAGAGCATGG + Intergenic
1116906458 14:50408343-50408365 CAGCACATGGTGGAGGAGCAAGG + Intronic
1117370951 14:55077972-55077994 CCTCATATTCTAAAAGAGCACGG + Intergenic
1118318499 14:64739740-64739762 CCTCACATGGCAAAGGGGCAAGG + Intronic
1119181360 14:72607384-72607406 CTTCACATGGTGAAGGGGCAAGG + Intergenic
1121674250 14:95739594-95739616 CCTCAGATGATGAAAGTGGAAGG + Intergenic
1121953021 14:98188671-98188693 TCTATAATGGTGAAAGAGCAAGG - Intergenic
1122275972 14:100590973-100590995 CTTCCCATGGAGACAGAGCAGGG - Intergenic
1122495847 14:102154371-102154393 CCTCACATGGTGGAGGGGGAAGG + Intronic
1122997964 14:105275878-105275900 CCTCACGTGGTAGAAGAGCTGGG - Intronic
1123670744 15:22654404-22654426 CCTCACTTGGTGAAAGGGGCAGG - Intergenic
1123736786 15:23192502-23192524 CCTCAGTTGGGGAAGGAGCAAGG + Intergenic
1124287485 15:28415480-28415502 CCTCAGTTGGGGAAGGAGCAAGG + Intergenic
1124288007 15:28421182-28421204 CCTCAGTTGGGGAAGGAGCAAGG + Intergenic
1124395950 15:29301827-29301849 CCTCACATGGTGGAAGGGGCTGG - Intronic
1125146920 15:36481771-36481793 CTTCACATGGTGGAAGGGCAAGG + Intergenic
1127416412 15:58761759-58761781 CCTCACTTGGCTAAAGAGAATGG - Intergenic
1127733801 15:61823271-61823293 CCTCACGTGGTGGAAGAGGCCGG - Intergenic
1128576342 15:68777864-68777886 CCTCTCAGAGTGAAAGAACATGG - Intergenic
1129921571 15:79323629-79323651 CCTCAGAGGGTGAAGGAGAAGGG - Intronic
1130038024 15:80379185-80379207 CCACTCATGGTGGAAGAGGAAGG - Exonic
1130562742 15:84971524-84971546 CCTCTCATGGTGGAAGGGGAAGG - Intergenic
1130921146 15:88345686-88345708 CCTCACATGGTAAAGGAGGAAGG + Intergenic
1131345174 15:91640160-91640182 CCTCACATGGTGGAAGGGTGAGG + Intergenic
1131689821 15:94814710-94814732 CCTCACATGGATGAAGGGCAAGG - Intergenic
1133441144 16:5821823-5821845 CCTCACATGGTGAAAGGAGAAGG + Intergenic
1136028529 16:27485804-27485826 CCAGACTGGGTGAAAGAGCAAGG + Intronic
1137866552 16:51903029-51903051 CCTCACAAGGAGATAGGGCATGG + Intergenic
1138730004 16:59184104-59184126 CCTCACATGGTGGAAGGGTGAGG + Intergenic
1139336441 16:66235032-66235054 CCTCACATGGTGAAGGGAGAAGG - Intergenic
1139660240 16:68415875-68415897 CCTCACAAAGTAAAAGAGAAAGG + Intronic
1139681818 16:68570938-68570960 CCTCAGATGCTGAAGGAGCTGGG + Intronic
1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG + Intergenic
1142515219 17:423357-423379 CCTCTCACGGTGAATGTGCAGGG - Intronic
1143819882 17:9551987-9552009 ACTATCATGGTGAAAAAGCAAGG + Intronic
1144237359 17:13274510-13274532 CCTCTCATGGTGGAAGGGGAAGG - Intergenic
1144585205 17:16483444-16483466 CCTCAGCTGGTGCAAGAGCTGGG - Intronic
1145837529 17:27965862-27965884 CCTCACATGGTGGAAGGGGCAGG + Intergenic
1146415026 17:32623831-32623853 CCTCACATGGCAAAAGGGCGAGG + Intronic
1146732508 17:35206085-35206107 CCACACATGGTGGAAGATGAAGG - Intergenic
1147479152 17:40742440-40742462 CCTCACAAGGTGGAAGGGCAAGG + Intergenic
1147846600 17:43408424-43408446 CCACACATGGTGATTGAACATGG + Intergenic
1148605989 17:48929192-48929214 CATAACATGGTGGAAGGGCAGGG + Intergenic
1149045981 17:52246174-52246196 GCTCACAAGGTAAAAGACCATGG + Intergenic
