ID: 1115797426

View in Genome Browser
Species Human (GRCh38)
Location 14:36954365-36954387
Sequence CTGTAGTTAGTAAGGAGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 235}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115797426 Original CRISPR CTGTAGTTAGTAAGGAGAAA TGG (reversed) Intronic
903615405 1:24650689-24650711 CTGGAATTAGTAAAGAGAAGAGG + Intronic
904537688 1:31210739-31210761 CAGGGGTGAGTAAGGAGAAAGGG + Intronic
905596049 1:39208423-39208445 TTTTAATTAGTAAGGAGAGAAGG - Intronic
905856206 1:41316376-41316398 CTGTAGTGTGAAGGGAGAAATGG + Intergenic
906481278 1:46200808-46200830 CTGGATTTTGCAAGGAGAAAAGG - Intronic
907126734 1:52056669-52056691 CTGTTGTGAGCAAGGAGTAATGG - Intronic
910884328 1:91949701-91949723 CTGAAGTTGGTAAGGCCAAAGGG - Intronic
911026940 1:93446535-93446557 CATTAATTAGTAAGGGGAAATGG - Intergenic
911519164 1:98908224-98908246 CTGTAGTTCTTTAGGAGCAAAGG + Intronic
911726678 1:101248716-101248738 ATGTATTTATTAAGGAGACAGGG + Intergenic
914958183 1:152183528-152183550 CTGTGATTAGTATGGAGAAATGG - Intergenic
916071725 1:161174082-161174104 CTGTAGGTGGCACGGAGAAAAGG + Intronic
917393777 1:174569134-174569156 ATGTTGTTAGTATGGGGAAAAGG - Intronic
917778976 1:178370844-178370866 CTGAAGTAAGCATGGAGAAAAGG + Intronic
918162875 1:181917689-181917711 ATGTAGGAAGTAAGGAGGAAAGG + Intergenic
918549903 1:185730423-185730445 CCGTAGTTGGGAAAGAGAAAAGG - Intergenic
918992058 1:191709482-191709504 CTACTGTTAGTAAGGAGAAAAGG - Intergenic
919533615 1:198757773-198757795 CTTTACTTATTAATGAGAAAAGG + Intergenic
920903502 1:210136307-210136329 CAGGAATGAGTAAGGAGAAAGGG + Intronic
921221967 1:212979829-212979851 CTGTGGTTCGTAAAGAGAAAGGG + Intronic
921512950 1:216054623-216054645 CTGAAGTATGTAAGTAGAAACGG - Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
922055742 1:222040913-222040935 CTGTAAGGAGTAAGGAGGAATGG + Intergenic
922249901 1:223839035-223839057 CTGTAGTTTTAAAGTAGAAAAGG - Intronic
922361799 1:224829382-224829404 CTTCAGTTTGTTAGGAGAAAGGG + Intergenic
924143425 1:241049519-241049541 CAGTGGGTAGTCAGGAGAAAGGG + Intronic
1063902585 10:10749879-10749901 TGGTAATTAGTAAAGAGAAAAGG + Intergenic
1064327307 10:14363376-14363398 CTGTAGTACCTAAGTAGAAAAGG - Intronic
1065600355 10:27361719-27361741 CTGTAGTTACTAAGAAAAAATGG - Intergenic
1067147905 10:43706728-43706750 CAGCAGTTTGTAAGGAGAGATGG + Intergenic
1067389631 10:45851183-45851205 CTGTGTATAGTAAGGAGAACTGG + Intronic
1067444616 10:46333344-46333366 CTGTGTATAGTAAGGAGAACTGG - Intergenic
1068358505 10:55943878-55943900 CTGTAGTCAGTAAGGTGGAGAGG - Intergenic
