ID: 1115803036

View in Genome Browser
Species Human (GRCh38)
Location 14:37017404-37017426
Sequence TTTTACATGTACATGGTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 336}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115803036 Original CRISPR TTTTACATGTACATGGTTCA TGG Intronic
902155714 1:14484510-14484532 TTTTTCTTATACTTGGTTCAAGG - Intergenic
904663313 1:32101218-32101240 TCTTTCACGTACAAGGTTCAGGG - Intronic
904862958 1:33553373-33553395 TTTTATGTGTGCATGGTTCATGG - Intronic
905070385 1:35220112-35220134 TTTTCCATGTCCATCTTTCATGG - Intergenic
907478169 1:54721799-54721821 CTTTAAATGTTCATGGTTAAGGG + Intronic
907638966 1:56166410-56166432 TTTTACATGAGCAGGTTTCAGGG + Intergenic
907925708 1:58953529-58953551 TCTTCCATGCACATGGTGCAAGG - Intergenic
908975429 1:69891378-69891400 TCTTATATGGGCATGGTTCATGG + Intronic
909094074 1:71265594-71265616 TGTTACATAAACATGTTTCATGG + Intergenic
909235892 1:73152472-73152494 TTTTCCAGGTGCATGGTGCAAGG + Intergenic
909302800 1:74035392-74035414 TTTTATATTTATATGGGTCATGG + Intronic
909735581 1:78957081-78957103 TCTTATATGGGCATGGTTCATGG - Intronic
910438159 1:87226486-87226508 TTTTAAATGTAGATGATGCAAGG - Intergenic
910887221 1:91977568-91977590 TTGAACATGTCCATGGTTCTAGG + Intronic
911905398 1:103561674-103561696 TTATAAATATAAATGGTTCAGGG + Intronic
912131776 1:106611869-106611891 TCTTATATGGACATGGTTCATGG + Intergenic
914385007 1:147160211-147160233 TTTGACATCTACTTTGTTCAAGG - Intronic
914866940 1:151438404-151438426 TTTTTCATGAACATGGGTTATGG + Intronic
916781245 1:168032443-168032465 TTTTCCATGTTCATAGGTCAGGG - Intronic
918529909 1:185507234-185507256 TTTTACATGTATATTCATCAGGG + Intergenic
918606169 1:186428871-186428893 TCTTATATGGGCATGGTTCATGG + Intergenic
919035750 1:192307080-192307102 TTGTATATGTATATGGTACAGGG + Intergenic
919093908 1:193006725-193006747 TCTTACATGGGCATGGTTCATGG + Intergenic
919185580 1:194143572-194143594 TTTTACATGTATATACATCAGGG + Intergenic
919448848 1:197745531-197745553 TATTATATGGGCATGGTTCATGG + Intronic
919487887 1:198166688-198166710 TTTTATTTGGACATGATTCATGG + Intronic
920731144 1:208486701-208486723 TTGTACATTTACAGGGTACAAGG + Intergenic
920801533 1:209192718-209192740 TTTTACATGTGCATCTTTGAAGG - Intergenic
921321993 1:213950823-213950845 TTTTACTTGTGCATGGTACATGG - Intergenic
921710002 1:218364479-218364501 TTTTTCCTGAGCATGGTTCAGGG - Intronic
921809717 1:219498833-219498855 CTTTACATGTGCCTGGTTCTGGG - Intergenic
922169927 1:223145399-223145421 TTTTACATGGACATGTTTATTGG + Intergenic
922587515 1:226746030-226746052 TTTTTCATTCACATGTTTCATGG + Intergenic
923407044 1:233672047-233672069 CTTTATATGTACATAGTTAATGG - Exonic
924721556 1:246627685-246627707 TTTTACATGTCTATGCTTTAAGG - Intronic
924726701 1:246678139-246678161 TTTTCCAAGTACAAGGTTGAGGG + Intergenic
1063598399 10:7458267-7458289 TTTAACATGGTCATGGTTCACGG + Intergenic
1064842030 10:19603842-19603864 TCTTATATGGGCATGGTTCATGG - Intronic
1065402739 10:25324473-25324495 TATTATATGGGCATGGTTCATGG + Intronic
1068293811 10:55040395-55040417 TTTTACATTTACATGTCTAAGGG + Intronic
1068306915 10:55223349-55223371 TTTTACATGCACCTTTTTCAAGG + Intronic
1068781484 10:60923195-60923217 TTGTACATGTCTATGCTTCAAGG - Intronic
1069404092 10:68079573-68079595 TTGTACAGGTAAATGGTTTAGGG - Intergenic
1070873700 10:79781500-79781522 TATTAGATGTACATGGTTGGGGG + Intergenic