1149436290 17:56636322-56636344 CAGCTCATGGTGAAAGAGCCAGG + Intergenic
1149618348 17:58021378-58021400 CCACAAATGTTGAAAAAGCAAGG - Intergenic
1149635267 17:58162202-58162224 CCTCACATGGCAAAGGAGCAAGG - Intergenic
1151603039 17:75118344-75118366 GCTGACATGGAGAGAGAGCAGGG - Intronic
1151824806 17:76518275-76518297 CCTCACCTGGTGGAAGGGCAAGG - Intergenic
1152032390 17:77852582-77852604 CCTCAGCTGGTGAAGGACCAGGG - Intergenic
1152647315 17:81475393-81475415 ACACACAGGGAGAAAGAGCAAGG + Intergenic
1153780402 18:8490531-8490553 CATCACATGGTGAGAGAGGGAGG + Intergenic
1153970125 18:10218554-10218576 CCTGACAGGCTGAAAGAGGAGGG + Intergenic
1154183256 18:12156110-12156132 TGTCACATGGTGAGAGAGGAGGG - Intergenic
1155374406 18:25139915-25139937 CCTTACTTGGTGAAGGGGCAAGG - Intronic
1155769664 18:29680926-29680948 CCTCACATGGTAGAAGGGCAAGG + Intergenic
1157488190 18:48104347-48104369 CCACTCATGGTGGAAGAGGAAGG - Intronic
1157709156 18:49836994-49837016 TCTCACACGGTTAAAAAGCATGG + Intronic
1157768105 18:50318084-50318106 CCACTCATGGTGGAAGAGGAAGG - Intergenic
1157983589 18:52411257-52411279 CTTCACACTGTGAAAGAGCATGG + Intronic
1158013324 18:52754485-52754507 CCTCACATGGTGAAAGGAGCAGG - Intronic
1158411807 18:57212197-57212219 CCTGGCATGATGAAGGAGCATGG - Intergenic
1158618076 18:59005933-59005955 CCTCTCCTGGTGCTAGAGCAAGG + Intergenic
1158625356 18:59066578-59066600 CCTCACATGGCGGAAGGGTAGGG + Intergenic
1158727563 18:59987378-59987400 CCTCACATGGCAGAAGGGCAAGG - Intergenic
1159156763 18:64593178-64593200 CCTCACATAGCCGAAGAGCAAGG + Intergenic
1159540099 18:69764014-69764036 CCTCACCTTGCGCAAGAGCATGG - Intronic
1159955372 18:74515212-74515234 TCTCACATTGGGAAAGATCATGG + Intronic
1160082492 18:75742232-75742254 CCTCACATGGTGGCATGGCAGGG + Intergenic
1163800015 19:19358979-19359001 CCTCATATGCTGATGGAGCATGG - Intergenic
1163877166 19:19881936-19881958 CCCAACATGTTGAAAGGGCAAGG + Intronic
1164564995 19:29319336-29319358 CCTGCCATGGTGAAAAGGCATGG + Intergenic
1164861661 19:31566537-31566559 CCTGACAGGGGGAAAGAGGAGGG + Intergenic
1166051235 19:40261583-40261605 CGTCCCATGGTGAAAGGGGAAGG - Intronic
1166634188 19:44435033-44435055 ACACTCATGGTGGAAGAGCAAGG - Intronic
1166693634 19:44839577-44839599 CCACAGAAGGTTAAAGAGCAAGG - Intergenic
1167729431 19:51242733-51242755 CCTCACATGGTAGAAAGGCAGGG + Intronic
1167752011 19:51387221-51387243 CCGCGCCTGGGGAAAGAGCAGGG - Exonic
1168084968 19:54038843-54038865 CCTTACATAGTGAAAGAGACTGG - Intergenic
925214132 2:2078995-2079017 CCTTACATGGTGGAAGGGCCAGG - Intronic
925456598 2:4021678-4021700 CCTCACATGGTGGAAGAGTGGGG + Intergenic
926396441 2:12447380-12447402 CCTCACATGGCAAAAGGGAAGGG - Intergenic
926784117 2:16503249-16503271 CCTCACATGGTGGAAGGGATAGG + Intergenic
926907746 2:17821749-17821771 CTTCAGATGGTGAAAGATGAGGG - Intergenic
926947001 2:18199265-18199287 AATCAGATGGTGAAAGAACAGGG + Intronic
927242091 2:20928270-20928292 TCTCACATGATGCAAGAGGATGG + Intergenic
927952719 2:27183955-27183977 ACTCACAGGGTTAAAGAGAAGGG - Intergenic
