ID: 1115793392

View in Genome Browser
Species Human (GRCh38)
Location 14:36905212-36905234
Sequence ATGCTTCAGCAAAAGCTATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115793390_1115793392 15 Left 1115793390 14:36905174-36905196 CCAAACTACAATTTATGCTGGAT 0: 1
1: 1
2: 0
3: 3
4: 148
Right 1115793392 14:36905212-36905234 ATGCTTCAGCAAAAGCTATGTGG 0: 1
1: 0
2: 1
3: 11
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115793392 Original CRISPR ATGCTTCAGCAAAAGCTATG TGG Intronic
902465475 1:16614778-16614800 AAGCATGAGCAAAAGCTCTGTGG - Intergenic
903004759 1:20291274-20291296 ATGCTTCAGCATAAGAAGTGAGG + Intronic
905368267 1:37467745-37467767 AGGCTTCAGGAAAGGCTATGGGG + Intergenic
909012598 1:70351817-70351839 ATGTATCAGAAAAATCTATGAGG + Intronic
910000960 1:82341775-82341797 ATGCTTCAGAAATTGATATGAGG + Intergenic
911714266 1:101112642-101112664 ATGCTTCAGCAAATGCAATCTGG + Intergenic
911878379 1:103199307-103199329 ATGTTTCAACATAGGCTATGGGG + Intergenic
912037008 1:105329887-105329909 ATGTTTCTGCAAATCCTATGAGG - Intergenic
913494066 1:119411239-119411261 ATGCATCAGCATAAGATAGGAGG + Intergenic
913995040 1:143644565-143644587 AAGCATGAGCAAAAGCTCTGTGG - Intergenic
914361126 1:146937466-146937488 AAGCATGAGCAAAAGCTCTGTGG + Intergenic
914491462 1:148153166-148153188 AAGCATGAGCAAAAGCTCTGTGG - Intergenic
914578327 1:148997004-148997026 ATGACTCAGCAACAGCTGTGGGG + Intronic
915629325 1:157139024-157139046 GTGCTTCAGAGAAAGCTTTGCGG - Intergenic
917559949 1:176140163-176140185 ATGATCCAGTAAAAGCTTTGAGG - Intronic
918981932 1:191572622-191572644 TTTCTTCAGCAAAAGCCATCTGG + Intergenic
919671342 1:200341007-200341029 ATTTTTCAGCAAAAGCTCTTTGG - Intergenic
919685901 1:200483381-200483403 ATGCTTCTGAAAAAGTTCTGTGG + Intergenic
921325519 1:213983590-213983612 AAGCGACAGCAAAAGATATGTGG + Intronic
922364813 1:224853990-224854012 AGGCTTTAGCAAAAGCACTGGGG + Intergenic
923658057 1:235935510-235935532 GTGCTTCAGCAAAAGTTTTTTGG - Intergenic
1066440936 10:35437817-35437839 AGGTTTCAGCTAAAGCTAAGGGG - Intronic
1067799813 10:49351220-49351242 ATTCTTCTGCAAAAGGTATGTGG - Intergenic
1072317499 10:94216857-94216879 ATGCCTCAGCAAACACTGTGCGG - Intronic
1074200745 10:111232908-111232930 ATCCATCTGCAAATGCTATGTGG - Intergenic
1080956571 11:37103758-37103780 TTGGTTAAACAAAAGCTATGAGG - Intergenic
1081754876 11:45537368-45537390 ATCCTTCAGGAGACGCTATGAGG - Intergenic
1086426294 11:86686791-86686813 CTGCTTAAGCAAAAGCAAGGAGG - Intergenic
1089895229 11:121923992-121924014 ATTTTTCAGGAAATGCTATGAGG + Intergenic
1090715277 11:129424830-129424852 ATGATTGAGCACAAGCTATGAGG + Intronic
1098818441 12:75198879-75198901 ATGTTTAAGCAAAAACTATTTGG - Intronic
1099341763 12:81445706-81445728 ATGCTCCAGTAATAGCTATTGGG + Exonic
1099430212 12:82574337-82574359 ATGCTTCATAAAAAGTTGTGGGG - Intergenic
1102417084 12:112773269-112773291 ATCCTTCAACAAAAGGGATGGGG - Intronic
1102882050 12:116493077-116493099 ATGAGTCAGCAGAAGCCATGAGG + Intergenic
1102982507 12:117253357-117253379 ATCCTTCAGCACAAACAATGGGG + Intronic
1104229067 12:126866011-126866033 ATACTTCAGCAATGCCTATGTGG - Intergenic
1108286323 13:48912172-48912194 ATGCTTCACTAAAAATTATGTGG - Intergenic
