ID: 1115813924

View in Genome Browser
Species Human (GRCh38)
Location 14:37142296-37142318
Sequence AAGAGCTACCACTCTGGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115813924_1115813926 -2 Left 1115813924 14:37142296-37142318 CCAACTCCAGAGTGGTAGCTCTT 0: 1
1: 0
2: 1
3: 13
4: 150
Right 1115813926 14:37142317-37142339 TTCATCACAGACTATCATCGAGG 0: 1
1: 0
2: 2
3: 3
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115813924 Original CRISPR AAGAGCTACCACTCTGGAGT TGG (reversed) Intronic
900577237 1:3389408-3389430 AAGAGCTATCCCTATGGCGTGGG + Intronic
900737868 1:4310438-4310460 TAGAGCTCCCAGTCTGGAGGGGG + Intergenic
903554717 1:24185241-24185263 AAGAGCTCGGACTTTGGAGTTGG - Intronic
906241500 1:44244999-44245021 AGGAGCTGCCAGCCTGGAGTGGG - Intronic
906275760 1:44514139-44514161 AAGAGCTCACAGTTTGGAGTGGG - Intronic
907304209 1:53504881-53504903 AGCAGCTCCCAGTCTGGAGTGGG + Intergenic
912895716 1:113586481-113586503 CAGAACTCACACTCTGGAGTGGG - Intronic
918458095 1:184746684-184746706 AAGAGCAAGAACTCTGGACTTGG - Intronic
920801148 1:209188648-209188670 GAGAGCTATCACTCTGGACCAGG - Intergenic
922672688 1:227523684-227523706 AACTGCTTCCACTGTGGAGTTGG - Intergenic
1063565598 10:7170564-7170586 AAGAGCCCCCACTGTAGAGTCGG + Intronic
1063738404 10:8789444-8789466 AAGAGCTATTACTCTGAAGATGG - Intergenic
1064069638 10:12216598-12216620 AACAGCTACCTCTGGGGAGTAGG - Intronic
1064881756 10:20063436-20063458 AAGAGCTAAGAATCTGGAGTGGG - Intronic
1065468285 10:26049141-26049163 AAGAGCCACCTCTGTAGAGTGGG + Intronic
1066366416 10:34781242-34781264 AAGAGATACCCCTCTGCAGGAGG + Intronic
1067283341 10:44889641-44889663 AAGACCTACCATGCTGGACTTGG + Intergenic
1069796540 10:71056278-71056300 CAAATGTACCACTCTGGAGTGGG + Intergenic
1069815005 10:71188234-71188256 CACAGCTACCACTCTGGACTTGG - Intergenic
1070715813 10:78720177-78720199 AGGAGCTTCCACTCTCAAGTTGG + Intergenic
1072743582 10:97924706-97924728 AATAGCTACCACTTTGGTGGGGG - Intronic
1077172716 11:1175140-1175162 AAGAGCTCCCGCTGTGGACTGGG + Intronic
1078627649 11:12972119-12972141 AACAGGTAGCACTCTGGATTTGG - Intergenic
1079771898 11:24473138-24473160 AAGAGCTCACAGTCTGGAGGAGG + Intergenic
1080850057 11:36060451-36060473 AAGAGCAACAACTCTGGAGTTGG - Intronic
1081406503 11:42704896-42704918 AAGAGCAAGGACTCTGTAGTAGG + Intergenic
1083087737 11:60168101-60168123 AAGAGGTAGCCCCCTGGAGTAGG + Intergenic
1083399141 11:62411847-62411869 ACCAACAACCACTCTGGAGTGGG + Intronic
1086093430 11:83026714-83026736 AAGAGCAGCCAATCTGGAGAAGG + Intronic
1089002637 11:115064840-115064862 AAGTGCTTGGACTCTGGAGTTGG - Intergenic
1090853659 11:130593065-130593087 AAGAGCTAGCACTTTGGTGATGG - Intergenic
1091846434 12:3659693-3659715 AGGAGCTACCGCTGTGGAGTAGG - Intronic
1092808822 12:12252769-12252791 AAGATTTAGCAGTCTGGAGTAGG - Intronic
1093398479 12:18713277-18713299 CAGAGCTACAACTATGGAGCAGG - Intronic
1095934825 12:47666623-47666645 AAGAGCTCAGACTATGGAGTTGG + Intronic
1096829384 12:54302290-54302312 GATAGGTGCCACTCTGGAGTAGG + Intronic
1102211268 12:111128926-111128948 AAAAGCTGCCAGTTTGGAGTGGG - Intronic