1070984359 10:80675400-80675422 TCTTATATGGACATGGCTCATGG - Intergenic
1071640633 10:87303650-87303672 TATTAGATGTACATGGTTGGGGG + Intergenic
1071654603 10:87434295-87434317 TATTAGATGTACATGGTTGGGGG - Intergenic
1071862842 10:89692764-89692786 TGATAAATGTACATCGTTCAAGG + Intergenic
1072474023 10:95741356-95741378 TCTTATATGGGCATGGTTCATGG + Intronic
1072642040 10:97218990-97219012 TTTCAACTGTACATGGTCCAGGG - Intronic
1072881153 10:99231309-99231331 TTTTATATGTAAAGGGCTCAGGG - Intronic
1073514754 10:104066342-104066364 TTTTCCTTGTCCCTGGTTCAAGG - Intronic
1073598997 10:104828440-104828462 TTTTATATGGGCATGGTTCATGG + Intronic
1073781054 10:106838926-106838948 TCTTACATGGGCATGGTTCAGGG - Intronic
1074619656 10:115106016-115106038 TTTTCCAGGCACATGGTGCAAGG - Intronic
1076089243 10:127666612-127666634 TTATACATGTACATGGTTGGTGG - Intergenic
1076260234 10:129059302-129059324 TTTTATTTGTACTTCGTTCAAGG - Intergenic
1078491603 11:11774445-11774467 TGGTACATGTCCATTGTTCAGGG + Intergenic
1078834434 11:15013671-15013693 TCATACCTGTACAGGGTTCATGG - Intronic
1079357988 11:19745881-19745903 TGGTACTTGTCCATGGTTCAAGG + Intronic
1079571326 11:21946766-21946788 TTTAACATGCAGATGATTCAAGG - Intergenic
1079678016 11:23256659-23256681 TTTTGCATCTACATTATTCAAGG + Intergenic
1079767232 11:24409399-24409421 TTGTAACTGTACATAGTTCATGG - Intergenic
1080127231 11:28751135-28751157 TATTAAATTTACATGGTTAAGGG - Intergenic
1080671389 11:34382478-34382500 ATTTACATATACATGTTTCCTGG - Intergenic
1084369222 11:68727932-68727954 TCTTACATGGACATGGCTCGTGG - Intronic
1085904534 11:80744377-80744399 TTATAGTTGTACATGGTACAGGG + Intergenic
1085919926 11:80941381-80941403 TTTTAATTGTATATAGTTCAAGG - Intergenic
1086645764 11:89218056-89218078 TTTTTCATGTAGGTTGTTCAGGG + Intronic
1087842076 11:102930877-102930899 TTTATCATTTACATGTTTCAAGG + Intergenic
1087913961 11:103786474-103786496 TCTTACATGGGCATGGTTTATGG + Intergenic
1088352368 11:108904404-108904426 TTTTGAATGCACATGGTTAATGG + Intronic
1088529714 11:110795615-110795637 CTGTACATGTACATGGTCCATGG + Intergenic
1088662050 11:112057111-112057133 TCTTATATGGGCATGGTTCATGG - Intronic
1089332306 11:117698392-117698414 TTTTACATGTATCTGTTGCATGG - Intronic
1091427105 12:400665-400687 TCTTATATGGGCATGGTTCATGG + Intronic
1092041627 12:5390076-5390098 TTTTACATGTGAATAGTTGAGGG - Intergenic
1094176929 12:27550400-27550422 TTTAACATTTACATGGATAATGG + Intronic
1094341316 12:29414536-29414558 TTTTTAAAGTACATGCTTCATGG - Intronic
1094359829 12:29618518-29618540 TTTTACATGTACATTGCCTAAGG - Intronic
1099044234 12:77695949-77695971 TTTGTCATGTCCTTGGTTCAAGG + Intergenic
1099257206 12:80328651-80328673 TTTTCCATGTAAAGGGTTGAAGG + Exonic
1100005349 12:89889046-89889068 TTTTACATTTATAGAGTTCAAGG + Intergenic
1100723488 12:97384156-97384178 TCTTGTATGGACATGGTTCATGG + Intergenic
1100971997 12:100080222-100080244 TTTTCCAGGCACATGGTGCAAGG - Intronic
1102987526 12:117290577-117290599 CTTGACATGTACAAGGTTCCTGG + Intronic
1104534068 12:129601742-129601764 TCTTACATGGGCATGGTTCATGG + Intronic
1105661456 13:22499841-22499863 GTCTACATTTACATGTTTCAGGG + Intergenic
1106352847 13:28950693-28950715 TCTTATATGGGCATGGTTCATGG + Intronic
1106685104 13:32050177-32050199 TTTGACATTTAAATGGTTTAAGG - Intronic
1106946646 13:34835213-34835235 TCTTATATGGGCATGGTTCATGG - Intergenic
