ID: 1115796750

View in Genome Browser
Species Human (GRCh38)
Location 14:36945421-36945443
Sequence ACAGCAGCGCTATTCATGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 96}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115796745_1115796750 27 Left 1115796745 14:36945371-36945393 CCAAAGAACTGAAAGCAGAGACT 0: 5
1: 22
2: 99
3: 239
4: 719
Right 1115796750 14:36945421-36945443 ACAGCAGCGCTATTCATGAGAGG 0: 1
1: 0
2: 0
3: 8
4: 96
1115796744_1115796750 28 Left 1115796744 14:36945370-36945392 CCCAAAGAACTGAAAGCAGAGAC 0: 10
1: 99
2: 437
3: 868
4: 1751
Right 1115796750 14:36945421-36945443 ACAGCAGCGCTATTCATGAGAGG 0: 1
1: 0
2: 0
3: 8
4: 96
1115796743_1115796750 29 Left 1115796743 14:36945369-36945391 CCCCAAAGAACTGAAAGCAGAGA 0: 2
1: 26
2: 178
3: 698
4: 2893
Right 1115796750 14:36945421-36945443 ACAGCAGCGCTATTCATGAGAGG 0: 1
1: 0
2: 0
3: 8
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115796750 Original CRISPR ACAGCAGCGCTATTCATGAG AGG Intronic
905547617 1:38812007-38812029 ACAGCAGCATTATTCATAATAGG + Intergenic
911300026 1:96161136-96161158 ACAGCAGCACTATTCAAAATAGG + Intergenic
918234445 1:182565551-182565573 ACAGCAGCACTATTCATAGTAGG - Intergenic
921379661 1:214511728-214511750 ACAGCAGCATTATTCATGGCAGG + Intronic
1063557544 10:7095300-7095322 ACAGCAGCATTATTCATCATAGG + Intergenic
1069071290 10:63992964-63992986 ACAGCAGCTTTATTCATGATAGG + Intergenic
1071342606 10:84662714-84662736 CTAGCAGGGCTAGTCATGAGGGG + Intergenic
1071582958 10:86790508-86790530 ACAGCAGCATTATTCATAATAGG + Intronic
1072978976 10:100083728-100083750 ACAGCAGCATTATTCATAATAGG + Intergenic
1073783657 10:106865411-106865433 ACAGCAGCCCTATTAAAAAGTGG + Intronic
1076268155 10:129126900-129126922 ACAGCAGCTTTATTCATTATAGG + Intergenic
1078834611 11:15015049-15015071 ACAGCAGCCCTATAGAAGAGAGG + Intronic
1079520189 11:21317307-21317329 ACAGCAGCATTATTAATAAGTGG - Intronic
1080276550 11:30509512-30509534 ACAGCAGTGATTTTCCTGAGAGG - Intronic
1080513672 11:33000693-33000715 ACAGCAGCCCTATGGAAGAGTGG - Intergenic
1087529608 11:99361922-99361944 ACAGCAGTGTTATTCATAATAGG - Intronic
1092033686 12:5311641-5311663 ACAGCAGTGTGCTTCATGAGAGG - Intergenic
1094216051 12:27943963-27943985 ATAGCAGCTCTTTGCATGAGCGG - Intergenic
1100727672 12:97426028-97426050 ACAGCAGGGCTATTGGTCAGTGG + Intergenic
1102566111 12:113798456-113798478 AGACGAGCGATATTCATGAGGGG - Intergenic
1104405210 12:128511220-128511242 ACAGCAGCTGCATTCATGGGTGG - Intronic
1105264422 13:18803459-18803481 ACAACAGCCCTGTCCATGAGAGG - Intergenic
1105838979 13:24236948-24236970 ATAGCAGCACTATTCATAAGAGG + Intronic
1106890803 13:34243554-34243576 CCAGCAGCACTGTTCATTAGAGG + Intergenic
1107119340 13:36779584-36779606 GCAGCAGCCCTATGCAAGAGTGG + Intergenic