1069322854 10:67194550-67194572 CAGTAGTTAGCAAGGAGGGATGG + Intronic
1069490548 10:68856963-68856985 CTGTAGTTGGTTAGGAGGATTGG - Intronic
1070741359 10:78905392-78905414 CTGTAGGTAGGAGGGAGAAATGG - Intergenic
1070874944 10:79794133-79794155 CTCTAGATAGTGAGGAGAACTGG + Intergenic
1071641868 10:87316300-87316322 CTCTAGATAGTGAGGAGAACCGG + Intergenic
1072156960 10:92732482-92732504 CTGTAGGTATGAAGAAGAAAGGG - Intergenic
1073169573 10:101492670-101492692 CTTTAGATAATAAGGAGACAAGG + Intronic
1073672771 10:105610481-105610503 ATGTAGGCAGCAAGGAGAAAGGG + Intergenic
1074204389 10:111269870-111269892 CTGCAGTTACTAAAAAGAAAAGG - Intergenic
1077920034 11:6635005-6635027 CTGTACTTAGAAAGAAGAAAGGG + Intronic
1078383454 11:10865305-10865327 CTTTGGTTAGTGAGGAGAATGGG - Intergenic
1080136460 11:28860250-28860272 GTGCAGGTAGAAAGGAGAAATGG + Intergenic
1081338664 11:41900639-41900661 GTGTGGTGAGGAAGGAGAAATGG + Intergenic
1081564877 11:44252807-44252829 GTGTAGTTAGAAAGGCGACAAGG + Intergenic
1086256565 11:84883572-84883594 CAGTAATTAGTGAGGAGAAGTGG - Intronic
1088996876 11:115008380-115008402 CTGTTGTAAGGAAGGAGAGAGGG - Intergenic
1091415126 12:276211-276233 GAGAAGGTAGTAAGGAGAAAAGG + Intergenic
1091832169 12:3557586-3557608 CTGTCTTTAGTAAGCAGATAGGG - Intronic
1094083054 12:26558673-26558695 ATGTAGATAGCAAAGAGAAAAGG - Intronic
1095644346 12:44525479-44525501 GTGTAGATAATAAGCAGAAAAGG - Intronic
1096245239 12:49981219-49981241 CTGCAGTTAATTAGCAGAAAAGG + Intronic
1096438892 12:51621672-51621694 CAGTAGTGAGTAAGAAGGAAGGG + Intronic
1098871008 12:75816947-75816969 CTGTAGATTATAAAGAGAAATGG + Intergenic
1100075642 12:90779866-90779888 GTGTAGTTAGTAAAGTGAATAGG + Intergenic
1100275180 12:93065264-93065286 TGGCATTTAGTAAGGAGAAAAGG + Intergenic
1103669665 12:122602812-122602834 CTGTAGCTAGAAAGGAAACAAGG - Exonic
1104999869 12:132683293-132683315 CTAGAGTCAGGAAGGAGAAAGGG + Intronic
1105697997 13:22909556-22909578 CTATAGTTTGTTGGGAGAAAGGG + Intergenic
1105784939 13:23739231-23739253 CTGTAGTGGGGACGGAGAAAGGG + Intronic
1108535067 13:51367574-51367596 CAGTAATTTGTAGGGAGAAAAGG + Intronic
1109595483 13:64548478-64548500 CTGTAGTTAATAAGGTGTGAGGG - Intergenic
1109828799 13:67757945-67757967 TTGTAGTTAGTTGGAAGAAAGGG + Intergenic
1110033373 13:70646960-70646982 CTGTATATTGTAAGTAGAAAGGG - Intergenic
1110355988 13:74568159-74568181 CTTTAGCAAGAAAGGAGAAATGG - Intergenic
1111134571 13:84024518-84024540 CTGGGGTTAGAAAGGAGACAGGG + Intergenic
1112106041 13:96240797-96240819 CTGTAGCTAGAAAGGTTAAAAGG - Intronic
1112677017 13:101713752-101713774 TTTTAGTTAGGTAGGAGAAATGG + Exonic
