ID: 1115808654

View in Genome Browser
Species Human (GRCh38)
Location 14:37080623-37080645
Sequence ACTACTACTTAGTACTTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 85}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115808650_1115808654 9 Left 1115808650 14:37080591-37080613 CCCTGCCTCAAAAACAAACAAAC 0: 27
1: 535
2: 856
3: 2858
4: 24829
Right 1115808654 14:37080623-37080645 ACTACTACTTAGTACTTGGTAGG 0: 1
1: 0
2: 0
3: 6
4: 85
1115808649_1115808654 28 Left 1115808649 14:37080572-37080594 CCTGGGTGACAGAGCAAGACCCT 0: 4209
1: 20933
2: 63781
3: 122612
4: 173503
Right 1115808654 14:37080623-37080645 ACTACTACTTAGTACTTGGTAGG 0: 1
1: 0
2: 0
3: 6
4: 85
1115808652_1115808654 4 Left 1115808652 14:37080596-37080618 CCTCAAAAACAAACAAACAAGAA 0: 3
1: 87
2: 446
3: 1797
4: 12106
Right 1115808654 14:37080623-37080645 ACTACTACTTAGTACTTGGTAGG 0: 1
1: 0
2: 0
3: 6
4: 85
1115808651_1115808654 8 Left 1115808651 14:37080592-37080614 CCTGCCTCAAAAACAAACAAACA 0: 26
1: 540
2: 848
3: 2803
4: 24612
Right 1115808654 14:37080623-37080645 ACTACTACTTAGTACTTGGTAGG 0: 1
1: 0
2: 0
3: 6
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115808654 Original CRISPR ACTACTACTTAGTACTTGGT AGG Intronic
903723336 1:25422480-25422502 ACTGTTACTAAGTACTTGCTAGG + Intronic
905115781 1:35639479-35639501 ATTACTAGTTAGTAGTAGGTTGG - Intronic
908578884 1:65492418-65492440 ACTAATACCTAGTACCTAGTAGG - Intronic
909098430 1:71319352-71319374 GCTACCAATTAGTACTTGGAAGG - Intergenic
910035936 1:82788910-82788932 ACTACTCCCTAGTACATGGGAGG + Intergenic
911299886 1:96158887-96158909 ACAACTACTTTTTCCTTGGTAGG + Intergenic
915928745 1:160044347-160044369 ACTACTACTGAGTACTAAATAGG - Intronic
918371998 1:183870233-183870255 ACTGCTACGTAGTACCTGGACGG + Intronic
920688685 1:208129379-208129401 GCTACAACATAGAACTTGGTAGG - Intronic
921264220 1:213409194-213409216 CCTAATACTTTGCACTTGGTTGG - Intergenic
1067964576 10:50895529-50895551 AACACTACTAAGTACCTGGTAGG + Intergenic
1071964979 10:90843240-90843262 CATAGTACTTTGTACTTGGTAGG - Intronic
1073241622 10:102062638-102062660 CCTACTTCTTAGTATTTGGTGGG + Intergenic
1078045094 11:7906373-7906395 ACTATGACTTAATACTTGCTTGG + Intergenic
1079970294 11:27028320-27028342 ACTTTTTCTTAGTAATTGGTAGG + Intergenic
1079981179 11:27153109-27153131 ATTTATACTCAGTACTTGGTGGG - Intergenic
1080448349 11:32357856-32357878 ACTTCTACTTAGTAGTTGTAAGG - Intergenic
1085335526 11:75691150-75691172 TCTAGTTCTTAATACTTGGTAGG + Intergenic
1088398225 11:109392280-109392302 AATATTTCTTAGTATTTGGTAGG - Intergenic
1088690120 11:112319263-112319285 CATCCTGCTTAGTACTTGGTGGG + Intergenic
1091678933 12:2512393-2512415 ACTACCACTCAATACTGGGTGGG + Intronic
1092104774 12:5913563-5913585 ACTACTATAAAGTGCTTGGTTGG + Intronic
1093099739 12:15013492-15013514 ATTTCTACTTAGTATTTGGGGGG + Intergenic
1093934992 12:24990915-24990937 ACAAATACTGAGTACTTGGTAGG - Intergenic
1099191796 12:79568943-79568965 AGTGCTATTAAGTACTTGGTGGG - Intergenic
1100482061 12:94988697-94988719 ACTGCTACATAGTACCTGGACGG - Intronic
1100547392 12:95616111-95616133 GCTATTACTTGGTGCTTGGTAGG + Intergenic
1102859024 12:116319405-116319427 ACAACCATTAAGTACTTGGTTGG + Intergenic
1104031884 12:125070731-125070753 ACTACTACCACCTACTTGGTAGG - Intronic
1106750208 13:32756412-32756434 ACTCCTACTTATTACTTAATTGG + Intronic
1107700134 13:43038957-43038979 TCTACAACTTATTACTAGGTAGG - Intronic
1107720289 13:43241371-43241393 ACTTCTACTTTGTAATTGCTAGG - Intronic
1115808654 14:37080623-37080645 ACTACTACTTAGTACTTGGTAGG + Intronic
1123910813 15:24965175-24965197 AATACTACTTATGATTTGGTAGG - Intronic
1124656424 15:31512747-31512769 ACTATGACTTAGTGCTTGCTTGG + Intronic
1130743992 15:86631042-86631064 ACTGCTACTTGGTACCTGGAAGG + Intronic
1135729454 16:24882178-24882200 CCTACCACGTAGAACTTGGTGGG + Intronic