928288769 2:30018955-30018977 CATCACATGATGACAGAACATGG + Intergenic
929815982 2:45231981-45232003 CCTCACATTGCGGAAGAGCAAGG + Intergenic
930912844 2:56650778-56650800 TCTCACATGGTGGAAGGGCAAGG - Intergenic
932970497 2:76535151-76535173 CTTCATATGGTAAAAGAGGAAGG + Intergenic
934936168 2:98467101-98467123 GCTCACATGGCGAGAGAGGAAGG + Intronic
935524426 2:104148032-104148054 CCTCACATGGTGGAAGGGGCTGG - Intergenic
936635559 2:114252454-114252476 CATCACGTGGTGAAAAAGAAAGG - Intergenic
938768348 2:134479015-134479037 TCTCACATGGGGAAGAAGCAAGG - Intronic
939402286 2:141709965-141709987 CCTCACATGGTTGAAGTACAAGG + Intronic
939684993 2:145188411-145188433 CCTCACAAGGTGAAAGGGTGAGG + Intergenic
940041992 2:149370498-149370520 CCTCACAAGGTAAAAGAGATGGG - Intronic
940385205 2:153063636-153063658 TCTCACATGGTGGAAGAGGCAGG - Intergenic
941083730 2:161092207-161092229 CCTCACATGGAGGAAGAGCAAGG + Intergenic
941657278 2:168157598-168157620 CCTCACATGGTAGAAGGGCACGG + Intronic
943297994 2:186161952-186161974 CTTCACATGGTGACAGGGCTTGG - Intergenic
943759085 2:191588940-191588962 CCTCACATGGAGAAAGGTCAAGG - Intergenic
944384333 2:199147878-199147900 CCTCACATGGTAGAAGGGCAAGG - Intergenic
944702942 2:202261852-202261874 GCTAACATGGTGAAATAACAAGG - Intergenic
945059755 2:205898704-205898726 GCTCACGTGGTGAAAGAGGAAGG - Intergenic
946246468 2:218390617-218390639 CCTCCCAAGGTCACAGAGCAAGG - Intronic
946655934 2:221947036-221947058 CCACACATGGCCAAAGAGAAAGG + Intergenic
946735676 2:222752115-222752137 CCTCACATGGTGAAACGTTAAGG - Intergenic
947324681 2:228961475-228961497 CCTCCCCTGGGGAAGGAGCAAGG - Intronic
947361788 2:229352848-229352870 CCTCACATGGTGGAAGGGACAGG - Intergenic
947364110 2:229376308-229376330 CTTCACATAGTGGAAGGGCAAGG - Intronic
947944513 2:234090135-234090157 CCTTACATGGTAAAAGGGGAAGG - Intergenic
948048402 2:234961023-234961045 CATCACAGTGGGAAAGAGCAGGG + Intronic
948106373 2:235417470-235417492 TCTCCCAGGGTGGAAGAGCAGGG - Intergenic
948317703 2:237041656-237041678 CCTCACATGGTGGAAGGGGCAGG + Intergenic
948704608 2:239781106-239781128 CCTCAAATGGTCAAGGGGCAAGG + Intronic
948943850 2:241209668-241209690 CCCCACATGGTGCAGGAGGATGG - Intronic
1168935734 20:1664044-1664066 CATCACATGGTGAGAGAGGAAGG + Intergenic
1169033117 20:2428541-2428563 CCTTGCATGGTGATAGACCACGG - Intronic
1169263998 20:4156661-4156683 CCTCACTGGGTGAATGAGGAAGG + Intronic
1170064173 20:12292625-12292647 CCTCACATGGTGGAAGGGACAGG - Intergenic
1170389331 20:15854683-15854705 CCTCACTTGGTGGGAGAGGAGGG + Intronic
1170570498 20:17629665-17629687 CCTCAGAAAGTCAAAGAGCAGGG - Intronic
1171102373 20:22397286-22397308 CATGACATGTTGAAAGAGCATGG - Intergenic
1171394799 20:24825111-24825133 CCTCACATGGTAGAAGACAAAGG + Intergenic
1171465356 20:25324133-25324155 CCTCACACTGTGGAAGACCATGG + Intronic
1172218280 20:33252020-33252042 CATCACATGGTGGAAAGGCAAGG - Intergenic
1172324175 20:34021438-34021460 CATCACATGGTGAGAGAGAGTGG + Intronic
1172493361 20:35359744-35359766 CCTCAGCTGGTGACAGAGTAAGG - Intronic