1113575592 13:111393173-111393195 CTGTAGTTCATAAGGAGAGAGGG - Intergenic
1114162315 14:20182127-20182149 TTGCTGTTAGTAAGGAGAATTGG + Intergenic
1114257233 14:21013509-21013531 CTGATGTTAGTGAGGAGAGAGGG + Intergenic
1114997816 14:28379231-28379253 CTGTAGTTGGGAATGTGAAATGG + Intergenic
1115797426 14:36954365-36954387 CTGTAGTTAGTAAGGAGAAATGG - Intronic
1117831714 14:59758042-59758064 CTGGGGTTAGGAAGGAGGAAAGG - Intronic
1117836463 14:59811946-59811968 CTTTAGTTAGGAAGGAGGAAAGG + Intronic
1118209152 14:63750720-63750742 TTGTGGATAGTAAGTAGAAATGG - Intergenic
1119831740 14:77708933-77708955 CTGAAGTTAGTATGGGAAAAGGG + Intronic
1119843528 14:77811080-77811102 GTGTAGAGAGCAAGGAGAAAGGG + Intronic
1120120523 14:80674384-80674406 CACTTGTTAGTAAGCAGAAATGG - Intronic
1120176415 14:81298123-81298145 CTGTAATTAGAAAGAAAAAAAGG + Intronic
1127040681 15:54973252-54973274 CAGTAGTTAGTTAGAAGTAATGG + Intergenic
1127534586 15:59878276-59878298 CGGTAGTTGGTGAGGAGCAAAGG - Intergenic
1128845193 15:70887673-70887695 CTGAAATTAGGAATGAGAAAAGG + Intronic
1129727263 15:77907818-77907840 CTGTAGGTAGTAGGGAGCCATGG + Intergenic
1130713383 15:86306799-86306821 CTGTTGAGAGTATGGAGAAAAGG - Intronic
1133183344 16:4075979-4076001 ATCTAGTTAATGAGGAGAAAAGG + Intronic
1133603606 16:7364299-7364321 TTGCAGTTACTATGGAGAAAGGG + Intronic
1135048473 16:19173236-19173258 CTGCAGTTGGTAAATAGAAATGG + Intronic
1138232307 16:55347458-55347480 CTGTTGTGAGTCAGGAGAATTGG + Intergenic
1138795759 16:59966764-59966786 CGGGAGTTAGAAAAGAGAAATGG + Intergenic
1139814767 16:69659895-69659917 GTGTAGTAAGTAAGAAGATACGG + Exonic
1143932613 17:10445510-10445532 CTATATATAGAAAGGAGAAAAGG - Intronic
1146536476 17:33657149-33657171 GTGTCGTTCGTAAGGAGAATGGG - Intronic
1147788648 17:42998726-42998748 CTGCAGAGAGCAAGGAGAAAGGG - Exonic
1149025480 17:52022528-52022550 TTCTAGTTATTAAGGAGAATAGG - Intronic
1149190397 17:54054532-54054554 CTGAAGTAAGTGGGGAGAAATGG - Intergenic
1150059356 17:62051104-62051126 TTTTTGTTAGTAAGAAGAAAGGG - Intronic
1153716514 18:7855277-7855299 ATGTAGTGATTAAGGAGACATGG + Intronic
1153786392 18:8538813-8538835 GTTTTGTTATTAAGGAGAAAGGG - Intergenic
1155106970 18:22676747-22676769 CTGTAGTTGGTTAAGAGTAAGGG - Intergenic
1156199671 18:34816017-34816039 GAGTAGTTACTAAGGAGCAAAGG + Intronic
1157553637 18:48598361-48598383 CTGTCATTAGCAAGGAGAGAAGG + Intronic
1158655839 18:59332445-59332467 CAGTAGCTAGTAAGTAGGAAAGG - Intronic
1159128288 18:64250540-64250562 GAGTATTTAGTAAGGGGAAAAGG - Intergenic
1163697198 19:18769909-18769931 CTGGAGTTGGAAAGGACAAAGGG - Intronic
1166177245 19:41082967-41082989 CTGAAGGGAGTTAGGAGAAAGGG - Intergenic