1107830293 13:44369302-44369324 GTTTTCATGTACATGAGTCAGGG + Intergenic
1109106741 13:58262179-58262201 TTTTACATCTACATTAATCAAGG - Intergenic
1109125058 13:58506479-58506501 TTTTTCATATACAGGATTCAGGG - Intergenic
1110053784 13:70939247-70939269 TTTTCCATATGCATGATTCATGG + Intergenic
1110074490 13:71221726-71221748 TTATGCATCTACATTGTTCAAGG + Intergenic
1110119037 13:71859346-71859368 TTTTAAATGCATTTGGTTCAAGG + Intronic
1111261543 13:85746793-85746815 TTTTACAGGTCCAGGGTTCAGGG - Intergenic
1111586254 13:90288036-90288058 TTTTCCTTGTCCCTGGTTCAAGG - Intergenic
1111817545 13:93172819-93172841 TTTTTCATGTTCATGCTGCATGG + Intergenic
1111839941 13:93437102-93437124 TTTTATATGGGCATGATTCATGG - Intronic
1111857673 13:93660301-93660323 TCTTCCATGTACATGTTTTAAGG + Intronic
1112826552 13:103398515-103398537 TTTTCCAGGCACATGGTGCAAGG + Intergenic
1112856706 13:103779657-103779679 TCTTATATGAGCATGGTTCATGG + Intergenic
1113096557 13:106670910-106670932 TTTAACATCTCCATGTTTCATGG - Intergenic
1113277191 13:108744019-108744041 GTATACATTTAAATGGTTCAAGG + Intronic
1113535878 13:111065976-111065998 TTATACATGGGCATGGTTCAGGG - Intergenic
1113554956 13:111225710-111225732 TCTTACATGGGCATGGTTCATGG - Intronic
1115021849 14:28691311-28691333 TTTTAAATGTATATTGTTTATGG + Intergenic
1115298959 14:31862991-31863013 ATTTACATGTAAATATTTCATGG - Intergenic
1115803036 14:37017404-37017426 TTTTACATGTACATGGTTCATGG + Intronic
1117455057 14:55888639-55888661 TCATACAGGTAAATGGTTCATGG - Intergenic
1117759081 14:59007454-59007476 TTTTACATATACATTTTTAATGG - Intergenic
1117887013 14:60374990-60375012 TCTTATATGGGCATGGTTCATGG - Intergenic
1118956256 14:70484190-70484212 TTTTGCATGTACATTCATCAAGG - Intergenic
1119335578 14:73830805-73830827 TTTTTCATTTTCTTGGTTCATGG + Intergenic
1121997993 14:98620319-98620341 TCTTATATGGACATGGTTTATGG - Intergenic
1122522702 14:102356789-102356811 TTATATATGCACATGGTTCATGG - Intronic
1123126203 14:105947829-105947851 TTATACATTGACATGGTTCTGGG + Intergenic
1125133360 15:36311102-36311124 TGTAAAATGTACATGGTGCATGG - Intergenic
1125233394 15:37483812-37483834 TTTTCCACGCACATGGTTCAAGG + Intergenic
1126279544 15:46928589-46928611 CAATACATGTACATGGTACAAGG - Intergenic
1127849256 15:62898566-62898588 TTTTGTATGTACATGGTAAATGG - Intergenic
1128063869 15:64752194-64752216 TTTTACATGTACATTTTTGGGGG - Intronic
1128444808 15:67749674-67749696 TTTTACATCAACATGGATTATGG - Intronic
1130129840 15:81130918-81130940 TCTTATATGCCCATGGTTCATGG + Intronic
1130266271 15:82407157-82407179 TTATACATATACAGGGCTCAGGG + Intergenic
1130330053 15:82915223-82915245 TGTTACATGTATAGAGTTCAGGG - Intronic
1135293040 16:21256576-21256598 TGTTACAGGAACATGGTTCAGGG - Intronic
1135798599 16:25471394-25471416 TTTTAAATGTCCATGTTTCTAGG - Intergenic
1136639337 16:31549431-31549453 CTCTACATGTTCATGGTTAAGGG + Intergenic
1136682241 16:31975127-31975149 GTTTATATGTACATGGTAAAGGG - Intergenic
1136782494 16:32916294-32916316 GTTTATATGTACATGGTAAAGGG - Intergenic
1136887298 16:33937556-33937578 GTTTATATGTACATGGTAAAGGG + Intergenic
1138322179 16:56125020-56125042 TTTTACCTGTACTTAATTCAAGG - Intergenic
1139362962 16:66414224-66414246 TTATTGATGTACAAGGTTCAGGG + Intergenic
1203085155 16_KI270728v1_random:1180282-1180304 GTTTATATGTACATGGTAAAGGG - Intergenic
1149177182 17:53886717-53886739 TTTTATATGGGCCTGGTTCATGG + Intergenic