1109257931 13:60106350-60106372 ATGCTGCTGGAAAAACTATGTGG + Intronic
1110404825 13:75138409-75138431 ACGCTTCAGCTAAATCTGTGTGG - Intergenic
1110909821 13:80943582-80943604 ATGTTTTAGCAAAAAGTATGAGG + Intergenic
1112126623 13:96475540-96475562 ACGTATCAGCAAAAGCTATTTGG + Intronic
1114808637 14:25869448-25869470 CTGCTTCAGCAAAAGATGTCTGG - Intergenic
1115394640 14:32894363-32894385 ATTCTTCAGCAAGGGATATGTGG - Intergenic
1115793392 14:36905212-36905234 ATGCTTCAGCAAAAGCTATGTGG + Intronic
1117429260 14:55636715-55636737 ATGCTTCAGGCAAAGCTAGTAGG - Intronic
1122566527 14:102661570-102661592 GTGCTTCAGGAAAAGCAATGGGG + Intronic
1126381289 15:48050080-48050102 AAGCTTCATCACTAGCTATGAGG + Intergenic
1127869391 15:63058404-63058426 ATGCTTCATCAAAAGATAGTGGG + Intronic
1128018149 15:64366407-64366429 ATCCTTCAGCAAGAACTTTGTGG + Intronic
1129065548 15:72901066-72901088 ATTATTCAGGGAAAGCTATGCGG - Intergenic
1130209195 15:81907752-81907774 ATGCACCAGGAACAGCTATGTGG + Intergenic
1131575664 15:93588114-93588136 ATTCTTCAACACAAGCTATGTGG - Intergenic
1132991276 16:2796212-2796234 ATTCTTCAGCAAAAGAGCTGAGG - Intergenic
1133999923 16:10775005-10775027 CTGGTTCAGCAAGAGCTTTGTGG - Exonic
1134195989 16:12159457-12159479 AAACTTCAGCAAAAGCTTTAGGG - Intronic
1135359014 16:21795267-21795289 ACACTTCAGCAAAGGCTAAGTGG + Intergenic
1135457568 16:22611704-22611726 ACACTTCAGCAAAGGCTAAGTGG + Intergenic
1142716734 17:1751123-1751145 ATTCTGCAGCAAAAGCAGTGTGG - Intronic
1152359172 17:79822605-79822627 ATGGTTCAGAAAAAAATATGTGG - Intergenic
1152822230 17:82443267-82443289 CAGCTTCAGCATAAGCTGTGAGG - Exonic
1155388890 18:25312409-25312431 CTGCTGCAGCAAAATCAATGTGG + Intronic
1159701195 18:71630326-71630348 ATCCTTCAGAAAAAGCTTGGAGG + Intergenic
1159892122 18:73962965-73962987 GAGTTTCAGCAAAAGCTAAGTGG - Intergenic
1159993115 18:74933980-74934002 CTGCTGCAGTAAAAGCTATTAGG - Intronic
1160094933 18:75862518-75862540 ATGCTTCCCCAAAGGCTCTGTGG - Intergenic
925625448 2:5838375-5838397 ATGCTTCTGCAAAAGGCATTTGG + Intergenic
928455493 2:31416853-31416875 ATGCTCCAGGAAAAGCTAAAGGG + Intergenic
929842031 2:45476979-45477001 ATGTATCAGGTAAAGCTATGTGG - Exonic
930905705 2:56564285-56564307 ATGTTGCAGGAAAAGATATGAGG + Intergenic
935012089 2:99144870-99144892 ATGCTTGAGGAACAGCAATGGGG + Intronic
936680980 2:114770903-114770925 ATCCTTCAGCAAGAAATATGTGG + Intronic
939060307 2:137414141-137414163 ATGCCATAGCAAAAGCTATTAGG + Intronic
940558172 2:155259070-155259092 ATACTACAATAAAAGCTATGTGG - Intergenic
943504747 2:188740970-188740992 AAGTTTCAGCAAAACCAATGAGG - Intronic
943826279 2:192397697-192397719 ATGCTTAAGGAAAAGATATATGG - Intergenic
944082792 2:195807728-195807750 AAACTTTAGGAAAAGCTATGTGG + Intronic
944149910 2:196546876-196546898 AAGAATAAGCAAAAGCTATGAGG + Intronic
944174938 2:196818615-196818637 ATGCTTGAGCAAAAGCCAGCTGG + Intergenic
1169626277 20:7573325-7573347 AGGCATCAGCAAGAGATATGGGG + Intergenic
1171343793 20:24450768-24450790 TTGCTTCAGCAGAAGCTACATGG - Intergenic
1172413815 20:34747427-34747449 ATTCTGCAGCAAAATCTTTGTGG - Intronic
1177729653 21:25011811-25011833 ATGGATTAGCAAAAGGTATGAGG + Intergenic
1178206126 21:30468721-30468743 AGGCTTCCACAAAAGCTTTGGGG - Intergenic