1172993998 20:39056588-39056610 CCTCAGATGGTGAAATGTCAAGG - Intergenic
1173134759 20:40429718-40429740 CCAATCATGGTGAAAGGGCAAGG + Intergenic
1173660216 20:44727892-44727914 CCTCACAAGGTGAAATCACATGG + Intronic
1174650416 20:52120101-52120123 CCACACATGGTGGAAGGGGAAGG - Intronic
1175004710 20:55669953-55669975 TGTCACATGGTGAAAGCACAGGG - Intergenic
1175029727 20:55939949-55939971 CCTCACATAGGGGAAGAGCAGGG + Intergenic
1175145841 20:56895677-56895699 CTTCACATGGGGTAAGACCAAGG + Intergenic
1175828417 20:61949572-61949594 CCTCACATGGTGGAAGGTGAGGG + Intergenic
1176032037 20:63017368-63017390 CCTCCCACGGTGAGAGAGGACGG + Intergenic
1176369324 21:6052939-6052961 CCTCACACGTGGAAGGAGCAAGG - Intergenic
1176691874 21:9921988-9922010 CCTCACATGGTGGAAGAGGGAGG - Intergenic
1177802357 21:25840378-25840400 GCTCACATGGTAGAAGGGCAAGG + Intergenic
1178046292 21:28697682-28697704 CCACTCATGGTGAAAGTGAAGGG - Intergenic
1178522829 21:33300716-33300738 CCTCACATGGTGGAAGAGATGGG - Intergenic
1178717985 21:34984265-34984287 CATCACAGTGTGAAAAAGCAAGG + Intronic
1178995163 21:37392587-37392609 CCTCACATGATGGAAGGGCAGGG + Intronic
1179503275 21:41823079-41823101 CCTCACATGGTAGAAGGGTAGGG - Intronic
1179604790 21:42507708-42507730 CCTCACATAGTGAGAGGGGAAGG + Intronic
1179754195 21:43485602-43485624 CCTCACACGTGGAAGGAGCAAGG + Intergenic
1181450981 22:23020517-23020539 CCTCACATGGTGGAAGGGACAGG - Intergenic
1181974100 22:26716338-26716360 CCTCACAAGGTGTTTGAGCAGGG - Intergenic
949122613 3:404989-405011 CCTCACATCGTGAAAGGGGTAGG + Intronic
949303273 3:2609305-2609327 CCTCACATGGTGAAGGCAGAAGG - Intronic
949910989 3:8907831-8907853 ACCCACATGCTGAAAGGGCAGGG + Intronic
951404413 3:22277819-22277841 CATTACATGATGAAAGAGCGAGG + Intronic
952343751 3:32466061-32466083 CCTCAAAGGGTGAAGGACCAAGG + Intronic
952625795 3:35401772-35401794 CATCTCATGATGATAGAGCATGG - Intergenic
952685672 3:36145380-36145402 CCTCACATGGAGAAAGGGCAAGG + Intergenic
952987066 3:38794941-38794963 CCTCTCATGTTGTAAGAGAAGGG - Intergenic
953120046 3:40031202-40031224 CCTCACATCGTGGAAGGGCAAGG + Intronic
953686286 3:45080889-45080911 AATCACATGGTGAGAGAGGAAGG - Intergenic
954588357 3:51756827-51756849 CATCACATGGTGAGAGAGGAAGG + Intergenic
954655363 3:52191137-52191159 CCTGATATGGAGAAGGAGCATGG - Intergenic
955148818 3:56346840-56346862 CCTCCAATGGAGAAAGGGCAAGG + Intronic
956051420 3:65252254-65252276 CTGCAGATGGGGAAAGAGCAAGG - Intergenic
957147492 3:76443098-76443120 CATCACATGGCGAGAGAGGAAGG + Intronic
958836021 3:99146018-99146040 CCTCACATGGTGGAAGGCAATGG - Intergenic
959515073 3:107256693-107256715 CCACACATGGTGGAAGAAGAGGG + Intergenic
959661648 3:108875184-108875206 CTTGACATGGAGAAAGAGAAAGG + Intergenic
959770186 3:110085665-110085687 CCTCACATGGTGGAAGGGGCAGG - Intergenic
960499571 3:118419805-118419827 TCTCACATGGTGAAAAATCAAGG - Intergenic
960523355 3:118681229-118681251 CATCACATGGTGAGAGAGGAAGG - Intergenic
961498650 3:127314977-127314999 CCACTCATGGTGGAAGAGGAGGG + Intergenic
961541029 3:127599440-127599462 CCTCAAATGGTGGAAGGTCACGG - Exonic