1102546147 12:113657238-113657260 AAGAGCTAGGACTTTGGAGTTGG - Intergenic
1111729740 13:92058457-92058479 AAAATGTACCACTCTGGTGTGGG - Intronic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112948053 13:104956094-104956116 AAGAGCTACCGTCCTGCAGTAGG + Intergenic
1115813924 14:37142296-37142318 AAGAGCTACCACTCTGGAGTTGG - Intronic
1118131722 14:62973050-62973072 CAGATGTACCACTCTGGTGTGGG + Intronic
1118492501 14:66274826-66274848 AAAAGCTAACACACTGAAGTTGG - Intergenic
1120431305 14:84419228-84419250 AAGAGCTCCTCCTCTGGAGCAGG + Intergenic
1120737894 14:88075897-88075919 AAAAGGTACCACTGTGGTGTAGG + Intergenic
1121626382 14:95388459-95388481 AAGAGCATGGACTCTGGAGTTGG - Intergenic
1129372762 15:75108567-75108589 AAGAGCTAGCAGTCAGGAGCAGG - Intronic
1129854551 15:78813899-78813921 TGGAGCTCCCACTCTGGAGGAGG + Intronic
1130814438 15:87416339-87416361 AAAAGGTAATACTCTGGAGTTGG - Intergenic
1135931511 16:26741835-26741857 AAGAGCTGAGAATCTGGAGTTGG - Intergenic
1141085101 16:81088377-81088399 AAGAGCTAGCAGTCTTGTGTGGG - Intronic
1142674747 17:1506841-1506863 AGGAGGTGCCACTCTGGAGAGGG + Intronic
1145973156 17:28968708-28968730 AAGAGCCAGCACTCTGGAGATGG - Intronic
1147617885 17:41841051-41841073 AATTGCTTGCACTCTGGAGTTGG + Intronic
1148218579 17:45847298-45847320 AGAAGCTGCCACTCTGGATTGGG - Intergenic
1151233258 17:72699979-72700001 CAGAAGTACCACTCTGGAGGAGG - Intronic
1151554117 17:74837925-74837947 TGGAGCTACCTCTCTGGGGTGGG + Exonic
1156868102 18:41911616-41911638 AAAAGCTACCACTCTAAACTTGG - Intergenic
1157098544 18:44709369-44709391 AAGAGCCTCCACTCTGGAAGTGG + Intronic
1157413714 18:47485081-47485103 GAGCGCTACCCCTCTGGAGGGGG + Intergenic
1158607038 18:58904926-58904948 AACTGCTAGAACTCTGGAGTCGG - Intronic
1158684784 18:59603653-59603675 AAGAGCAACAACTTTGTAGTAGG - Intronic
1162300933 19:9844566-9844588 AGGAGCTCCCAGTCTGGAGCAGG - Intronic
1162608823 19:11733278-11733300 AATAGCTAGAACTCAGGAGTCGG + Intronic
1163101642 19:15100890-15100912 AACAGAGACCACTCTGGAGGTGG + Intergenic
926843381 2:17106914-17106936 AAGAGCAACCACTTTGGACTTGG + Intergenic
926904666 2:17794554-17794576 AAGAGCTTCCTCTCTGAGGTTGG - Intronic
926958095 2:18323873-18323895 AAGTGCAAGCACTCTAGAGTTGG - Intronic
930326330 2:49923786-49923808 AAGAGCTACTACTTTGGAAATGG - Intronic
933748019 2:85584763-85584785 AAGAGCACCGACTTTGGAGTCGG + Intronic
935947534 2:108299965-108299987 AGGAGCTTCCACTCTAGTGTGGG - Intronic
937219367 2:120332972-120332994 AAGAGCTATCACAGTAGAGTGGG - Intergenic
937625417 2:124038042-124038064 AAGAGCTTACAGTCTGGATTTGG - Intronic
937635176 2:124147638-124147660 CAGCGCTACAGCTCTGGAGTGGG + Intronic
939291750 2:140204713-140204735 AAGAGATTCCAATCTGGACTGGG + Intergenic
939565966 2:143786810-143786832 AAGTGCTATCATTCTGCAGTTGG - Intergenic
940320792 2:152374243-152374265 AAGAATAACCACTCTGGGGTGGG + Intronic
940436587 2:153663757-153663779 AAGAGCTGTCTATCTGGAGTAGG + Intergenic
941034486 2:160553358-160553380 AAGAGCTACCACTCCGGGGCTGG + Intergenic
941309923 2:163914470-163914492 CAAAGCTACCACACTGGAGAAGG - Intergenic
