ID: 1115807510

View in Genome Browser
Species Human (GRCh38)
Location 14:37068166-37068188
Sequence CCGGGAATAAGGAGCTCCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 42}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115807504_1115807510 2 Left 1115807504 14:37068141-37068163 CCACATTGTGGACTTGTCCATCA 0: 1
1: 0
2: 1
3: 6
4: 101
Right 1115807510 14:37068166-37068188 CCGGGAATAAGGAGCTCCGAAGG 0: 1
1: 0
2: 0
3: 2
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115807510 Original CRISPR CCGGGAATAAGGAGCTCCGA AGG Intronic
900595500 1:3478488-3478510 CCGGGCAGAGGGAGCTCAGACGG - Exonic
910483488 1:87684161-87684183 TCTGGAATAAGGAGCTCAGGAGG + Intergenic
919086895 1:192931149-192931171 CAGGGAAAGAGGAGCTCAGAAGG - Intergenic
919727676 1:200894734-200894756 CAGGGAAAAAGGGGCTCCCATGG - Intronic
1064438805 10:15334356-15334378 CTGGGAATCAGGAGATCTGAGGG + Intronic
1067439893 10:46302647-46302669 CCAGGAATAGGGAGGTCAGAGGG + Intronic
1069953012 10:72032472-72032494 ACAGGAATAAGGTGCTCCGGGGG - Intergenic
1075311704 10:121419837-121419859 GCGTGGGTAAGGAGCTCCGAGGG + Intergenic
1078462996 11:11529486-11529508 CCGAGAATAAGGAGAGCAGATGG - Intronic
1096942711 12:55365290-55365312 CCAGGAATGAGAAGTTCCGAAGG - Exonic
1104633605 12:130424615-130424637 CCGGGAACCAGGAGCCCCGAGGG + Intronic
1107456896 13:40563516-40563538 CCGGGAATCTGGGGCTCCGGTGG - Intronic
1108298957 13:49054807-49054829 CTGGGAAGCAGGACCTCCGAGGG - Intronic
1115807510 14:37068166-37068188 CCGGGAATAAGGAGCTCCGAAGG + Intronic
1121508307 14:94493211-94493233 CCAGAAATAATGAGCTCAGAAGG + Intronic
1127354018 15:58180950-58180972 CTGGGAATAAGGAGATCCTTAGG - Intronic
1138180440 16:54937308-54937330 CCAGGAATAAGCAGCCCGGAGGG - Intergenic
1152967995 18:134278-134300 CCCGGAAAAAAGAGCTCTGAGGG - Intergenic
1167702271 19:51056502-51056524 CTGGGAATAAGGAGCAGAGAAGG + Intronic
928089291 2:28364164-28364186 CCGGGAATCAGCAGCTGCAAAGG - Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
939663296 2:144917880-144917902 TCGAGAATAAGGAGCTAGGAAGG - Intergenic
948197993 2:236109283-236109305 CCGGGAATGAGGTGCTCGGCAGG - Intronic
1175714838 20:61248320-61248342 CCGAGAGAAAGGAGCTCCGGAGG + Intergenic
1179494545 21:41763545-41763567 CAGGTAACAAAGAGCTCCGAAGG + Intronic
1181286167 22:21753999-21754021 CCTGGCAAAAGGAGCTCCAAAGG - Intergenic
950190699 3:10974354-10974376 CAGGGAATAAGGAGCGCAGCGGG - Intergenic
956852038 3:73237756-73237778 CCGAGAATAAGGAGCACTGTAGG + Intergenic
960997978 3:123352024-123352046 CTGGGATTAAGGTGCTCCGCAGG - Intronic
964053304 3:152421454-152421476 CCGGGACTAAGGAGCTTGGTTGG + Intronic
971240590 4:24885199-24885221 CCAGCAGTCAGGAGCTCCGAGGG + Intronic
975567906 4:75779216-75779238 CAGGGAATAGGGAGGCCCGAGGG - Intronic
976252673 4:83069208-83069230 GTGGGAATAAGGAGCTGGGAAGG - Intronic
998375617 5:141688669-141688691 CCAGGAATATGGAGCCCTGAAGG + Intergenic
1000457617 5:161471165-161471187 CTGGGAATAAGGATTTCTGAAGG + Intronic
1003034753 6:2632957-2632979 CCGGGAGGAAGGAGCTGGGAGGG - Intronic
1003271769 6:4613827-4613849 CTGGAAATAAGGACCTGCGAGGG + Intergenic
1009669010 6:66721066-66721088 CAAGGAATATGGAGCTCCAAAGG - Intergenic
1019914190 7:4122005-4122027 GCTGGAATAACGAGCTCCCAGGG + Intronic
1024716953 7:52089871-52089893 CAGGGAATAGGGGGCTCCGAAGG + Intergenic
1028366980 7:90043696-90043718 CAGGGAATAGGGAGATCTGAGGG - Intergenic
1045038686 8:98199484-98199506 CAGGGAATAAGGAGGCCCAAGGG + Intronic
1055110285 9:72552445-72552467 CAGGCAATAAGCAGCTCAGAAGG - Intronic
1058223635 9:102333472-102333494 CAGGGAATAGGGAGGTCCAAAGG + Intergenic
1200212669 X:154353781-154353803 CCTGCACTGAGGAGCTCCGATGG + Intronic