961993184 3:131213990-131214012 CCTCATATGGTGGAGGAGCATGG - Intronic
961998762 3:131273113-131273135 CCACACCTGCTGAAAGAGAATGG + Intronic
962071808 3:132041528-132041550 CCTCACATGGTAGAAAAGAAGGG + Intronic
963173724 3:142277380-142277402 CCTCACGTGGTGAAAGGCAAAGG - Intergenic
963581569 3:147132767-147132789 CCACACTTGGTAACAGAGCAAGG - Intergenic
963713001 3:148768825-148768847 CCTCACATGGTGGAGGGGCAGGG - Intergenic
963989368 3:151635419-151635441 CCTCACATGGTGGAAGGGGAGGG + Intergenic
965460617 3:168957547-168957569 CTTCACATTGTGAAAGACTAAGG + Intergenic
966001046 3:174949006-174949028 CCTCACATGGCAGAAGAGAAAGG + Intronic
966003838 3:174983604-174983626 CCTCACATGGTGGAAGGGGCAGG + Intronic
966938794 3:184732057-184732079 CCAGCCATGGTGACAGAGCATGG + Intergenic
967123459 3:186404525-186404547 CCTCACATGGTGAAAGGGCAAGG - Intergenic
968292136 3:197547121-197547143 CCTCAAATGGTGAGGGAGCGGGG - Intronic
969039613 4:4285508-4285530 CATCACATTCTCAAAGAGCATGG + Intronic
970237711 4:13975402-13975424 CCTCACATGGCGAAAGGGGAAGG + Intergenic
972161572 4:36234299-36234321 CCTCACATGGCAGAAGGGCAAGG + Intronic
973665447 4:53154344-53154366 TATCACATGGTGAAAGAGAATGG + Intronic
974989024 4:69062200-69062222 CCTGACTTGGAGAAAGACCATGG - Intronic
975805082 4:78103692-78103714 CCTCACATGGTGAAAGGGGTTGG - Intronic
976168053 4:82276000-82276022 CTCCACCTGGTGATAGAGCAGGG - Intergenic
976542993 4:86299450-86299472 CCTCACCTGATGAAGGAACAAGG - Intronic
977141927 4:93384126-93384148 CCTCACATGGCCAAAGGGGAAGG + Intronic
977889809 4:102296765-102296787 GCTAAAATGGTGACAGAGCAAGG + Intronic
977941334 4:102862980-102863002 GTTCACATGGTGAGAGAGAAAGG + Intronic
979132571 4:117066251-117066273 ACACACATGTGGAAAGAGCAGGG + Intergenic
979306786 4:119155074-119155096 CATCACATGGTGAGAGAGGAAGG + Intronic
979930540 4:126624574-126624596 CCTCACATGGTGGAAGCATAAGG + Intergenic
980069579 4:128229265-128229287 CTTCAGCTGGTGAAATAGCAAGG - Intergenic
980115632 4:128676538-128676560 CATGACCTGGTGAAAGAACACGG - Intergenic
980364460 4:131782191-131782213 CCTCACATGGTGGAAGAGGGAGG - Intergenic
981552973 4:145960417-145960439 CCTCACAAGGTGAAAGGGAAAGG + Intergenic
982101409 4:151971817-151971839 GATCACATGGTGAAAGAAGAAGG - Intergenic
982560632 4:156924954-156924976 CCTCACACAGTGAAAGAGTCAGG + Intronic
983645734 4:169989646-169989668 CCTCAGATGGTGACAGAGTGAGG + Exonic
983664763 4:170168495-170168517 CCTCTCATGGTGACAGAGAGGGG + Intergenic
984290874 4:177792312-177792334 CATCACATGGTGGGAGAGGAAGG + Intronic
984546191 4:181106593-181106615 TCTCTCTTGGTGACAGAGCATGG - Intergenic
985384921 4:189435100-189435122 CCAATCATGGTGAAAGAGGAAGG + Intergenic
986985779 5:13499675-13499697 CCTAACATGGCCAAAGGGCAAGG - Intergenic
987774691 5:22349076-22349098 CCTCATATGGTGAAGGGACAAGG - Intronic
988708988 5:33754653-33754675 GCCAACATGGTGAAACAGCATGG + Intronic
990465451 5:56067244-56067266 CCTCACATGGAGAAAGGGTAAGG - Intergenic
991582813 5:68174465-68174487 CCTCACATGGTGGAAGGGCAAGG + Intergenic