1166345699 19:42163958-42163980 CTGTTGTTAGGAAGAAGAAAAGG + Intronic
929557763 2:42936250-42936272 CTGGAGCCAGGAAGGAGAAACGG - Intergenic
929827627 2:45321691-45321713 CTGCAGTTATTCAGGAGAGAAGG + Intergenic
930842910 2:55867628-55867650 TTCTAGTAAGTAAAGAGAAATGG + Intronic
932106191 2:68944786-68944808 CTGGAGTGAGAAGGGAGAAAGGG - Intergenic
934252728 2:90375217-90375239 ATGTAATTAATAAGAAGAAAAGG + Intergenic
934256710 2:91427730-91427752 ATGTAATTAATAAGAAGAAAAGG - Intergenic
934604139 2:95681528-95681550 CAGTAATCAGGAAGGAGAAAGGG + Intergenic
935483119 2:103617729-103617751 CTGAAGGTAGTAAGCAGCAATGG + Intergenic
936537530 2:113323762-113323784 CAGTAATCAGGAAGGAGAAAGGG + Intergenic
937796838 2:126033347-126033369 TTGTAGCTAGAGAGGAGAAATGG + Intergenic
940962474 2:159800637-159800659 CTGTAGTTAGGAGGGCAAAAGGG - Intronic
941018124 2:160380157-160380179 CTGTGGTGAGTGAGGAGAGATGG - Intronic
941128455 2:161616325-161616347 CTGTAGTGAGGAGGGATAAAAGG - Intronic
942441299 2:176039570-176039592 CTAGAGTCAGTAAGGAGAAGTGG - Intergenic
945188205 2:207160997-207161019 CTGTCCTTAGTAGGGGGAAAAGG - Intronic
946901104 2:224372641-224372663 CTGTAGCAAGTAAGAGGAAAAGG - Intergenic
1168942705 20:1727035-1727057 CTCTGGTTAGTAAGAGGAAAAGG - Intergenic
1169176107 20:3515882-3515904 CTCTAGTTACAAAGGATAAATGG - Intronic
1169867157 20:10214449-10214471 CTGAAGTTGCTAATGAGAAAAGG + Intergenic
1170866221 20:20160518-20160540 CTTAATTCAGTAAGGAGAAATGG - Intronic
1172153231 20:32805298-32805320 CTATAGCTAGTAAGAAGTAATGG + Intronic
1172425347 20:34852062-34852084 CTGGAGAAAGTAGGGAGAAAGGG + Intronic
1173742757 20:45413004-45413026 CTGTGGTTCGGCAGGAGAAAAGG - Intergenic
1173782216 20:45765558-45765580 CTGCTATTAGGAAGGAGAAAGGG - Intronic
1177228902 21:18293497-18293519 CTGAATTCAGTCAGGAGAAAAGG - Intronic
1180015094 21:45076492-45076514 CTGTAGTTGGAAAGGAAAAAAGG + Intronic
1182864285 22:33589116-33589138 CTGTAGTAAGTGAGGAGGAAAGG + Intronic
949205607 3:1435329-1435351 TTATAGTTAGTAATGCGAAAGGG + Intergenic
955845963 3:63163012-63163034 GTGTAGATAAAAAGGAGAAAAGG + Intergenic
956258018 3:67305045-67305067 ATGTTGTTAGTAAGGACAAAGGG - Intergenic
956302358 3:67786124-67786146 TTGTAGTAAATAAGTAGAAAGGG - Intergenic
956815737 3:72906675-72906697 CTGAAGTTAGCAAGGAAAAGAGG + Intronic
957358471 3:79122411-79122433 CTAGAGATGGTAAGGAGAAAAGG + Intronic
957997586 3:87709884-87709906 CTGTAGTAAGTAAATTGAAAGGG - Intergenic
958573468 3:95916871-95916893 CTGAAGTTAGTTAGAAGAAATGG + Intergenic
960555210 3:119020657-119020679 CAATAGTTTGTAAGGAGAAAAGG - Intronic
