ID: 1115800443

View in Genome Browser
Species Human (GRCh38)
Location 14:36987836-36987858
Sequence CAATTTATGCTACCTGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 65}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115800442_1115800443 -8 Left 1115800442 14:36987821-36987843 CCAGAAAAATGACATCAATTTAT 0: 1
1: 0
2: 1
3: 51
4: 596
Right 1115800443 14:36987836-36987858 CAATTTATGCTACCTGTAGCTGG 0: 1
1: 0
2: 0
3: 6
4: 65
1115800441_1115800443 10 Left 1115800441 14:36987803-36987825 CCACTGACAAACTGCTTTCCAGA 0: 1
1: 0
2: 0
3: 24
4: 262
Right 1115800443 14:36987836-36987858 CAATTTATGCTACCTGTAGCTGG 0: 1
1: 0
2: 0
3: 6
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115800443 Original CRISPR CAATTTATGCTACCTGTAGC TGG Intronic
904275447 1:29381130-29381152 AAATTTAGGCTACCTTCAGCTGG + Intergenic
906918617 1:50038914-50038936 GAAGTTATGCTCCCTGTATCTGG + Intergenic
910372923 1:86537161-86537183 AACTTTATGCTTCCAGTAGCAGG - Intergenic
913394985 1:118358236-118358258 CAATTTTTGCTGCATGTATCTGG - Intergenic
915256371 1:154633725-154633747 CAATTTATGCTCCCTGTACTTGG + Intergenic
919382812 1:196879393-196879415 CAATTTATGATACTTGGATCAGG - Intronic
1066490522 10:35889694-35889716 AAATTCATGCTACCTGTAGATGG + Intergenic
1068801291 10:61143553-61143575 CAATGTATGGAACCTGAAGCTGG + Intergenic
1073783514 10:106864680-106864702 CAATTGTTGCTACCAGTGGCTGG - Intronic
1075663835 10:124216869-124216891 CCATTTATGCGACCTGGAGCTGG + Intergenic
1079386266 11:19982846-19982868 GAATTTCTTCTACCTGTAGCTGG - Intronic
1086587918 11:88477500-88477522 CAATTTATACTATTTGTATCTGG - Intergenic
1091717409 12:2789125-2789147 AAATTTATACTTCCTGTAGATGG - Intergenic
1105374333 13:19829849-19829871 CAATTGATGATACCTAAAGCTGG - Intronic
1105929418 13:25038371-25038393 CAATTTATGTCTCCTGTAGACGG - Intergenic
1115800443 14:36987836-36987858 CAATTTATGCTACCTGTAGCTGG + Intronic
1116167684 14:41354422-41354444 CCAGTTATGCTCCCTGTAGTTGG - Intergenic
1121965665 14:98302165-98302187 CTATTTATGCTCCTTGCAGCGGG - Intergenic
1125111601 15:36040429-36040451 CTCATTAAGCTACCTGTAGCAGG - Intergenic
1125793473 15:42387258-42387280 GAATCTATTCTAGCTGTAGCAGG - Intronic
1126803712 15:52324044-52324066 GAATTTGGGCTAGCTGTAGCTGG - Intronic
1132132936 15:99301651-99301673 AAATTTATACTAGCTCTAGCAGG + Intronic
1140175963 16:72660017-72660039 TAATTTATGGTACATGTACCTGG - Intergenic
1140347554 16:74228650-74228672 CAGTTTGTGCTACATGGAGCAGG - Intergenic
1141460826 16:84177848-84177870 CCATTTATGCTACATATAACTGG - Exonic
1155309841 18:24512688-24512710 CAATTTATGCTTCCTGATGTGGG + Intergenic
1155888263 18:31234982-31235004 CAATGTAGGCTCCCTGAAGCAGG - Intergenic
1163885707 19:19962950-19962972 GGATTTAAGCTACCTGTACCAGG - Intergenic
1163888785 19:19992720-19992742 GGATTTAAGCTACCTGTACCAGG + Intergenic
1163949371 19:20569770-20569792 GGATTTAAGCTACCTGTACCAGG - Intronic