993233787 5:85276049-85276071 CATCACATGGTGAAAAGACAAGG - Intergenic
993699098 5:91097237-91097259 CCTCACATGGTGGAAGGGGCAGG + Intronic
993771481 5:91933300-91933322 CCTCCTATGGTGGAAGGGCAAGG + Intergenic
994381645 5:99078851-99078873 CCTCACATGATGGAAGAGAGAGG + Intergenic
994820411 5:104643442-104643464 CCCCACATGAAGAAACAGCACGG + Intergenic
996214020 5:120845873-120845895 CCTCACATGGTGGAAGGTAAAGG - Intergenic
997762080 5:136458989-136459011 CCTCATATGGCTAAAGAGAAGGG - Intergenic
998738651 5:145173457-145173479 GGTCACATGATGAAATAGCATGG + Intergenic
999001239 5:147925208-147925230 TATCACATGGTGAGAGAGGAGGG + Intergenic
999816139 5:155178244-155178266 CTTCACATGGTGAAAGGGCAAGG - Intergenic
1000410332 5:160930677-160930699 CCTCAGGTGGAGAAAGGGCAGGG - Intergenic
1001890942 5:175337957-175337979 TGTCACATGGTGAGAGAGGAAGG - Intergenic
1002002553 5:176206265-176206287 TCTCACATGGTGAAAGCAGAAGG + Intergenic
1002449844 5:179312416-179312438 CCTCACATGCTGAAAGGGTGAGG - Intronic
1003193049 6:3890915-3890937 CCTCACATAGTGGAAGAAGAAGG - Intergenic
1003946213 6:11078263-11078285 CCTCACATGGTGGAAGGGCAAGG - Intergenic
1004551647 6:16653772-16653794 CCTCACATCCTGAAAAAGCTTGG + Intronic
1005214519 6:23509606-23509628 CCTCACATGGAGGAAGGGAAAGG - Intergenic
1005457796 6:26038145-26038167 CATAACATGTTGAGAGAGCAAGG + Intergenic
1006036230 6:31214932-31214954 CATCCCATGGTGAAAGAGGTAGG + Intergenic
1007835077 6:44667907-44667929 CATCACAGGGTTAAAGAACAAGG + Intergenic
1008679052 6:53853036-53853058 CCTCACATTGTGGAAGGGCAGGG + Intronic
1008787342 6:55184827-55184849 CCTCACATGGTTATAAACCATGG - Intronic
1008868169 6:56240279-56240301 CCTCACATGGTGGAAGACTAAGG - Intronic
1009494659 6:64332183-64332205 CCTGACATGGAGAAGGACCACGG - Intronic
1009811990 6:68680033-68680055 CCTCACATAGTGAAAGGGACAGG - Intronic
1009947413 6:70355908-70355930 CCTCACATGGTGGAAGGGCAAGG - Intergenic
1010043129 6:71410344-71410366 ACCGTCATGGTGAAAGAGCAAGG - Intergenic
1012458438 6:99432172-99432194 CCTCACATGGGAAAAGTACAAGG - Intergenic
1012868670 6:104647134-104647156 CCTCACATGGTGGAAGGCAAAGG - Intergenic
1012926621 6:105274273-105274295 CCTCACATGGTGGAAGGGATGGG + Intergenic
1013705086 6:112823485-112823507 CCACACTTGGTGACAGAGCAAGG + Intergenic
1014274036 6:119366603-119366625 TCTCAAATGGTGAAAGATGAAGG + Intergenic
1015169890 6:130240762-130240784 CCTCACATGGTGGAAGGGCAAGG - Intronic
1015175723 6:130306003-130306025 CCTCACATGGTGGAAGGAAAAGG + Intronic
1015211942 6:130708604-130708626 GATCACATGGTGAGAGAGGAAGG + Intergenic
1016149859 6:140727020-140727042 CATTACATGGTGAAAGAAAAGGG - Intergenic
1016150355 6:140734073-140734095 CCTCACATGTGGAAAGAACAGGG - Intergenic
1016227563 6:141758627-141758649 CATCACATGGTGAGGAAGCATGG - Intergenic
1017595645 6:156025901-156025923 CCTCACATGGTGGAGGGGGAGGG - Intergenic
1019841605 7:3451584-3451606 TCTCACATAGTGAAAGATAATGG - Intronic
1020591629 7:10146527-10146549 TATCACATGGTGAGAGAGAAAGG + Intergenic
1021062462 7:16130933-16130955 CCTCACATGGTGGAAGGGTGTGG - Intronic