1108468640 13:50745125-50745147 ACAGCAGCATTATTCACAAGCGG + Intronic
1108560497 13:51638621-51638643 ACAGCATAGCTTTTCATGAATGG - Intronic
1109146788 13:58790038-58790060 ACAGCAGCCCTATAGAAGAGTGG - Intergenic
1109982632 13:69928480-69928502 ACAGCAGCATTATTCATAAGGGG + Intronic
1110476414 13:75919757-75919779 ATTGCAGCACTATTCATGATAGG + Intergenic
1111332717 13:86781676-86781698 ACAGCAGCTCTATGGAAGAGGGG - Intergenic
1115796750 14:36945421-36945443 ACAGCAGCGCTATTCATGAGAGG + Intronic
1122450972 14:101806996-101807018 ATATGAGCGCTATTCCTGAGGGG + Intronic
1124720173 15:32104847-32104869 ACAGCAGCGTTGTTCCTTAGAGG - Intronic
1128698701 15:69788318-69788340 ATAGCAGCACTATGCATGGGAGG + Intergenic
1129570211 15:76674595-76674617 ACAACAGCTCTAATCATGAAGGG + Intronic
1143507546 17:7376400-7376422 ACAGCAGCTTTATTCATAATGGG + Intergenic
1146646553 17:34580613-34580635 AAAGCGGCGCTATCCATGTGCGG + Intergenic
1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG + Intronic
1150178061 17:63083158-63083180 ACAGCAGCCCCATTCAGGGGTGG - Intronic
1163735669 19:18978894-18978916 ACAGCAGCTCTAGTCATGGTTGG + Intergenic
927184101 2:20469805-20469827 ACAGCACCGCAAATCCTGAGTGG - Intergenic
928726065 2:34174534-34174556 AAAGCAGCACTCTTCATTAGTGG + Intergenic
936133925 2:109872654-109872676 ATAGCAGCATTATTCATAAGAGG - Intergenic
936210772 2:110498831-110498853 ATAGCAGCATTATTCATAAGAGG + Intergenic
936435300 2:112499935-112499957 ATAGCAGCATTATTCATAAGAGG + Intronic
939947853 2:148431816-148431838 ACTGCAGCGCTATTCAAAACAGG - Intronic
946303375 2:218839926-218839948 AGAGCAACACTATTCATGACTGG + Intergenic
1176107699 20:63397326-63397348 GCAGCAGCGTCATTCACGAGAGG - Intergenic
1176849496 21:13901901-13901923 ACAGTAGCCCTGTCCATGAGAGG - Intergenic
1180938254 22:19640017-19640039 AGAGCAGCGCCATGCATGTGAGG - Intergenic
1181680048 22:24488789-24488811 AAAGCAGAGCTGGTCATGAGAGG + Intergenic
1184371286 22:44083709-44083731 ACTGCAGCTGTATTGATGAGAGG + Intronic
1184589678 22:45473570-45473592 ACAGCAGCTCTGTCCATCAGAGG + Intergenic
951726100 3:25761764-25761786 ACAGCAGCATTATTCATAATAGG + Intronic
953735473 3:45490592-45490614 AAAGCAGCCCTTTTCATGAATGG - Intronic
958816437 3:98921343-98921365 ACAGCAGATCTAGCCATGAGAGG - Intergenic
961417225 3:126768029-126768051 ACTGCAGCACTATTCACGATAGG - Intronic
968135678 3:196217915-196217937 ACAGCAGCCCAACTCCTGAGAGG + Exonic
972990083 4:44814134-44814156 GCAGCAGCCCTATGGATGAGTGG - Intergenic
980204926 4:129705373-129705395 ACAGCAGCTCTGTTCATGGACGG - Intergenic
981273939 4:142875492-142875514 ACAGCAGCCCTATGGAAGAGGGG + Intergenic
985079424 4:186248616-186248638 ATAGCAGCATTATTCATAAGAGG - Intronic
988345688 5:30035498-30035520 ACAGCAGCCCTTTCCATCAGAGG + Intergenic
996679634 5:126217580-126217602 AGAGCAGCACTGTTCAGGAGAGG - Intergenic
