ID: 1115805911

View in Genome Browser
Species Human (GRCh38)
Location 14:37051548-37051570
Sequence GCACAGGCAACTTGGGCAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115805905_1115805911 19 Left 1115805905 14:37051506-37051528 CCTATTCTTACCTATTCAATCAG 0: 1
1: 0
2: 1
3: 14
4: 219
Right 1115805911 14:37051548-37051570 GCACAGGCAACTTGGGCAATTGG 0: 1
1: 0
2: 2
3: 9
4: 143
1115805906_1115805911 9 Left 1115805906 14:37051516-37051538 CCTATTCAATCAGAATATGTAAG 0: 1
1: 0
2: 3
3: 49
4: 396
Right 1115805911 14:37051548-37051570 GCACAGGCAACTTGGGCAATTGG 0: 1
1: 0
2: 2
3: 9
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115805911 Original CRISPR GCACAGGCAACTTGGGCAAT TGG Intronic
900334633 1:2155927-2155949 TCACAGGCATCCTGGGCAAGGGG - Intronic
901790716 1:11652594-11652616 GTCCAGGCATCTTGGGCACTCGG - Intronic
906930327 1:50163441-50163463 GCACAGCCAAGTTGGGAGATGGG + Intronic
908674506 1:66588293-66588315 TCAGGGGCAACTTGGGCTATAGG - Intronic
911831099 1:102552233-102552255 GAACAGGCAACTTAGAGAATGGG - Intergenic
918133011 1:181645637-181645659 GCACAGGGAACTGGGGCAGGTGG - Intronic
919542211 1:198862483-198862505 GGAGAGGCAAGTTGGGCACTTGG + Intergenic
920443564 1:205998447-205998469 GCACAGGAATCTAGGGCACTGGG + Intronic
921970162 1:221139559-221139581 GCACAGCAAACTTGGACGATGGG + Intergenic
924866380 1:247986045-247986067 GAACAGGCAACTTACGGAATGGG - Intronic
1069686641 10:70323177-70323199 GCCCAGACAACCTGGGCACTGGG - Intronic
1070391551 10:75975250-75975272 ACTCAGGCAAGTTGGGCAGTAGG - Intronic
1070592042 10:77808244-77808266 GCACAGGCAACATCAGCAAGAGG - Intronic
1072775778 10:98191589-98191611 GCACAGGCAACCTGCAGAATGGG - Intronic
1072966955 10:99982053-99982075 GCACACTCAAATTGGGTAATTGG - Intronic
1073290834 10:102412479-102412501 GCACAGACACCTTGTCCAATGGG - Exonic
1075044852 10:119138882-119138904 GCACAGTCCGCTTGGGGAATAGG + Intergenic
1076593632 10:131609431-131609453 GCACAGGCCACATGGGAAAGGGG + Intergenic
1078015363 11:7608890-7608912 GCACAGGCTACTTGGCCACTAGG - Intronic
1078115784 11:8448838-8448860 GCACAGGCAACCTACGGAATGGG + Intronic
1082652929 11:55816898-55816920 GCTCAGGAGACTGGGGCAATAGG + Intergenic
1089890290 11:121873988-121874010 GCACAGGCATCTTGAGAACTTGG - Intergenic
1090012041 11:123053918-123053940 TCTCAGGATACTTGGGCAATGGG - Intergenic
1091502295 12:1030100-1030122 GTACAGACAACTTGGGCCATGGG - Intronic
1093716093 12:22383708-22383730 GAACAGGCAACCTACGCAATGGG + Intronic
1096445302 12:51685047-51685069 GCAGTGGCAACTTGGTGAATTGG + Intronic
1102328753 12:112012103-112012125 GCACAGGCATGTTGGGGAACTGG - Intronic
1107448393 13:40487839-40487861 GTAAAGGCAACTTAGGAAATGGG + Intergenic
1108106747 13:47018902-47018924 GAACAGGCAACCTACGCAATGGG - Intergenic
1108710513 13:53028322-53028344 TCAACGACAACTTGGGCAATAGG + Intergenic
1108989245 13:56633973-56633995 GAACAGGCAACTTGCAGAATGGG + Intergenic