963294151 3:143526821-143526843 CTGAAGTTAGCAAGCATAAAAGG + Intronic
965213900 3:165833728-165833750 CTGCATTTATTAAAGAGAAAAGG - Intronic
965257843 3:166439515-166439537 CTGTAGTTGGCAAAGAGTAATGG + Intergenic
966931256 3:184677305-184677327 CTGTAGTGAAGAAGGAAAAATGG + Intronic
967151634 3:186656129-186656151 CAGTGGTTAGCAAGGAGACAGGG + Intergenic
971709698 4:30094465-30094487 AGGGAGTTAGAAAGGAGAAAAGG + Intergenic
972854620 4:43091628-43091650 CTGAAGGTAGCAGGGAGAAAAGG + Intergenic
973547342 4:51995201-51995223 CTGGAGATAGTAAGGAAAGAGGG - Exonic
973848071 4:54933405-54933427 CTGGAGTTAGTGAGAGGAAATGG - Intergenic
974295011 4:59986945-59986967 ATGTAGTTAGTATGGAGTTAAGG - Intergenic
976145275 4:82036626-82036648 ATGGAGTTAGAAAGGAGAAGTGG + Intronic
976909280 4:90280466-90280488 CTCTGGATAGTAAGGAGGAAAGG + Intronic
977263928 4:94832205-94832227 CAGTATTTAGTACAGAGAAATGG + Intronic
977602331 4:98947891-98947913 CTATAGCTAGTTATGAGAAAAGG - Intergenic
979025669 4:115571264-115571286 ATGTAGAGAGTAAGGAAAAATGG + Intergenic
979434113 4:120668960-120668982 ATTTAGTTAGTAAAGAGAAAGGG - Intergenic
980010265 4:127587260-127587282 CTTTAGGGAGGAAGGAGAAAGGG + Intergenic
980445702 4:132904594-132904616 CTATAGTATGTAAGGAAAAATGG + Intergenic
981077772 4:140607946-140607968 CTGCAGTTAGTGAGGAGGGAGGG + Intergenic
981393027 4:144214604-144214626 CTGTACTTTGTAAGCATAAAAGG - Intergenic
981733383 4:147922962-147922984 CTGTATTTAGAAATGAGAAGAGG - Intronic
981751903 4:148100613-148100635 CTGTTGTTAGCAATGAAAAATGG + Intronic
981875018 4:149531855-149531877 CTGTTATGAGTCAGGAGAAATGG - Intergenic
982140884 4:152316746-152316768 CTACATTTAGTAAGGAGTAAGGG + Intergenic
983741406 4:171139085-171139107 CTGGAGCTATAAAGGAGAAAGGG + Intergenic
986063960 5:4217812-4217834 CTGTAGTGTGTAAGGGGAAGTGG + Intergenic
986367625 5:7049280-7049302 GTGTACTTAGGAAGGAGAGATGG - Intergenic
989436979 5:41425636-41425658 CAGGGGTTAGAAAGGAGAAACGG - Intronic
990108764 5:52296276-52296298 CTTTATTTAATAAGTAGAAAAGG - Intergenic
990831034 5:59957550-59957572 CTGTTGGTAGTATAGAGAAAAGG + Intronic
993161030 5:84291218-84291240 ATCAATTTAGTAAGGAGAAATGG - Intronic
993641448 5:90410279-90410301 CTGAAATTAGAATGGAGAAACGG - Intergenic
993647706 5:90479780-90479802 CTATAGTGAGTCAGGAGAATAGG + Intronic
994150119 5:96437922-96437944 CTGGAGGTAGTAATGAGGAAAGG - Intergenic
994933855 5:106225787-106225809 CTGTAGGCAGAAAGAAGAAATGG - Intergenic
995254678 5:110032842-110032864 TTTTAGTTAGTAAGGAAAGAAGG + Intergenic
995821861 5:116244115-116244137 CTGTTGATAGTACAGAGAAATGG + Intronic
996225143 5:120983747-120983769 CTGTAGGCAGTAGGGGGAAAGGG + Intergenic
