ID: 1115811640

View in Genome Browser
Species Human (GRCh38)
Location 14:37115426-37115448
Sequence ACATGAGGACGGCCCCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 81}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115811640 Original CRISPR ACATGAGGACGGCCCCTGCA TGG Intronic
902223533 1:14982000-14982022 AAATGAGGCTGTCCCCTGCATGG + Intronic
908275350 1:62465009-62465031 ACATAAACACGGACCCTGCATGG + Intronic
915762708 1:158331040-158331062 AAAGGAGGTCGGCCCCTGGAAGG + Exonic
917931327 1:179824649-179824671 CCAGGAGGGCGGTCCCTGCAGGG - Intergenic
1062827065 10:578654-578676 ACAGGAATAGGGCCCCTGCAGGG - Intronic
1071154639 10:82674861-82674883 ACATGAGGCCGGCCACACCATGG + Intronic
1072806089 10:98424755-98424777 CCGTGAGGCCGCCCCCTGCATGG - Intronic
1075780181 10:125012340-125012362 ACACGGGGACGGTCCCTGCAGGG + Intronic
1077848491 11:6051124-6051146 CTAAGAGGAGGGCCCCTGCAAGG - Intergenic
1080741013 11:35064333-35064355 AAATGAGCAGGGCCCCTGCTGGG + Intergenic
1085034841 11:73293576-73293598 CCTTGAGGCCGGCCCCTGCCAGG + Intronic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1090203889 11:124874543-124874565 AGATGAAGATGGCCCCTCCATGG - Intronic
1090541569 11:127711869-127711891 ACATGCGCATGGCCCCTTCATGG - Intergenic
1096408736 12:51362252-51362274 CCATGAGGACAAACCCTGCATGG + Intronic
1102936020 12:116897715-116897737 AGATGTGGACTGCCCCTGGAAGG - Intergenic
1104050858 12:125192730-125192752 AGATGTGGAAGGCCCCTGGAAGG + Intronic
1107715270 13:43193567-43193589 ATATGAGGAGGGGCCCTGCCTGG + Intergenic
1115811640 14:37115426-37115448 ACATGAGGACGGCCCCTGCATGG + Intronic
1118032439 14:61831908-61831930 ACATGAGGTGAACCCCTGCAGGG - Intergenic
1122259236 14:100502649-100502671 ACATGAGGTCCCTCCCTGCATGG + Intronic
1124853246 15:33361397-33361419 AAATGGAGACGGCCCATGCATGG - Intronic
1138567632 16:57845200-57845222 ACATGAAGGCTGCACCTGCAGGG - Intronic
1141463908 16:84194711-84194733 GCATCAGGACGTCACCTGCAGGG + Intronic
1141811679 16:86380223-86380245 ACTCCAGGACGGCCCCTCCAGGG - Intergenic
1141915852 16:87096579-87096601 ACATGGAGAAGGTCCCTGCAAGG - Intronic
1145927669 17:28659728-28659750 ATATGAGGAGGGCCTCTGCCCGG - Intronic
1151628742 17:75295317-75295339 ACATGAGGGCTGCACTTGCATGG - Intergenic
1151930633 17:77229627-77229649 ACAGTAGGACTGACCCTGCAGGG - Intergenic
1152791694 17:82283571-82283593 AAGTGAGCACGGCCTCTGCAGGG + Intergenic
1152981939 18:286613-286635 ACATGAGGACAGCGTTTGCATGG + Intergenic
1158562898 18:58530539-58530561 CCATGAAGCCGGCCACTGCATGG - Intronic
1161182691 19:2895493-2895515 ACATGAGGACAGGCCGGGCACGG + Intergenic
1162991756 19:14307392-14307414 ACATGAGAACAGCCCATGCAAGG - Intergenic
1163617747 19:18339965-18339987 ACAGGAGGAGGGCCCCTGGGAGG + Intergenic
1166978703 19:46620460-46620482 ACATGAGGTCAGGCTCTGCAAGG + Exonic
926061156 2:9806024-9806046 AAATGAAGACAGCCACTGCAGGG - Intergenic
926139400 2:10359447-10359469 CCATGAGGCCGGGGCCTGCAGGG - Intronic
927147708 2:20177902-20177924 ACAGGAGGACTGTCCCTGGAAGG + Intergenic
928632470 2:33208193-33208215 AGGTGAGGATGGCACCTGCATGG + Intronic
942498587 2:176564726-176564748 AAATGAGAATGGCCACTGCATGG + Intergenic
942873320 2:180762504-180762526 GCATAAGGACAGCCTCTGCATGG + Intergenic