1168385567 19:55960272-55960294 GAATTCATTCTACCTGTGGCAGG - Intronic
928878291 2:36066919-36066941 CATTTTCTGGTACCTGTTGCTGG - Intergenic
934036164 2:88090047-88090069 CAATTTATTCAACCTATAGATGG + Intronic
941525014 2:166596713-166596735 CAATTTCTCCTACTTGTATCAGG - Intergenic
1177105120 21:16945846-16945868 CAAGTTATACTACCTGTGGCTGG - Intergenic
1182384460 22:29925095-29925117 CAATTACTGCTCACTGTAGCTGG + Intronic
951523284 3:23629363-23629385 TCAGTTATGCTCCCTGTAGCTGG + Intergenic
952403247 3:32982349-32982371 ATATTTATACTACCTGTTGCAGG + Intergenic
953599802 3:44351101-44351123 CAAGTGATTCTGCCTGTAGCTGG + Intronic
962521746 3:136203519-136203541 CAATTTATACACCCAGTAGCAGG - Intergenic
966705345 3:182907397-182907419 CAAATTATTCTACCTGTTCCAGG - Intronic
973060580 4:45718929-45718951 CAAGTTGTGCTACCTGCAGTTGG - Intergenic
975192020 4:71475571-71475593 CAATTCCTGCTACCTCTAGTTGG + Intronic
976541129 4:86277843-86277865 CAATCTATGCTATCTGTTGAAGG + Intronic
978017393 4:103762278-103762300 CAATTTATGCTGGCTGTTGTGGG - Intergenic
980279551 4:130702070-130702092 CAAATTATACTACATGTATCAGG - Intergenic
985879450 5:2627601-2627623 CAGTGTATGCTACATGTGGCAGG - Intergenic
988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG + Intronic
990384933 5:55251220-55251242 CAATTGATGATACCTTTATCAGG - Intergenic
992775325 5:80083909-80083931 CTATTTGTGGTACCAGTAGCTGG + Intergenic
995510696 5:112906272-112906294 CAATCCTTGCTACTTGTAGCTGG - Intronic
998881850 5:146653160-146653182 CTAGCTATGCTTCCTGTAGCTGG - Intronic
1003426385 6:6000697-6000719 CAATTTAGGCATCCTTTAGCAGG - Intronic
1016364350 6:143299499-143299521 CAATTGATGACACCTGTAACAGG - Intronic
1020580051 7:9986088-9986110 CAATTTATGCAACTTGAAGATGG + Intergenic
1020600087 7:10263641-10263663 ATCTTTATGTTACCTGTAGCAGG + Intergenic
1021094051 7:16514775-16514797 TAATGTATGCTAGCTGTAGGTGG - Intronic
1028357761 7:89929978-89930000 ACAATTATGCTACCTGTAGTTGG - Intergenic
1028824148 7:95250022-95250044 CATTTTCTGCTGCCTGCAGCTGG - Exonic
1031759320 7:125691684-125691706 CAATTTATTATATATGTAGCTGG + Intergenic
1036725203 8:11214451-11214473 CATTTTCTGCTACATGTAGCAGG + Intergenic
1043754318 8:83983585-83983607 CAATTTATACTCCCATTAGCAGG - Intergenic
1043975767 8:86583014-86583036 CAACCTCTGCTTCCTGTAGCTGG + Intronic
1046678403 8:117138561-117138583 GAATTTCTGCAACCTGAAGCTGG - Intronic
1049852333 8:144839515-144839537 CTATTTCTGCCAACTGTAGCTGG - Intronic
1055191681 9:73531999-73532021 CAGTTTATACTATCTTTAGCTGG - Intergenic
1059476883 9:114554453-114554475 CAAATTATAGTACCTGAAGCAGG - Intergenic
1060690565 9:125654651-125654673 TAATTTTTGGTTCCTGTAGCTGG - Intronic
1185842447 X:3404754-3404776 AAGTTTAAGCTACCTGTAGTTGG - Intergenic
1186772049 X:12827870-12827892 CCATTTATGCTAGATGTAGTTGG + Intergenic
1188624118 X:32263550-32263572 AACTATATGCTAACTGTAGCAGG + Intronic
1197983241 X:132240635-132240657 CATTTTATTCTTGCTGTAGCAGG - Intergenic