998156829 5:139791927-139791949 CTGTAATAGGTAAAGAGAAATGG + Intergenic
999595143 5:153194953-153194975 CAGTAGATAGTAAGAAGAAATGG + Intergenic
1000025012 5:157351244-157351266 CTGTTATTATTAAGAAGAAAAGG + Intronic
1001552105 5:172610532-172610554 CCGGAGTTAGTAAGGAGCAGAGG - Intergenic
1003251800 6:4434930-4434952 CTGAAATTAGTATGGAGAAAAGG - Intergenic
1005242721 6:23850897-23850919 CTGTAGTTTGCAAACAGAAAAGG + Intergenic
1007009967 6:38407028-38407050 CTGTCTTTTGTAAGGAGAATGGG + Intronic
1008102366 6:47405683-47405705 CTGCAGTTAGAAAGTAGAAAGGG + Intergenic
1008355619 6:50549150-50549172 CTGTAATTAACAAGGAAAAAAGG - Intergenic
1009315360 6:62212521-62212543 TTGTAGTTAGTAAAGTTAAAAGG + Intronic
1011721243 6:90158610-90158632 GTGTAGTAAGTAACGAGAGACGG + Intronic
1013788115 6:113805989-113806011 CTGTTGTTAATACGGACAAATGG - Intergenic
1014902995 6:126990682-126990704 CTGCTCTTTGTAAGGAGAAAAGG + Intergenic
1016675105 6:146756040-146756062 CTGTAGTTGTTAAAGAGAGAGGG - Intronic
1017795191 6:157837759-157837781 CTGCAGTCAGTAAGAAGTAACGG + Intronic
1018101193 6:160442033-160442055 CACTAGTTAGTAGGGAGGAAAGG + Intronic
1019092359 6:169549858-169549880 CAGGAGTTAGGAAGGAGAGAGGG + Intronic
1020799857 7:12720152-12720174 CTGTAATTATTAAGTGGAAATGG - Intergenic
1021659628 7:22907229-22907251 TTGAACTAAGTAAGGAGAAAGGG - Intergenic
1021827342 7:24568564-24568586 CCGTAGGCAGTAAGGAGACAGGG + Intergenic
1022853682 7:34294045-34294067 CTGTAATTAGTGAGAAGAATAGG + Intergenic
1024765457 7:52652550-52652572 CTTTACTTGATAAGGAGAAAAGG - Intergenic
1027347624 7:77277232-77277254 CTGTAATTTCTAAAGAGAAAAGG - Intronic
1027599301 7:80219674-80219696 TGGTACTTAGTAAGGAAAAATGG - Intergenic
1027742335 7:82025640-82025662 CTGTGGTCAGTAAGGAGACTGGG + Intronic
1028148312 7:87343525-87343547 CTCTAATAAGTAAGGAGATATGG - Intergenic
1030367906 7:108667527-108667549 CTGCAGCTAGAAAGAAGAAAAGG - Intergenic
1034370906 7:150595489-150595511 GTTTTGTTAGTAAGGAGGAAAGG - Intergenic
1035928153 8:3752122-3752144 CTGTAGTTAGAATGGAGTAAAGG - Intronic
1038062020 8:23924250-23924272 CTGGACTTAGTTAAGAGAAAGGG - Intergenic
1038967924 8:32596231-32596253 CTGTAGGAAGTAAGAAGAGATGG + Intronic
1040425745 8:47284285-47284307 CTGTAGGCAGGCAGGAGAAATGG - Intronic
1041210700 8:55548322-55548344 GTGTAATTAATAAAGAGAAACGG - Intergenic
1041889929 8:62857891-62857913 CTGTAGTCATTTAGAAGAAAGGG + Intronic
1042862892 8:73331386-73331408 CTGTAGCAGGTAAGGAGAAATGG - Intergenic
1046020492 8:108659145-108659167 CTTTAGTTTTGAAGGAGAAATGG - Intronic
1048462764 8:134636250-134636272 CTTTAGTTAGTAAGGGGACCTGG - Intronic