997175720 5:131774819-131774841 ACAGAAGCTCTTTTCTTGAGAGG + Intronic
1009035920 6:58117029-58117051 ACAGGAGCCCTGTGCATGAGAGG - Intergenic
1009211741 6:60870630-60870652 ACAGGAGCCCTGTGCATGAGAGG - Intergenic
1009707032 6:67265823-67265845 ACAGCAGCCCTATGAAAGAGGGG - Intergenic
1011196807 6:84789132-84789154 ACAGCAGCATTATTCATAATAGG + Intergenic
1015379766 6:132553167-132553189 ACAGCACCGCTGTACGTGAGAGG - Exonic
1015381160 6:132570799-132570821 ACAGCACCGCTGTACATGAGGGG - Exonic
1015705093 6:136079366-136079388 ACAGTAGCCCTAGTCATGTGTGG + Intronic
1015816894 6:137219945-137219967 AGAGCAGACCTCTTCATGAGAGG - Intergenic
1017536024 6:155348957-155348979 ACAGCAGCCCTATGCAAAAGTGG - Intergenic
1018480695 6:164186534-164186556 ACAGCAGCGCTATGACTGATTGG + Intergenic
1026487260 7:70832164-70832186 ACAGCAGCTTTATTCATGGTAGG - Intergenic
1036925423 8:12900276-12900298 ACAGAAGCTCCACTCATGAGAGG - Intergenic
1037249475 8:16876555-16876577 ACAGCAGCCCTATGGAAGAGGGG - Intergenic
1038014456 8:23502143-23502165 ACAGTATCGCTTTTAATGAGTGG + Intergenic
1038152502 8:24955466-24955488 ACATCAGCGCTATGCAGGTGCGG - Exonic
1038309862 8:26438069-26438091 ACAGCAGCACTATTCAGAATAGG + Intronic
1040841935 8:51793215-51793237 ACAGCAGCCCTATGAAAGAGGGG + Intronic
1043723355 8:83576697-83576719 ACAGCAGCAGAATTAATGAGTGG + Intergenic
1045596414 8:103661311-103661333 ACAGCAGCACTATTCATAATAGG - Intronic
1045614817 8:103897288-103897310 ACCACAGCCCTATTCAAGAGTGG - Intronic
1046092717 8:109522021-109522043 ACAGCAGTCATATTAATGAGGGG - Intronic
1046637611 8:116689009-116689031 ACAGCAGCATTATTCATAATAGG + Intronic
1049322980 8:142006989-142007011 ATAGCATCCCTGTTCATGAGTGG - Intergenic
1051957262 9:22711455-22711477 AAAGCACCTCTATTAATGAGAGG - Intergenic
1052387037 9:27835105-27835127 ACAGCAGCCCTATGGAAGAGGGG - Intergenic
1055509697 9:76984297-76984319 ACAGCAGCCCTATGGAAGAGTGG - Intergenic
1056608631 9:88109666-88109688 GCAGCAGTGCTATTCATAAGAGG + Intergenic
1058526404 9:105863726-105863748 ATAGCAGCACTATTCATAATAGG + Intergenic
1058530257 9:105899666-105899688 ACAGCAGCCCTATGAAAGAGGGG - Intergenic
1059206065 9:112467126-112467148 ACAGCAGCGCTATTCACAATAGG + Intronic
1186593349 X:10953860-10953882 ACAGCAGCCCTATGGAAGAGTGG + Intergenic
1186913290 X:14193057-14193079 ACAGCAGCCCTATGGAAGAGGGG - Intergenic
1191164330 X:57371516-57371538 ACAGCAGCACTATTCATAATAGG - Intronic
1192037684 X:67583016-67583038 ACAGCAGTGCCATACATGAAAGG + Intronic
1194214800 X:91116795-91116817 ACAGAAGCTCTGTGCATGAGTGG - Intergenic
1194405807 X:93494356-93494378 ACAGCAGCCCTATGGAAGAGGGG + Intergenic
1194855535 X:98923470-98923492 ATAGCAGCATTATTCACGAGTGG + Intergenic
1196168062 X:112556294-112556316 ACAGCAGCCCTATGGAAGAGGGG + Intergenic
1199589179 X:149450782-149450804 ACAGCAGCCCTATGGAAGAGTGG - Intergenic