1021291481 7:18850860-18850882 CCTCACATGGTGGAAGGGTGAGG + Intronic
1022415118 7:30170812-30170834 GCTCACATGGTGACAGAGCTGGG + Intergenic
1022969291 7:35502752-35502774 GCACACATGGTGAAAAAGGACGG + Intergenic
1024390588 7:48807204-48807226 CCTCACATGGTGAAGGGGCAAGG - Intergenic
1026277719 7:68894768-68894790 CCTCACATGGAGGAAGAGGGAGG - Intergenic
1026290215 7:68999316-68999338 CCTCATATGGTAAAAGAGGCAGG + Intergenic
1028134511 7:87211338-87211360 CCTGGGATGGGGAAAGAGCAAGG + Intronic
1028155927 7:87429308-87429330 CCTCACTTGCTAAATGAGCAGGG - Intronic
1028224059 7:88229284-88229306 CCTCATATGATGAAAGGACAAGG - Intergenic
1029502371 7:100939882-100939904 CTTCACATGGTAGAAGGGCAAGG - Intergenic
1029972454 7:104802543-104802565 CCTCACATGGTGGAAGGGGAGGG - Intronic
1030618958 7:111769013-111769035 CTTCACATGGTGAAAGGGGCTGG - Intronic
1031198977 7:118653704-118653726 CCCAAAACGGTGAAAGAGCATGG - Intergenic
1032742045 7:134748938-134748960 CCTCACATGGTGAAAGGGGTGGG - Intronic
1033004396 7:137545894-137545916 ACTCACATGGTGAAGGAGCCGGG + Intronic
1033992804 7:147308605-147308627 CCTCAAATTGTGAAAGGGGAAGG - Intronic
1034949835 7:155289838-155289860 CCTCACATGGTGAAGGGGCCAGG + Intergenic
1036282539 8:7414125-7414147 CCTCCCAAGGAGAGAGAGCAGGG + Intergenic
1036338933 8:7897424-7897446 CCTCCCAAGGAGAGAGAGCAGGG - Intergenic
1036526848 8:9542814-9542836 CACCACATGGTGAAAGAGGAAGG + Intergenic
1038169569 8:25116883-25116905 CCTGCCCTGGTGTAAGAGCAGGG + Intergenic
1038684565 8:29704526-29704548 CCTCACATGGCAAAAGGGCAAGG + Intergenic
1039307176 8:36275260-36275282 CCTCACATGGTAGACGGGCAAGG + Intergenic
1039553985 8:38463853-38463875 ACTCACATGTTGAGAGGGCAGGG + Intronic
1041127742 8:54662109-54662131 GCTCACATGGGAAAAGAGAATGG - Intergenic
1041313154 8:56536740-56536762 CCTCACATGGGGAGAGAGAGAGG + Intergenic
1041551884 8:59112112-59112134 CCTCCCATCAGGAAAGAGCAAGG + Intronic
1041799935 8:61787767-61787789 CCACACATTGTGAAAGAGTGTGG + Intergenic
1042659674 8:71140849-71140871 CCTCACATGATGAAAGGGGTGGG + Intergenic
1042820227 8:72922565-72922587 CCTCACATGGTGGAAAAGGCAGG + Intronic
1042938757 8:74086801-74086823 TCTCACATGGGGAAGGAGCAAGG - Intergenic
1043651033 8:82592386-82592408 CCTCACATGTGGAAAGGGCAAGG + Intergenic
1044921473 8:97173974-97173996 TCTCACCAGTTGAAAGAGCAGGG - Intergenic
1046183368 8:110681924-110681946 CCTCACATAATGAAAGAGTTGGG + Intergenic
1046426219 8:114053505-114053527 CCTCACATGGCAGAAGGGCAAGG + Intergenic
1047539258 8:125748393-125748415 CCTCACATGGTAAAGGGGCAAGG + Intergenic
1047710493 8:127546892-127546914 CCACACATGGTTACTGAGCACGG + Intergenic
1048704990 8:137143642-137143664 AATCACATGGTGAGAGAGCAAGG - Intergenic
1049071169 8:140357229-140357251 AGTCACATGGTGAAGGGGCAGGG + Intronic
1050014828 9:1222454-1222476 CCTCACTTGGTGAAGGTGGAAGG - Intergenic
1051446612 9:17146549-17146571 CCTCACATGGCAGAAGAGAAGGG - Intronic
1052341757 9:27370537-27370559 CTTCACATGGAGAAAGAAAAAGG - Intronic
1053628811 9:39908081-39908103 CCTCACATGGTGGAAGAGGGAGG - Intergenic
1053777257 9:41558263-41558285 CCTCACATGGTGGAAGAGGGAGG + Intergenic