1170609874 20:17903804-17903826 AGATTAGCATGGCCCCTGCAAGG + Intergenic
1171337197 20:24395213-24395235 ACATGAGGACCGCCCTGCCAAGG + Intergenic
1171413072 20:24959554-24959576 CCATGAGGACCACCCCTCCACGG + Intronic
1171498159 20:25572100-25572122 ACATGAGGACAGACCCTGCAGGG + Intronic
1172670655 20:36632616-36632638 GGATGAGGAAGGCCCCTCCAGGG + Exonic
1172759953 20:37314840-37314862 AGAAGAGGAGGGCCCATGCAGGG - Intronic
1173758033 20:45535291-45535313 ACAGGAGGCTGGCCCCTGCCTGG - Intronic
1174278995 20:49424871-49424893 ACAGGAGCAGGCCCCCTGCACGG + Intronic
1175300735 20:57941041-57941063 ACATGAGCACAGCCCATGTATGG - Intergenic
1175949420 20:62575303-62575325 GCATGAGGAGGGCCCCTCCAGGG + Intergenic
1175993594 20:62802129-62802151 GCATGAGGCTGGCCCGTGCACGG + Intergenic
1176217950 20:63957084-63957106 ACACGGGGACGGCCCCTCCCGGG + Exonic
1179183114 21:39062037-39062059 AGGTGAGGTCGGCCCATGCATGG - Intergenic
1181934553 22:26429403-26429425 ACCCGCGGACGGCCCCTGCCCGG - Exonic
1185046581 22:48531507-48531529 ACATGTCGACTGCACCTGCAGGG - Intronic
1185215740 22:49599078-49599100 TAATGACGACGGCCCCTCCACGG + Intronic
1185258922 22:49850751-49850773 ACATGAGGGCGAACCCTCCAGGG + Intergenic
950615187 3:14152495-14152517 ACCTGAGGAGGGAGCCTGCAGGG - Intronic
956783600 3:72624050-72624072 ACAAGAGAAGGGGCCCTGCAAGG - Intergenic
961190605 3:124958073-124958095 TCATGAGGCCAGCCTCTGCAAGG + Intergenic
962241769 3:133756244-133756266 ACATCAGCAGGGCTCCTGCAGGG - Intronic
962255165 3:133865522-133865544 TCATTAGGACGGGCCCTGCACGG + Intronic
966201021 3:177359690-177359712 CTAAGAGGAAGGCCCCTGCAGGG + Intergenic
979329436 4:119409117-119409139 ACTTGAGAACAGCCTCTGCAGGG - Intergenic
1001989418 5:176104003-176104025 ACATGAGCAGGCCCCTTGCACGG - Intronic
1002227454 5:177734135-177734157 ACATGAGCAGGCCCCTTGCACGG + Intronic
1002947809 6:1779550-1779572 ACATGAGGATTGTCTCTGCAGGG - Intronic
1006800861 6:36758889-36758911 ACTGGAGGACGCCCCCTCCACGG + Intronic
1017029282 6:150206631-150206653 GCATGAGGATGGTCCCTGCCGGG + Intronic
1019738466 7:2661624-2661646 GCATCAGCAGGGCCCCTGCATGG - Intronic
1029172451 7:98640607-98640629 CCATGAGGGCGCCCCCTGCTCGG - Intergenic
1034983464 7:155493017-155493039 AAATGAGGACGGCACCGGCCAGG + Intronic
1035006093 7:155662298-155662320 AGGTGAGGAGGGCCCCTGCTTGG - Intronic
1035099500 7:156384546-156384568 ACATGAGGACACCCCATCCAGGG - Intergenic
1035372632 7:158389036-158389058 ACGTGAGGCGGGCCCCTGGAAGG + Intronic
1039488697 8:37931426-37931448 CCCTGAGGATGGCTCCTGCAGGG - Intergenic
1039753478 8:40498137-40498159 ACATTAGGCCGGCCCTTGCTTGG + Intergenic
1049468880 8:142766518-142766540 CCAGGAGGACGGCCCGTGCTCGG + Intronic
1056519897 9:87390727-87390749 TCATGTGGACGTCCTCTGCATGG + Intergenic
1057269062 9:93636892-93636914 ACATGAGGACAACGCCTGCCTGG - Intronic
1059589617 9:115644534-115644556 ACATGAGTAATTCCCCTGCATGG + Intergenic
1061005944 9:127928469-127928491 CCGGGAGGGCGGCCCCTGCAGGG + Exonic
1061683834 9:132259012-132259034 ACATGTGGAGTGCCCCTGCCTGG - Intergenic
1062188433 9:135231095-135231117 GCATGAGGGGGGCTCCTGCAGGG - Intergenic
1062260752 9:135661991-135662013 ACATGATGCCGGTGCCTGCAAGG - Intergenic