1182377995 22:29862435-29862457 AGGCTTTGCCAAAAGCTATGAGG + Intergenic
1183313210 22:37122799-37122821 ATCCTTAAGCAAATGCCATGAGG - Intergenic
951036856 3:17942101-17942123 ATGTTTCAGCACAATTTATGAGG + Intronic
951541191 3:23783523-23783545 ATGGTTTAGCAATAGCTCTGGGG + Intergenic
953514912 3:43580528-43580550 ACGCTTCAGCAAATACTATAAGG + Intronic
954871713 3:53772353-53772375 ATACTTCAGCAGAAGCAAGGTGG + Intronic
958621035 3:96560477-96560499 ATTCTTCTGGAAAGGCTATGAGG + Intergenic
958701897 3:97602069-97602091 ATGCTTTTGCAAAAACTCTGGGG - Intronic
960263635 3:115595754-115595776 ATGAATCATCAGAAGCTATGTGG + Intergenic
960682606 3:120264539-120264561 AAGCATCAACAAAACCTATGAGG - Intronic
961052457 3:123758459-123758481 ATGGCTCAGCAAATGCCATGTGG + Intronic
963328519 3:143888800-143888822 ATGCATTAGCAAAAGCTATATGG + Intergenic
963855096 3:150245184-150245206 ATGATGCAGTAGAAGCTATGAGG - Intergenic
963875252 3:150468076-150468098 AGACTTCAGAAAAAACTATGGGG - Intergenic
966389364 3:179435921-179435943 TTGCTTCAGTAAAAGTTCTGTGG - Intronic
970700520 4:18731594-18731616 ATACTACAGAAAAAGCCATGTGG - Intergenic
970931457 4:21517073-21517095 GTTCTTCACAAAAAGCTATGAGG - Intronic
971534605 4:27733555-27733577 ATTCTTCAGAAAAAGGTAGGAGG + Intergenic
974157623 4:58094570-58094592 ATGCTACAGCAAAGGTTATCAGG + Intergenic
974485656 4:62502183-62502205 AAGCTTCACAAAATGCTATGGGG + Intergenic
975698405 4:77037643-77037665 ATGTTTGAACAAAAGATATGGGG - Exonic
979216721 4:118173485-118173507 ATGCTAGAGCAATAGCAATGGGG + Intronic
979967729 4:127095817-127095839 AACCTTCACAAAAAGCTATGAGG + Intergenic
981175528 4:141678525-141678547 CTGCTTCAGAAAAATCCATGGGG - Intronic
981689391 4:147490013-147490035 ATGCTTCAGCAGCAGCAATTCGG - Intronic
984346195 4:178530255-178530277 ATACTTCAGAATAAGCAATGAGG + Intergenic
986737358 5:10678016-10678038 ATGTTTCCCCAAAAGATATGTGG + Intergenic
987483916 5:18498211-18498233 ATGCTTCAACAAAAGCAAATTGG - Intergenic
988815505 5:34830443-34830465 AACCCTCAGCAAAAGCTATCTGG - Intronic
990322059 5:54639861-54639883 ATGTATCAGCAAAAGCCAGGTGG + Intergenic
990571681 5:57085368-57085390 ATGGTTCAGCAAAAGATAATTGG - Intergenic
991246193 5:64510868-64510890 GTGCTTAAGCAATAGCCATGAGG - Intronic
993558421 5:89371477-89371499 TTGCTTCCAGAAAAGCTATGAGG + Intergenic
994558010 5:101329884-101329906 ATGAATCACCAAAAGCTAGGTGG + Intergenic
996234703 5:121111040-121111062 AGGCTTCAGAAAAAGTTATCAGG - Intergenic
996558155 5:124799992-124800014 GCGCTTCCCCAAAAGCTATGAGG - Intergenic
997070638 5:130618294-130618316 ATCCATCAGCAAATCCTATGGGG + Intergenic
997735037 5:136206937-136206959 GTGCTTCAGCAAAAGCCATTAGG - Intergenic
998594115 5:143510232-143510254 ATGCTTCAAGAATAGCTATTTGG - Intergenic
1000462036 5:161535069-161535091 TTGCTTCAGCAAAATCTGTCAGG - Intronic
1000548676 5:162632754-162632776 GTGTTTCAGAAAGAGCTATGAGG - Intergenic
1001920428 5:175595568-175595590 ATGGTTCAGCAGAGGCAATGAGG - Intergenic
1002465722 5:179407497-179407519 AGGCTTCAGCAGAGGCTGTGAGG - Intergenic
1003320940 6:5050459-5050481 TTGCTTCAGCCAAAGAGATGAGG - Intergenic
1008027838 6:46658054-46658076 ATGCTTCAGGAAACATTATGAGG - Intronic