1149332422 17:55598804-55598826 TTTTACATGAACATTAATCAGGG + Intergenic
1151167460 17:72217754-72217776 TCTTTCAGGTACATGGTTGAGGG - Intergenic
1155780834 18:29832429-29832451 ATTTACATATATATGTTTCATGG - Intergenic
1158154549 18:54410708-54410730 ACATACATGTAAATGGTTCATGG - Intergenic
1159180607 18:64897869-64897891 TTTTATATGGTCATGATTCATGG + Intergenic
1160155100 18:76427784-76427806 TTTTAAATGTGCAAAGTTCATGG + Intronic
1166595650 19:44047142-44047164 TGTGACATTTACAGGGTTCAGGG + Intergenic
925360084 2:3272603-3272625 TCTTACATGGGCATGGTTCGTGG + Intronic
926403052 2:12519752-12519774 TTTTACATGTATATGCTAGACGG - Intergenic
926449973 2:12991131-12991153 TTTTATATGGACATGCTTCCTGG - Intergenic
928607850 2:32960623-32960645 TTTTTCAAGTACATGGTACTTGG - Intronic
929916203 2:46138086-46138108 TTTTAAAAGTACATTGTTTAGGG + Intronic
930132982 2:47871699-47871721 TTTAACATCTACAGGATTCAAGG - Intronic
931154150 2:59608459-59608481 TTTTCCAGGTGCATGGTGCAAGG - Intergenic
931545917 2:63387204-63387226 TTTTACATCTACGTGTATCAAGG - Intronic
932069716 2:68607143-68607165 TTTTACCTGTAGATGCTTAACGG - Intronic
932469958 2:71948321-71948343 TTTTCTATGGGCATGGTTCATGG + Intergenic
932857398 2:75250688-75250710 TCTTACATTAACATGGTTCATGG + Intergenic
933181345 2:79230684-79230706 TTTTCCAGGCACATGGTACAAGG - Intronic
936719782 2:115237318-115237340 TTTTATACTGACATGGTTCATGG - Intronic
937563282 2:123251513-123251535 TTTTACATGGTGATAGTTCATGG + Intergenic
939354326 2:141081545-141081567 TTTTATATATACAGGTTTCAAGG + Intronic
940133932 2:150414782-150414804 TTTTACATGTTCATGATTGTTGG - Intergenic
940840267 2:158571807-158571829 TGTTACGTGAAAATGGTTCAAGG + Intronic
941188937 2:162352506-162352528 TTATACATGCACATAGTTTAAGG + Intronic
941974558 2:171388884-171388906 TTTTATATGGATATGGTTCATGG - Intronic
943229192 2:185224022-185224044 TTTTACATGTAAATGGTTTTGGG + Intergenic
943335913 2:186613535-186613557 TTTTGCATGTCCATGGATTATGG + Intronic
943616568 2:190099451-190099473 TCTTATATGGACACGGTTCAAGG + Intronic
944131404 2:196351319-196351341 TTTTTCCTGTACATGATTCTTGG + Intronic
944255705 2:197621618-197621640 TTTTATATGGGCATGGTTCCCGG - Intronic
945680295 2:212905625-212905647 TTTGACATTTAAAGGGTTCATGG + Intergenic
946489225 2:220131701-220131723 TTTAACATGCTCATGGTTCTGGG - Intergenic
946615713 2:221507471-221507493 TTTTACATTTACATTGTTTTAGG + Intronic
947226465 2:227845205-227845227 TTTCAAATGTACATTGTTTAAGG + Intergenic
947234603 2:227926943-227926965 TTTTATATGGGCATGATTCATGG - Intergenic
948107134 2:235423611-235423633 TCTTATATGGGCATGGTTCATGG - Intergenic
948978400 2:241478965-241478987 TTTTGCAAGAACAAGGTTCAAGG + Intronic
1169846109 20:9993448-9993470 TTTTTCAAGTGCATGATTCAGGG - Intronic
1173346309 20:42203634-42203656 TTATACATGTACATGTTCAATGG - Intronic
1174326756 20:49785345-49785367 CCTAACATGTACATGGTTCATGG - Intergenic
1174652551 20:52140062-52140084 TCTTATATGGACATGGTTCATGG - Intronic
1175152341 20:56945058-56945080 TTTTAAATGTACATTATTAATGG + Intergenic
1175330385 20:58159748-58159770 TTTTACTTGTAGCTGGTTCAAGG + Intronic
1177063550 21:16401464-16401486 TTTTAGATTTTCATGTTTCATGG + Intergenic
1177763790 21:25433863-25433885 TTTTTCCAGTACATGATTCAAGG - Intergenic
1178557153 21:33602157-33602179 TTTTACAAGTACATTTTTAAAGG + Intronic
1178620346 21:34168804-34168826 TTTTTCATGCTCATTGTTCAGGG + Intergenic