1050779073 9:9307564-9307586 CAGTAGTTAGAATGGAAAAAAGG - Intronic
1051009569 9:12394816-12394838 CTGAAGTTAGCAAGAAGAAGGGG + Intergenic
1055059542 9:72054514-72054536 CAGGAGTTAGTATGGGGAAATGG - Intronic
1055542733 9:77329804-77329826 CTTTTGATAGTCAGGAGAAATGG + Intronic
1055762773 9:79626991-79627013 ATGTAGATAGCAAAGAGAAAAGG + Intronic
1056813755 9:89784481-89784503 CAGTAGTTTGAAAGGAGAAGAGG + Intergenic
1056991032 9:91411200-91411222 CTGTATTTAATGAGGCGAAATGG + Intronic
1058407795 9:104696646-104696668 ATTTAGTTATTAATGAGAAAGGG - Intergenic
1058555186 9:106159350-106159372 CTCTAGTTAGAAAGCACAAAGGG + Intergenic
1059195114 9:112363997-112364019 CGGTAGTTAGTGAGGAGGGAGGG - Intergenic
1059753016 9:117266585-117266607 GTGTAGTTATCTAGGAGAAAAGG - Intronic
1059838821 9:118189366-118189388 TCGTCGTTAGTAATGAGAAAAGG + Intergenic
1061338010 9:129955406-129955428 CTGTATTTTTTATGGAGAAAGGG + Intronic
1062422234 9:136488346-136488368 CTGTAGATAGGGAAGAGAAAAGG + Intergenic
1186167325 X:6840583-6840605 CAGGAGTTAGTGGGGAGAAAAGG + Intergenic
1186282245 X:8005508-8005530 CTGTAGGTGGTAGGGAGAATTGG + Intergenic
1186504115 X:10076402-10076424 TGGTACTTAGGAAGGAGAAATGG + Intronic
1186923355 X:14305852-14305874 CTGTTATTAGTAGGGGGAAAAGG + Intergenic
1188313676 X:28648016-28648038 CTGAAGTCAGTGAGGAGACAAGG - Intronic
1188960873 X:36489908-36489930 CGGTAGTTGGAAAGGTGAAATGG + Intergenic
1189512560 X:41677680-41677702 CTGTAGTAAAAATGGAGAAATGG + Intronic
1189529843 X:41868654-41868676 TTATAGTTAGTAATGAGTAATGG - Intronic
1189772150 X:44437527-44437549 GTTTTGTAAGTAAGGAGAAAGGG + Intergenic
1190599165 X:52071580-52071602 TTCTAGTTACTTAGGAGAAAGGG - Intergenic
1190609659 X:52182493-52182515 TTCTAGTTACTTAGGAGAAAGGG + Intergenic
1191041559 X:56086789-56086811 ATGTAGTTAGTAATTAGCAATGG + Intergenic
1194574165 X:95591399-95591421 ATGTAGTAAGTATGGAGGAAAGG + Intergenic
1195228840 X:102825469-102825491 CAGTAATCAGTACGGAGAAATGG - Intergenic
1195513274 X:105742462-105742484 CTTTACTTATTAAAGAGAAATGG - Intronic
1195724651 X:107901910-107901932 CTGAAGTGACTAATGAGAAACGG + Intronic
1195842246 X:109186970-109186992 CTGTTTTTGGTAAGGATAAAAGG + Intergenic
1195990114 X:110674094-110674116 CTGTAGTTAGTAGAGAAGAATGG - Intronic
1197309916 X:124892046-124892068 ATGTTGTTAGTAAGGTGAAATGG + Intronic
1198462776 X:136879549-136879571 CTTTAGTTATTAAGGAACAATGG - Intronic
1199062048 X:143368436-143368458 ATGTAGTTAAATAGGAGAAATGG + Intergenic
1199989859 X:152980912-152980934 ATGTAGATAGTAAAGAGAAGAGG + Intergenic
1201722337 Y:17113274-17113296 ATTTTGTTAGGAAGGAGAAAGGG + Intergenic