1109957009 13:69581705-69581727 GCACAGGGATCATGGGCAAGAGG - Intergenic
1110184462 13:72656950-72656972 GGACAGGCAGCCTGGGGAATTGG + Intergenic
1112046549 13:95603536-95603558 GCCCAGGCAACCTAAGCAATTGG + Intronic
1115805911 14:37051548-37051570 GCACAGGCAACTTGGGCAATTGG + Intronic
1117324730 14:54658594-54658616 TCACAGTCAACTTGTGCAACAGG + Intronic
1120814245 14:88837292-88837314 GGACAGGCAAAGTGGACAATAGG - Intronic
1121580056 14:95023404-95023426 GCACATGCACCTTGGGCCCTTGG - Intergenic
1125137350 15:36358981-36359003 GCATATGCAACATGGGCATTTGG - Intergenic
1127970723 15:63958289-63958311 GAACAGGCAACTTGCAGAATGGG - Intronic
1130662034 15:85838448-85838470 GCACAGGCTACCTGGGCAGGGGG - Intergenic
1130845826 15:87744509-87744531 GCACAGGCCACTTGGGAAAGTGG - Intergenic
1136363845 16:29799352-29799374 GCACAGGCAACAAGGGCCTTCGG + Exonic
1137510257 16:49093402-49093424 GCACAGGCAAATTAAGTAATTGG - Intergenic
1137793934 16:51198907-51198929 GCACTGACAACTTGCGCAGTGGG + Intergenic
1141704984 16:85659883-85659905 CCACAGGCCACTTGGGCAGTGGG + Intronic
1144745790 17:17613418-17613440 GCACAGGCCACTGGGTTAATGGG + Intergenic
1148586190 17:48782475-48782497 GAAAAGGCAACTTGGGCAATGGG - Intronic
1151010052 17:70483876-70483898 GCACATGCCACTTGGTCCATGGG + Intergenic
1151292278 17:73159182-73159204 GCACAGGCAACTCTGGGAAATGG - Intergenic
1152460371 17:80439150-80439172 GCACAGGCAACCAGGGCCCTGGG + Intergenic
1152691432 17:81719902-81719924 GCAGTGGCGGCTTGGGCAATGGG + Intronic
1152896061 17:82912064-82912086 GCAGAGGCAGCTGGGGCAGTGGG + Intronic
1157289405 18:46399268-46399290 GCTCCGGCAGCTTGGGCAAAAGG + Intronic
1157714443 18:49873773-49873795 GCAAAGTCACCTTGGCCAATAGG - Intronic
1158552802 18:58450932-58450954 GTACAAGCATCTTGAGCAATGGG - Intergenic
1160948875 19:1656191-1656213 GCACGGGCAGCTGGGGCGATCGG + Intergenic
1162726207 19:12691006-12691028 ATACAGGCAACTTGGGCAGCGGG - Intronic
1163325911 19:16603142-16603164 GCACAGGCCACTGAGGCAAACGG + Intronic
1163643027 19:18472621-18472643 TCACAGGCTGCTTGGGCAATGGG - Intronic
1166346216 19:42167789-42167811 CCATAGGCAATATGGGCAATGGG - Intronic
1166592081 19:44008482-44008504 GCTGGGGCAACTGGGGCAATTGG + Intronic
1202703741 1_KI270713v1_random:5775-5797 GGACAGTCAGCTTGGGGAATCGG + Intergenic
926141311 2:10370196-10370218 GCAGAGGCGATTTGGGGAATGGG - Intronic
930033835 2:47073636-47073658 GCACAGGCATCTTGGCAACTGGG - Intronic
930482850 2:51971302-51971324 GCTCATGCAAATGGGGCAATTGG + Intergenic
937009459 2:118549255-118549277 GCACAAGCAACTTGGGGATCAGG + Intergenic
937591770 2:123622011-123622033 GCACAGGCAACTAAAGCAAAAGG + Intergenic
937845787 2:126577287-126577309 GCACAGACAACCTTGGCAATGGG + Intergenic
938158938 2:128966549-128966571 GAACAGGCAACTTAGAAAATGGG + Intergenic
938675463 2:133629192-133629214 GAACAGGCAACTTACACAATGGG + Intergenic
939800871 2:146706207-146706229 GCACAGGCAACTAAGGCAAATGG + Intergenic