1179936723 21:44610705-44610727 TTTTCCAGGCACATGGTGCAAGG - Intronic
1182341453 22:29624539-29624561 CTTTACAGGCACTTGGTTCAGGG + Intronic
1182491628 22:30676135-30676157 TTTTACCTGTAGATGCTTAATGG - Intergenic
1182493708 22:30691959-30691981 TTTTGCATGTGGATGGATCATGG - Intergenic
1182924907 22:34113075-34113097 TTTTACAGGTACATAGTCAAAGG - Intergenic
1183008450 22:34924322-34924344 TATTATATGGGCATGGTTCACGG + Intergenic
1183820846 22:40344877-40344899 TATTACAAGTACATGATTAAGGG - Intergenic
949587178 3:5453347-5453369 ATTGACATTCACATGGTTCAAGG - Intergenic
949973544 3:9433349-9433371 TTTTACCTGTACTTTCTTCAGGG + Intronic
950780364 3:15386528-15386550 TTATACATGGGCATGGTTCCAGG + Intronic
950957225 3:17067045-17067067 TTTTACATGTATGTGGTGGAGGG - Intronic
953811641 3:46117640-46117662 TTTTCCTTGTCCCTGGTTCAAGG + Intergenic
956354704 3:68378187-68378209 TTTTCAAGGCACATGGTTCAAGG - Intronic
956451897 3:69383467-69383489 TATTAGATGTACATAGTTCGGGG + Intronic
956786348 3:72645720-72645742 TTTGACATGTACACACTTCAGGG + Intergenic
956960612 3:74395973-74395995 TCTTACATGAGCAGGGTTCATGG - Intronic
957723760 3:84037730-84037752 TGTTACATAAACATGTTTCATGG - Intergenic
957849974 3:85795243-85795265 TTTTAACTCTTCATGGTTCAAGG - Intronic
958067339 3:88560321-88560343 ATGTACATGTACATGTTTGAAGG + Intergenic
958698758 3:97561010-97561032 TCTTACATGGGCATTGTTCATGG - Intronic
958723509 3:97875652-97875674 TTTTAGATGTACCAGGTGCATGG - Exonic
958831523 3:99096337-99096359 TTTGACATGTAATTGGTTCAAGG - Intergenic
958971953 3:100621049-100621071 CTTTACATGGACGTGGTTCACGG - Intronic
959031241 3:101301150-101301172 TCTTACATGGATATTGTTCATGG + Intronic
959109050 3:102099684-102099706 TTTCACATGTATAAGATTCAGGG + Intronic
959109136 3:102100900-102100922 TTTCACATGTATAAGATTCAGGG - Intronic
960715713 3:120572907-120572929 TATTACATGTCCATAGTTTATGG + Intergenic
961473604 3:127133860-127133882 TTTTATCTGGACATGGTTGAAGG - Intergenic
961932755 3:130551082-130551104 TTTTACATCTACATTCATCAAGG + Intergenic
963069432 3:141290748-141290770 TTTTAACTGTAAATGGTTCAGGG + Intronic
963967910 3:151393902-151393924 TTTTTCATTTACATGTATCAAGG + Intronic
964019580 3:151993057-151993079 TCTTGCATATTCATGGTTCAGGG - Intergenic
964813563 3:160692476-160692498 TCTTATATGGACAGGGTTCAAGG - Intergenic
964926451 3:161963888-161963910 TTTTATAGGTGCATGGTGCAAGG - Intergenic
966653879 3:182331243-182331265 TTTGAAAGGTACATGGTACAAGG + Intergenic
966858151 3:184210551-184210573 ACTTACTTGTAAATGGTTCATGG + Intronic
967426542 3:189333708-189333730 ATTTACTTCTGCATGGTTCAGGG + Intergenic
967577358 3:191109159-191109181 TTTTACATGTACATTCTTGAGGG - Intergenic
967697680 3:192552445-192552467 TTTTCTATTTACATGGTTTAGGG - Intronic
970201196 4:13608260-13608282 TTATGCATGTACATTTTTCAGGG + Intronic
970744764 4:19281469-19281491 TTTTACAGGCACAGGGTGCAAGG + Intergenic
970880473 4:20923130-20923152 TTCTACATGTAAATGATTCTTGG - Intronic
971044091 4:22785434-22785456 TATTATATGTGCTTGGTTCATGG + Intergenic
972077715 4:35107166-35107188 TTGTACATGAATATGATTCATGG - Intergenic
972701585 4:41499326-41499348 TCTTACATTCAAATGGTTCAGGG - Intronic
974843442 4:67323641-67323663 TTTTCCAGGTGCATGGTGCAAGG - Intergenic
975039766 4:69731385-69731407 TTTTCCATGAACAGGGTGCAAGG - Intronic
975086679 4:70349842-70349864 TTATACATGTTGATGGTTGATGG + Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