1054215076 9:62342621-62342643 CCTCACATGGTGGAAGAGGGAGG + Intergenic
1054364475 9:64320223-64320245 CCTCACATGGTGGAAGAGGGAGG - Intergenic
1054672405 9:67812728-67812750 CCTCACATGGTGGAAGAGGGAGG - Intergenic
1056461169 9:86810933-86810955 CCTCACATGGAAAAGGAGGAAGG - Intergenic
1056528918 9:87469821-87469843 CCACCCATGGTGAAGGAGCTAGG + Intergenic
1057126647 9:92621057-92621079 CTTCACATGGTGAAAGGGGCTGG + Intronic
1057272045 9:93656930-93656952 CCTCAGCTGGTGACAGAGCCAGG - Intronic
1057565630 9:96164004-96164026 CCTCACTTGAAGAAAGGGCATGG - Intergenic
1058109575 9:101017708-101017730 CCTCACATGGTGAAGGCAGAAGG + Intergenic
1058238776 9:102528970-102528992 CCTCACATGATGGAAGAAAAAGG + Intergenic
1058546821 9:106069438-106069460 CCACAGATGGGGAAAGAGAATGG + Intergenic
1058548910 9:106092273-106092295 CTTCACTTGGCGAAAGGGCAAGG + Intergenic
1059265781 9:113029001-113029023 CCTCAGATTGTGAAATAGCTGGG - Intergenic
1060785734 9:126450502-126450524 CCTCACATGGGGATGGAGCAGGG - Intronic
1185586084 X:1243029-1243051 CCCCACAGGAGGAAAGAGCAGGG + Intergenic
1185997865 X:4973111-4973133 CCTCACACGGTGGAAGGACAAGG - Intergenic
1186147097 X:6635775-6635797 CCTAAGATGGTGATAGAGCTTGG - Intergenic
1186395586 X:9205702-9205724 CCTCACAGGGTGGAAGGGCAAGG + Intergenic
1186487630 X:9945955-9945977 CCTCACCTGGAGAAAGGGGAAGG - Intronic
1186518370 X:10184214-10184236 CCTCACATTCTGCAAAAGCAAGG - Intronic
1188146146 X:26616379-26616401 CATCACATGATGAGAGAGGAAGG + Intergenic
1188248846 X:27866641-27866663 CTAAACATGGAGAAAGAGCATGG - Intergenic
1188391785 X:29630157-29630179 CCTCACATGGTGAAGGGAGAAGG + Intronic
1188584564 X:31757608-31757630 CCTTACATGGTGGGAGGGCAAGG + Intronic
1188678215 X:32969072-32969094 CCTCACATGGTGGAGGGGAAAGG - Intronic
1188927280 X:36059976-36059998 GATCACATGGTGAGAGAGGAAGG - Intronic
1189025565 X:37390142-37390164 CCTCACATGGCAAAAGGGGATGG + Intronic
1190605995 X:52143438-52143460 CATCACATGGCAAAAGAGGAAGG + Intergenic
1190793866 X:53723553-53723575 CATCACATAGTGAAAGATGAGGG - Intergenic
1192211237 X:69129180-69129202 TCTCCCATGGGGAAAGAGCTGGG - Intergenic
1192672984 X:73166274-73166296 CGTCACATGATAAAAGAGAAAGG + Intergenic
1193136954 X:77983014-77983036 CCTCACATGGTGGAAGGGACAGG + Intronic
1193942617 X:87694787-87694809 GATCACATGGTGAAACAGGAAGG + Intergenic
1194190250 X:90826230-90826252 TGTCACATGGTGAGAGAGGAAGG - Intergenic
1194579657 X:95656211-95656233 CCTCACATGGTTGAAGAGCAAGG - Intergenic
1194680229 X:96843198-96843220 TGTCACATGGAGAAAGAGTAAGG - Intronic
1195307463 X:103598451-103598473 CCTCACATGGTAGAAGAGTGAGG - Intergenic
1196829952 X:119767985-119768007 CATCACATGGTGATAGAGGAAGG - Intergenic
1198251945 X:134887857-134887879 CCTCACATGGTTAAACAGTGAGG + Exonic
1198363173 X:135915660-135915682 CCTCACATGTTGAAGAAGCATGG - Intergenic
1198647893 X:138829412-138829434 GATCACATGGTGAGAGAGGAAGG - Intronic
1200259374 X:154604177-154604199 CATCACATAGTGAGAGAGGAAGG + Intergenic
1200536846 Y:4408330-4408352 TGTCACATGGTGAGAGAGGAAGG - Intergenic