940252165 2:151691004-151691026 CCAGAGGCAACTTGGGAAGTGGG - Intronic
941655413 2:168138530-168138552 GCACAGGCTAGTTGGGAAAGCGG + Intronic
943240686 2:185379712-185379734 GAACAGGCAACTTATGGAATGGG + Intergenic
943315904 2:186386881-186386903 GCAGAGGCAACTTTGGTACTGGG - Intergenic
943342880 2:186701955-186701977 GCTAAGGCAACTTGGACAAAAGG - Intronic
947543019 2:230991373-230991395 CCACATGCAACTTGGGGCATCGG + Intergenic
947870909 2:233437408-233437430 GCACAGGCCAAGTGGGCACTTGG - Exonic
948148076 2:235723571-235723593 TCACAGGCACCCTGGGCCATGGG + Intronic
948672376 2:239576656-239576678 GCACAGGGAAGTTGGGGAAGGGG + Intergenic
1181911784 22:26244211-26244233 GCACATGCAACTTGGGTGATGGG - Intronic
1184516767 22:44966954-44966976 ACACAGGGGACTTGGCCAATGGG - Intronic
951833340 3:26954574-26954596 GAACAGGCAACCTGTGAAATAGG - Intergenic
956497565 3:69844677-69844699 GAACAGGCAACTTATGGAATGGG + Intronic
957704694 3:83765415-83765437 ACAGATGCAACTTGGTCAATTGG - Intergenic
958093114 3:88903133-88903155 GAACAGGCAACCTGCGGAATAGG - Intergenic
958410148 3:93806383-93806405 GCACAGGCAACCTAGAGAATGGG - Intergenic
959014148 3:101113522-101113544 GAACAGGCAACCTGCACAATGGG + Intergenic
962362132 3:134751538-134751560 GCTCAGGCAACTGGAGCCATGGG + Intronic
962953441 3:140242711-140242733 ACACAGGCATCCTGGGGAATGGG - Intronic
963748560 3:149150506-149150528 TCACAGGCAAACAGGGCAATGGG - Intronic
963999605 3:151753959-151753981 TCACAGGGCACTTGGGAAATGGG + Intronic
964186612 3:153952709-153952731 GCAGATGCAACTGGGGCAATGGG + Intergenic
965090638 3:164158394-164158416 GAACAGGCAACCTAGACAATGGG - Intergenic
966473159 3:180315129-180315151 GCAAATGAAACTTAGGCAATGGG + Intergenic
969126512 4:4952401-4952423 GCACAGGAAACTTGGGGCAACGG - Intergenic
970591541 4:17564359-17564381 GCTCAAGCAACAAGGGCAATGGG + Intergenic
977779075 4:100958874-100958896 CTACAGGCAACTTTGGCAACTGG + Intergenic
978108739 4:104935588-104935610 GTACAGGCAACCTACGCAATGGG + Intergenic
978590203 4:110316424-110316446 GCTCAGGCATCCTGGGCAGTGGG + Intergenic
980626039 4:135375833-135375855 GAACAGGCAACTTACGGAATGGG - Intergenic
981406438 4:144375110-144375132 ACACAGCCAAGTTGAGCAATTGG - Intergenic
982609427 4:157554775-157554797 ACACAGGCAATTTGGGAATTAGG + Intergenic
986464623 5:8008626-8008648 GGCCAGGCATCTTGGGCCATGGG + Intergenic
986578664 5:9239993-9240015 GCAAAGGCTATTTGGGCATTAGG - Intronic
987084791 5:14458385-14458407 GCACAGGTAACCTAGGCACTGGG - Intronic
987968223 5:24905160-24905182 GCAGAAGCAACTTGAGCAGTAGG - Intergenic
995206113 5:109483197-109483219 GCAGAGGCAACTGGGAAAATTGG + Intergenic
999911119 5:156200630-156200652 GCACAGGCAACAAGAGAAATTGG + Intronic
1001925822 5:175636047-175636069 GAACAGGCAACCTGCGGAATGGG + Intergenic
1003338473 6:5197289-5197311 GCACAGCCAACTCAGGCACTTGG - Intronic
1009809111 6:68638062-68638084 GCAAAGGCAAGTGGGGCATTTGG + Intronic
1014387801 6:120822908-120822930 GAACAGGCAACCTGGAAAATGGG + Intergenic