1012519572 6:100104763-100104785 ATACTGCAGCAACAGTTATGTGG + Intergenic
1013050808 6:106533283-106533305 ATGCTTGGGCAATAGCTAAGAGG + Intronic
1014230544 6:118897277-118897299 TTGCTTCAGAAAAAGCCTTGAGG + Intronic
1014897590 6:126922235-126922257 CTACTTAAGCAAAGGCTATGAGG - Intergenic
1015636617 6:135281248-135281270 ATAGTTCAGGAAAAGTTATGTGG + Intergenic
1015757578 6:136623222-136623244 TTGCTTCTCCAAAAGCCATGTGG + Intronic
1017390435 6:153933093-153933115 ATGTTTCAGCAGATGCTATCTGG + Intergenic
1018034735 6:159872407-159872429 ATGCTTCATCTAAAGCTAAATGG - Intergenic
1018588983 6:165395403-165395425 ATCTTTCAGTAACAGCTATGTGG - Intronic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1024615307 7:51106823-51106845 ATGCTTCATGGAAAGTTATGAGG + Intronic
1024776303 7:52790638-52790660 ATGCTTCAGCATTGGCTATTTGG - Intergenic
1027766331 7:82347588-82347610 ATCCTTCAGCAAAAGGAATGAGG + Intronic
1029241575 7:99166943-99166965 ATTCTTCAGAAAAAGCTGTGTGG - Intergenic
1030136179 7:106252006-106252028 ATGCTACAGCTAAAGCACTGTGG - Intronic
1030328381 7:108246511-108246533 ATGAGTAAGCAAAAGATATGAGG + Intronic
1030382800 7:108831908-108831930 CTGCCTCAGAAGAAGCTATGTGG - Intergenic
1030871378 7:114760090-114760112 ATGATTCAGAAAAAGGGATGAGG - Intergenic
1031054447 7:116978134-116978156 ATGTTTTACCAAAAGATATGAGG - Intronic
1035770196 8:2141133-2141155 ATGCTTCATCAAAAGCTGTGAGG - Exonic
1038990989 8:32868057-32868079 ATGGTGCAGAAAAAGCTGTGAGG + Intergenic
1039243605 8:35583628-35583650 ATGTTCCACCAAAAGCTATAGGG - Intronic
1043204443 8:77418681-77418703 ATGCTTCAGCCAAATATATTGGG + Intergenic
1043768442 8:84166484-84166506 ATGCTTCAGAAAAAGATGTATGG - Intergenic
1044464840 8:92490741-92490763 ATGCTTCAACAATATCTCTGGGG + Intergenic
1045587912 8:103560059-103560081 CTGCTTCAGCAACAGATTTGGGG - Intronic
1045833537 8:106493121-106493143 ATGCTACAGCTACAGCTATATGG + Intronic
1046708689 8:117485497-117485519 CTGATTCAAAAAAAGCTATGAGG - Intergenic
1048095334 8:131285901-131285923 AGGGTTCAGCAAAGGCCATGAGG - Intergenic
1049159611 8:141088988-141089010 AGGCCTGAGCAAAGGCTATGCGG - Intergenic
1052452868 9:28654663-28654685 TTGCCTCTTCAAAAGCTATGAGG - Intronic
1057485913 9:95484117-95484139 ATGCTTCAGGAGAAGATGTGAGG - Intronic
1059857131 9:118412179-118412201 ATGCTTAAGCAAAGGATATGTGG + Intergenic
1060290017 9:122293367-122293389 CAGCTTCAGCACAAGCTGTGTGG - Intronic
1060653165 9:125348278-125348300 ATGCTTCAGGAAAAAATATAGGG - Intronic
1185498412 X:577336-577358 TTCCTTCAGCAATAGCTGTGAGG - Intergenic
1189648304 X:43158467-43158489 AAGCATCATCAAAATCTATGGGG - Intergenic
1192268601 X:69557461-69557483 ACGCTTCAGGAAAACCTAAGGGG + Intergenic
1192748651 X:73965066-73965088 AGGTTTCAGCAAAAAGTATGAGG - Intergenic
1193530158 X:82646460-82646482 ATGCTTCATAAAAAGCTAAAAGG + Intergenic
1196870763 X:120111029-120111051 TTACATCTGCAAAAGCTATGGGG + Intronic
1197583294 X:128311442-128311464 ATGCTTTAGCAAAGACTTTGGGG - Intergenic
1199100704 X:143796453-143796475 AGGCTTCAGCCAATGCCATGAGG + Intergenic
1199322835 X:146461669-146461691 ATGCTAAAGCAGAAGCTATCAGG + Intergenic
1199731313 X:150635124-150635146 ATGCTTCAGCAAGTCCTACGTGG - Intronic
1201352148 Y:13055562-13055584 ATGCTTCAGGAAATGCAATCAGG - Intergenic