975916411 4:79330992-79331014 TTATACATTGGCATGGTTCAGGG - Intergenic
976831163 4:89316118-89316140 TTTTAATTATACATGATTCAAGG + Intergenic
977296983 4:95221324-95221346 ATATACATGTACATTTTTCAGGG + Intronic
977401130 4:96534047-96534069 TTTTATATGGGCATTGTTCACGG - Intergenic
977467040 4:97395776-97395798 TTTAACATGAACATAGTTGATGG + Intronic
977539320 4:98297583-98297605 TCATACATGGGCATGGTTCACGG - Intronic
978111435 4:104968270-104968292 TTTTACATGTACTGAGTTTAAGG - Intergenic
978473548 4:109098426-109098448 TCTTACATCTACATGGATTATGG - Intronic
978888178 4:113790962-113790984 TTTTCCATGTACTTGGTTCTGGG - Intergenic
979374358 4:119928060-119928082 TCTTATATGGGCATGGTTCATGG - Intergenic
979619323 4:122780803-122780825 TCTTATATGGACATGGTTCATGG + Intergenic
981464422 4:145051307-145051329 TATTATATGAGCATGGTTCATGG + Intronic
982085122 4:151827347-151827369 TCTTACATGAGCATGTTTCATGG + Intergenic
982768077 4:159370270-159370292 TTTAACATGTCCATGGTTTATGG + Intergenic
982830431 4:160053352-160053374 TTTTCCACTGACATGGTTCATGG - Intergenic
983300878 4:165923983-165924005 TCTTATATGGGCATGGTTCATGG - Intronic
983606391 4:169590756-169590778 TCTATCATGTACATGTTTCAGGG + Exonic
983858574 4:172675880-172675902 TTCTAGATGTACATGCCTCAAGG - Intronic
983933236 4:173476043-173476065 TTTAAAATGTATATAGTTCATGG - Intergenic
984479115 4:180276302-180276324 TTTTACATGGTTCTGGTTCATGG - Intergenic
986081815 5:4402453-4402475 TTTCAAATGTACATGGTCCCAGG - Intergenic
986113887 5:4750381-4750403 TTTTCCAAGCACATGGTGCAAGG + Intergenic
988160315 5:27511344-27511366 TTTTACAAGTAAATCATTCACGG + Intergenic
988174954 5:27710875-27710897 TCTTATATGGTCATGGTTCATGG - Intergenic
989770562 5:45139828-45139850 TTTTACATGTTCATAGTAGAGGG + Intergenic
990697496 5:58436960-58436982 TCTTATATGGACGTGGTTCATGG + Intergenic
990732218 5:58821731-58821753 ACTTAGATGTACTTGGTTCAGGG + Intronic
991171618 5:63633144-63633166 TCTTACATGGATATGGTTCATGG + Intergenic
992526746 5:77619099-77619121 TTTTACATATAACTGCTTCATGG + Intronic
993167818 5:84381153-84381175 TTTTAAATGTATATGGTTTTGGG - Intronic
993693575 5:91033439-91033461 TGTCACATGTACATGGGACAAGG + Intronic
993711901 5:91233554-91233576 TTTTACATGTCAAGGGTTCATGG - Intergenic
994024324 5:95064132-95064154 TTATACAAGTACATGCTTTAGGG + Intronic
994700572 5:103128319-103128341 GTTTACATGTACTTGCTTCCTGG - Intronic
995355531 5:111233522-111233544 TTTGATATGAACATTGTTCACGG - Intronic
995431234 5:112080228-112080250 TCTTATATGGGCATGGTTCATGG - Intergenic
995988734 5:118210115-118210137 TTTTCCAGGTGCAAGGTTCAAGG - Intergenic
995996058 5:118301217-118301239 TTTTACATATACTTAGTTCCAGG + Intergenic
1000689679 5:164300986-164301008 TTTTGCATTTACATGGTTTTAGG - Intergenic
1002407842 5:179050159-179050181 TTGTACATGAATATGATTCATGG - Intergenic
1005160522 6:22856472-22856494 TTTTTCATGTAAATGTTTCTTGG + Intergenic
1006276861 6:33011162-33011184 TTATACATGTACATGTTTATTGG + Intergenic
1008752511 6:54753532-54753554 TTTTACATGTAGATTATACAGGG - Intergenic
1009816914 6:68748638-68748660 TTTTCCAGGTGCATGGTGCAAGG + Intronic
1009963380 6:70551805-70551827 TCTTACATAGGCATGGTTCATGG + Intronic
1010064796 6:71669742-71669764 TCTTATATGTGCATGGGTCATGG - Intergenic
1010450729 6:75999480-75999502 TTTTACCTGTACATGGGAAAAGG + Intronic
1010740316 6:79495251-79495273 TTTTCCATGGACAGGGTTGAGGG - Intronic