1015787219 6:136930306-136930328 GCAGAGGCCACTGGGGCCATTGG - Intergenic
1017987638 6:159457972-159457994 GAACAGGCAACTTACACAATGGG - Intergenic
1018325645 6:162664818-162664840 GCACAGGCAACCTAGAGAATGGG - Intronic
1019623467 7:2003651-2003673 GCACAGGGGTGTTGGGCAATGGG - Intronic
1021979424 7:26040103-26040125 CCACAGGCACCTTGGGAGATTGG + Intergenic
1024656051 7:51452101-51452123 GTACATGCAAATGGGGCAATGGG - Intergenic
1029836178 7:103313593-103313615 GCACTGGTACCTTGGGCACTTGG - Intronic
1030333141 7:108294629-108294651 ACACAGACTACTTGTGCAATGGG + Intronic
1030747413 7:113184073-113184095 GCACAGGCTACATTGTCAATGGG - Intergenic
1031104018 7:117517083-117517105 GAACAGGCAACTTACGGAATGGG + Intronic
1032305828 7:130732467-130732489 GCAGAGGTAGCTGGGGCAATTGG + Exonic
1035225376 7:157429648-157429670 GCAGAGGCACCATGGGCAGTGGG + Intergenic
1037912625 8:22752985-22753007 GGAAACTCAACTTGGGCAATGGG - Intronic
1040541330 8:48359535-48359557 GCACAGACAATCTGGGAAATAGG + Intergenic
1040705686 8:50123896-50123918 GCAAAGTCACCTTGGGAAATGGG - Intronic
1043277652 8:78420122-78420144 GCACAGACAACATGAGGAATGGG + Intergenic
1043312023 8:78872507-78872529 GAACAGGCAACCTGCGGAATGGG - Intergenic
1045325867 8:101117286-101117308 GCACAAGAAACTTGGACAAGAGG - Intergenic
1045570735 8:103366729-103366751 GAACAGGCAACCTAGGGAATGGG - Intergenic
1047054572 8:121149909-121149931 GAACAGGCAACTTACACAATGGG + Intergenic
1047276980 8:123413267-123413289 GCAGAGGTAATTTGGGCATTTGG - Intronic
1050078924 9:1894315-1894337 GCAGGGGCAACTTAGGGAATAGG - Intergenic
1050879188 9:10678001-10678023 GCACAGGCTACGAGGGCAAGTGG + Intergenic
1051319487 9:15886187-15886209 GGAAAGGCAACTTGTGGAATAGG + Intronic
1054916352 9:70498369-70498391 ACGCAGGCAACTTGGGGCATTGG - Intergenic
1056101928 9:83308190-83308212 GCATAGGCAACCTGGACAACTGG + Intronic
1058814120 9:108668126-108668148 GCACAGGTAACATGGGCAATGGG + Intergenic
1059326184 9:113505259-113505281 GCCCAGACAACTTGAGCACTGGG - Intronic
1059872402 9:118592595-118592617 ACATAGGCAACTTGTGCAAAGGG - Intergenic
1060026235 9:120174366-120174388 GCACCGGGACCTTGGGCAAGTGG + Intergenic
1062311252 9:135938689-135938711 CCACAGGCAAGCTGGGCACTTGG - Intronic
1190755067 X:53394545-53394567 GCAGGGGCAACTTGGGGTATGGG + Intronic
1191704090 X:64075346-64075368 GCACAGGCAACTAAAGCAAATGG + Intergenic
1192963625 X:76154662-76154684 GCACAGGCAACCTACACAATGGG + Intergenic
1193622813 X:83777524-83777546 GCACAGGCAACCTACGGAATGGG - Intergenic
1195198713 X:102525147-102525169 GCACAGGCAACCTACACAATGGG + Intergenic
1195808779 X:108805564-108805586 GAACAGGCAACCTGCGGAATGGG + Intergenic
1198624024 X:138548643-138548665 GCACCTGCACCTTTGGCAATGGG - Intergenic
1199805348 X:151294358-151294380 GGACAGCCAACTTGGGCTAAAGG - Intergenic
1200101426 X:153690656-153690678 GCACAGCGAACTTGGGGAAGCGG + Intronic
1200358811 X:155580026-155580048 GCACAGACAACCTGGAGAATGGG + Intronic