1136089049 16:27905255-27905277 ACTTCTACTGAGCACTTGGCTGG + Intronic
1137954559 16:52815792-52815814 AATACTACTTATGCCTTGGTTGG - Intergenic
1138821656 16:60267417-60267439 AATACTACTAATTACTTGGTAGG + Intergenic
1158191661 18:54835908-54835930 AATACTAATGAGTACTTGCTGGG - Intronic
1159601381 18:70431444-70431466 AAGATTACTTAGTACTAGGTGGG - Intergenic
926446288 2:12946734-12946756 CCTCATACTTGGTACTTGGTAGG - Intergenic
927541445 2:23915101-23915123 CCTGCTACATAGTACTTTGTAGG - Intronic
930533044 2:52614108-52614130 ACTGCTACCTAGTACCTGGATGG - Intergenic
935577041 2:104722031-104722053 AGTGTTACTCAGTACTTGGTTGG - Intergenic
947413818 2:229871895-229871917 AGTACTAGTTAGTACTAGCTAGG - Intronic
1177935641 21:27342303-27342325 AATACTACTAATTACTTTGTAGG + Intergenic
957148406 3:76453814-76453836 GTTACTATTTGGTACTTGGTAGG + Intronic
957446618 3:80320550-80320572 ACTACAACTTAATAAGTGGTGGG + Intergenic
961125970 3:124418007-124418029 ACTACTATTGAGAACTTGCTAGG - Intronic
963933013 3:151023833-151023855 ACTAGTACTTTGTATATGGTTGG - Intergenic
965871790 3:173274246-173274268 ACTGCTACGTAGTACCTGGACGG - Intergenic
965882266 3:173400015-173400037 ACTACAAATTAGTATTTGTTAGG - Intronic
965952252 3:174324617-174324639 ACCACTGCTTAATACTGGGTTGG + Intergenic
967420954 3:189272093-189272115 AGTACAACTTAGTTCTTGATGGG + Intronic
971780205 4:31023910-31023932 TCTACTACTTTGTCCTTGCTGGG - Intronic
975830834 4:78366805-78366827 AGTACTAGTAAGTACTTTGTGGG + Intronic
976538646 4:86246901-86246923 AATACCATTTAGTACTTGGTAGG - Intronic
980419026 4:132535476-132535498 ACTACTACTAATTTCTGGGTTGG - Intergenic
981110416 4:140928012-140928034 ACTAATACATACTACTTGGAAGG + Intronic
985392941 4:189510913-189510935 ACTACTACTTAGTTCTAAGCTGG + Intergenic
986367065 5:7042947-7042969 ACTACTCCTTACTACTGTGTAGG + Intergenic
989436781 5:41422836-41422858 ACTGCTATTTAGCACTGGGTTGG - Intronic
993364066 5:87014496-87014518 AATACTACATAGTAATTGATAGG - Intergenic
994023387 5:95053688-95053710 CCTACTGCTTGGTACCTGGTAGG - Intronic
994733391 5:103521811-103521833 AGTGGTACTTTGTACTTGGTGGG - Intergenic
1004397334 6:15256918-15256940 AGTACTACTTAGTAGTGGGAGGG + Intronic
1004945514 6:20608356-20608378 ACTACTTTTTAGTACTTTTTAGG + Intronic
1006053435 6:31361683-31361705 ACTAAGACTTAATACTTGGGTGG + Intergenic
1010193787 6:73220591-73220613 TGTACTACTTGGTACATGGTAGG - Intronic
1011790771 6:90895980-90896002 CCTACTACTGAGTACTCAGTGGG + Intergenic
1013044341 6:106469547-106469569 AGGACTACTTAATACTTAGTAGG + Intergenic
1014573711 6:123044270-123044292 ATTATTACTTTGTACTTTGTAGG + Intronic
1023742393 7:43292545-43292567 ACTTGTGCTTAGTCCTTGGTGGG - Intronic
1029299646 7:99569690-99569712 AGTTTTACTAAGTACTTGGTAGG - Intronic
1030478206 7:110065491-110065513 ACAGCTACTTAGTACAAGGTAGG + Intergenic
1031454540 7:121963103-121963125 AATAGTACTTAGTACCTTGTGGG - Intronic
1034755795 7:153618021-153618043 ACTACTCCTGAGTACATGGTTGG + Intergenic
1036516506 8:9449383-9449405 ACTACTACTTTGTATTTGCATGG - Intergenic
1041187851 8:55320447-55320469 GCTACTACTCAGAGCTTGGTTGG - Intronic
1041963114 8:63642826-63642848 AGTTCTCCTTAGTTCTTGGTTGG + Intergenic
1043296815 8:78674172-78674194 AATATTACTTAGTACATGCTTGG + Intronic
1046525398 8:115376427-115376449 CCTACTACAAAGTATTTGGTGGG + Intergenic
1048426599 8:134329200-134329222 TCTTCTAATTAGTACTTGGAGGG - Intergenic
1048863537 8:138741768-138741790 ACTATTACTAAGTACTTTGTGGG - Intronic
1048959712 8:139566065-139566087 CCTCCTTCTTAGTACTTAGTTGG + Intergenic
1051682135 9:19618188-19618210 ACAACTGCTTAGTAGTTGGGAGG + Intronic
1053091742 9:35284783-35284805 ACTACAATTTAGTAGTTGATAGG + Intronic
1057576469 9:96246616-96246638 ACTGCTACTTAGTTCCTTGTCGG - Intronic
1193809359 X:86033826-86033848 ACTAATATTTAGTATTTTGTGGG - Intronic
1197631250 X:128862072-128862094 ATTACTAGTTAGTACTTCCTTGG - Intergenic