1011378877 6:86721107-86721129 TTTTACTTGTAAAAAGTTCAAGG - Intergenic
1012199712 6:96390889-96390911 TCTTACATGTACATCTTTCCAGG + Intergenic
1012596093 6:101042188-101042210 TTTTAAATGTACATAGTGCCGGG - Intergenic
1015045147 6:128767964-128767986 TTTTCCAGGTGCATGGTACAAGG + Intergenic
1015063020 6:128990614-128990636 TTTAACATGTACTTGGCTTAAGG - Intronic
1015668658 6:135661897-135661919 TTTTACATGTATATTCATCAGGG - Intergenic
1015821812 6:137269287-137269309 TCTTATATGAACGTGGTTCATGG + Intergenic
1016219333 6:141647018-141647040 TTTTCCAGGTGCATGGTGCAAGG - Intergenic
1016616948 6:146061141-146061163 TCTTATATGGGCATGGTTCATGG + Intronic
1017314359 6:153013296-153013318 TCTTATATGGGCATGGTTCATGG - Intronic
1017569884 6:155732418-155732440 TTTCTCATGTACCTGATTCAAGG - Intergenic
1018935828 6:168273652-168273674 TGTTTCATGTTCATGTTTCATGG + Intergenic
1020222590 7:6251705-6251727 TTTTACGTTTCCGTGGTTCAGGG - Intronic
1020409229 7:7872451-7872473 TCTTACATGGGCATGGTTCGTGG + Intronic
1020833326 7:13118369-13118391 TCTAACATGGCCATGGTTCATGG - Intergenic
1020944540 7:14585862-14585884 TCTTACATGGGCGTGGTTCATGG - Intronic
1027726911 7:81817305-81817327 TTTTAAATGTACTTGGTGTATGG + Intergenic
1027818955 7:83018632-83018654 TTTAACATGTACATATTTAAGGG - Intronic
1028037861 7:86007465-86007487 ATTCACCTCTACATGGTTCAGGG - Intergenic
1028300091 7:89188285-89188307 TTCTATATGAACATGGTTCTTGG - Intronic
1028456446 7:91043015-91043037 TTTTCTGTGTAAATGGTTCAGGG + Intronic
1028578230 7:92377348-92377370 TCTTATATGGGCATGGTTCATGG + Intronic
1028675147 7:93451244-93451266 TTTTACATGTAATAGGTTCAAGG - Intronic
1029015129 7:97308371-97308393 TTTTACATGTAGAAGGTAGAAGG - Intergenic
1029836469 7:103317463-103317485 TTTTACTTGTGCATGTTTGAAGG - Intronic
1030483686 7:110138346-110138368 TCTTAAGTGTGCATGGTTCATGG - Intergenic
1030740824 7:113107665-113107687 TTTAACATGTAAGTGTTTCACGG - Intergenic
1031146481 7:118002699-118002721 TTTTAAATTTACAGGGTACAAGG + Intergenic
1031431893 7:121681963-121681985 TTTTATATGTACATGTATGAGGG + Intergenic
1031821319 7:126505544-126505566 TTTTACCTGTACATAGTTGAAGG + Intronic
1032235526 7:130118863-130118885 TTTTATATGGGCGTGGTTCATGG + Intronic
1032712988 7:134478436-134478458 TCTTATATGGACACGGTTCATGG + Intergenic
1033300328 7:140179041-140179063 TTTTAAATGTACTTTGTTGAAGG + Intergenic
1033788549 7:144763416-144763438 TTATACATGGCCATAGTTCAGGG - Intronic
1034408540 7:150923312-150923334 AATTGGATGTACATGGTTCAGGG - Intergenic
1037587073 8:20284588-20284610 TTTTACGTGTACATTGTCCGTGG + Intronic
1038292825 8:26265274-26265296 TTTTACATATATATTTTTCAAGG + Intergenic
1038306132 8:26404369-26404391 TTTTATCTGTACATGAATCATGG + Intronic
1038684356 8:29702778-29702800 TTTTCCAGGTGCATGGTGCAAGG - Intergenic
1038848678 8:31253581-31253603 TTTTGCATGTAGGTGCTTCAAGG + Intergenic
1039212291 8:35231480-35231502 TCTTATATGAGCATGGTTCATGG + Intergenic
1039305118 8:36253130-36253152 TTTTCCAGGTATATGGTTGAAGG + Intergenic
1039376364 8:37038294-37038316 TTTGACATTTACATAGGTCATGG - Intergenic
1040718141 8:50283434-50283456 TTTTACATGGCCATTGTTGAAGG + Intronic
1042140417 8:65673298-65673320 TCTTACATGTGCTTGGTTCATGG + Intronic
1042299409 8:67260329-67260351 TTTTACAGGTTCATGGTTTGTGG + Intronic
1042396438 8:68296412-68296434 TTTTACATTGGCATGGTTCCAGG - Intergenic
1042720073 8:71818062-71818084 GTTCACATGTACAAGGTCCAGGG - Intergenic
1042760759 8:72269270-72269292 TTTCACATGTAAAAGGTTTATGG - Intergenic
1043423056 8:80120116-80120138 TTATATATATACATGGTACAAGG - Intronic
1043601308 8:81941780-81941802 TCTTATCTGTGCATGGTTCATGG - Intergenic
1043682943 8:83053669-83053691 TTTTACTTGTTCATTATTCATGG + Intergenic
1043766010 8:84133131-84133153 TTTTACATGTACATTTTTCTAGG + Intergenic
1043862719 8:85339380-85339402 TCTTACTTGGACATGGTTTATGG - Intronic
1043872264 8:85446716-85446738 TTTTACAGATACATAATTCAAGG + Intronic
1044121167 8:88398080-88398102 TTTTGCATGAACATGTTTTATGG - Intergenic
1046373313 8:113341065-113341087 TTTTAATTGTACATATTTCAAGG + Intronic
1048824349 8:138409326-138409348 TCTTACATGGGCATGCTTCATGG + Intronic
1048825437 8:138420575-138420597 TTTTACATCTACATTCATCAAGG - Intronic
1048851375 8:138648400-138648422 TTTTACCCATACATGGTACAGGG - Intronic
1048943271 8:139421315-139421337 TCTTACATGGCCGTGGTTCATGG + Intergenic
1049731900 8:144182413-144182435 TTGGAGATGTAGATGGTTCAGGG + Intronic
1049954450 9:679229-679251 TTATAGATGTACATGGGTCATGG - Intronic
1050321433 9:4456846-4456868 TTGTATATGGGCATGGTTCATGG + Intergenic
1051085039 9:13338517-13338539 TCTTACATGGGCATGGTTCATGG + Intergenic
1051395858 9:16619550-16619572 TGTTACATGTTCATGTTTAAGGG - Intronic
1051601702 9:18881520-18881542 TTTTATATGAGCATGGTTCATGG + Intronic
1052532078 9:29699204-29699226 TTTTACATTTTTATGGTACAGGG + Intergenic
1055002339 9:71466069-71466091 TTTTACATTTTCATTTTTCAAGG - Intergenic
1055043758 9:71903655-71903677 TTTTACATGAAAAAGGTTTAGGG + Intronic
1055373756 9:75626646-75626668 TTTTAGATGTACATGTCTCAGGG + Intergenic
1055839480 9:80484992-80485014 TAATACATGAACATGGTTTATGG + Intergenic
1057538977 9:95946878-95946900 TTTTATAGGGGCATGGTTCATGG - Intronic
1058620909 9:106881686-106881708 TTTTACCAGTACAAGCTTCAAGG - Intronic
1186304095 X:8235428-8235450 TCATATATGAACATGGTTCATGG + Intergenic
1186321927 X:8437090-8437112 TTTTACAATGGCATGGTTCAGGG + Intergenic
1186971983 X:14856448-14856470 TATTACATTTACTTTGTTCAGGG + Intronic
1187800397 X:23055959-23055981 TCTTATATGGGCATGGTTCATGG - Intergenic
1187811152 X:23178977-23178999 TATTATGTGTACATGGTGCACGG + Intergenic
1188865207 X:35305674-35305696 TTTTACAGGTGCATGGTGCAAGG - Intergenic
1189072429 X:37877929-37877951 TTTTATATGAGCATGGTTCATGG - Intronic
1189096344 X:38144279-38144301 GTTTACGTTTACTTGGTTCATGG + Intronic
1191035799 X:56025505-56025527 TTGTACATGAATATGATTCATGG + Intergenic
1193833359 X:86314009-86314031 TTTTACATGGGCATGGTTTGTGG - Intronic
1194167869 X:90542876-90542898 TTTTATATGGGCGTGGTTCATGG + Intergenic
1194522526 X:94936169-94936191 TTTTGCAGGTGCATGGTGCAAGG - Intergenic
1194575537 X:95609852-95609874 TGTTACATTTACATTTTTCAGGG - Intergenic
1194796380 X:98216018-98216040 TTTTATATTTACATAGTTAACGG + Intergenic
1194964944 X:100277539-100277561 ATTTACATGTACACAGTACAGGG + Intergenic
1195987578 X:110646846-110646868 TCCCACATATACATGGTTCAGGG - Intergenic
1196504768 X:116428398-116428420 TCTTATATGAACATAGTTCATGG - Intergenic
1196724687 X:118885574-118885596 TTTTCCTTGTCCCTGGTTCAAGG - Intergenic
1198725188 X:139669414-139669436 TTTTACATTTACATGTATGAGGG - Intronic
1199396468 X:147344312-147344334 TATTACATGTACATAATTTAGGG - Intergenic
1199820067 X:151435936-151435958 TTTTACATGTACATTGCTCAGGG + Intergenic
1201692950 Y:16789518-16789540 TTTAAGAGGTACAGGGTTCAGGG - Intergenic