943717286 2:191166242-191166264 ACAAGCTACCACTGTGCAGTTGG - Intergenic
943996606 2:194774941-194774963 CAAAGCTACAACTCTGGAGATGG - Intergenic
945483232 2:210366219-210366241 ATTAGCTACAATTCTGGAGTTGG - Intergenic
945592002 2:211745459-211745481 AAGAGCAAAAACCCTGGAGTGGG - Intronic
947093290 2:226537738-226537760 CAAATGTACCACTCTGGAGTAGG - Intergenic
947273109 2:228361497-228361519 AGAATCTACCACTATGGAGTTGG - Intergenic
948082347 2:235216588-235216610 CAGAACTCCCACTGTGGAGTGGG + Intergenic
948693966 2:239723418-239723440 AAGAGGTACCACTGTGGAGCTGG - Intergenic
1171340931 20:24428226-24428248 AAAATCCACCACTCTGGTGTGGG + Intergenic
1172935207 20:38615382-38615404 AAGAGCTACCTCATTGGGGTGGG - Intronic
1176284558 21:5012538-5012560 AACAGGTACCAGCCTGGAGTGGG - Intergenic
1176409079 21:6438007-6438029 AACAGCCACCCATCTGGAGTCGG + Intergenic
1179034642 21:37748949-37748971 TAGAGCTATCAACCTGGAGTAGG + Intronic
1179872623 21:44250937-44250959 AACAGGTACCAGCCTGGAGTGGG + Exonic
1179925623 21:44532695-44532717 AGGATCTACCACTGTGGAGCAGG - Intronic
1179954451 21:44730460-44730482 ACGAGCCACCACTTTGGGGTTGG - Intergenic
1182413178 22:30204274-30204296 AAGAGCCAGCACCCTGGAGTTGG + Intergenic
952991719 3:38836382-38836404 AAGAGCTGCCATTTTGGATTCGG + Intergenic
953057451 3:39399393-39399415 AAGAACTTAGACTCTGGAGTAGG + Intergenic
954214686 3:49117773-49117795 TCGAGCAACAACTCTGGAGTGGG + Exonic
956616464 3:71177547-71177569 AAGAGCTCAGGCTCTGGAGTCGG + Intronic
962061009 3:131927516-131927538 AAGAGCACCCAGTCTGGAGTAGG - Intronic
965052045 3:163663456-163663478 TGGAGCTACCATTCTGGGGTCGG - Intergenic
966689599 3:182729233-182729255 AAGAGCTACCACATTGTAGGAGG + Intergenic
967438005 3:189473554-189473576 AAGAGATAGTACTCTGGATTTGG + Intergenic
969660678 4:8525710-8525732 CAGAGCTGCCCCTCTGGAGCCGG - Intergenic
970141853 4:12991647-12991669 AAGAGATATCACTCTTGACTGGG + Intergenic
970579291 4:17460194-17460216 AAGAGCCAGTGCTCTGGAGTGGG - Intergenic
971514746 4:27471972-27471994 AAGAGCTATCATACTGGAGAAGG + Intergenic
972043864 4:34639374-34639396 TAGAGCACCCACCCTGGAGTGGG + Intergenic
978243662 4:106547395-106547417 CATAGGTACCACTCTGGTGTGGG + Intergenic
979479250 4:121196441-121196463 AAGAGCTAAAATTCTGGAATTGG + Intronic
980190311 4:129516737-129516759 AAGAGAATCCACTCTGGAGATGG + Intergenic
986470485 5:8068800-8068822 AAGAGCTAACACACGGGGGTTGG + Intergenic
988077267 5:26368284-26368306 ATGAGCTCCCTCTCTGGAGCAGG + Intergenic
993936794 5:94014166-94014188 ATGAACTACCACTCTTGATTCGG - Intronic
997370613 5:133357311-133357333 AAGTGCTTCCAGTCTGGAGGAGG - Intronic
997986070 5:138502480-138502502 AAGAGCACCGAATCTGGAGTTGG + Intergenic
999111805 5:149127906-149127928 AAGACCTACCTCTATGAAGTAGG + Intergenic
999373570 5:151070973-151070995 AAAATCTACCACTCTGGTGGAGG + Intronic
1001680938 5:173556392-173556414 AATTGCTACAACTCAGGAGTGGG - Intergenic
1001814795 5:174659366-174659388 AAGAGATTGCACTCTGGAGCTGG - Intergenic
1003702357 6:8481831-8481853 AAGAGCTACCTGTAAGGAGTAGG - Intergenic
1004248573 6:14003198-14003220 AAGAGTTACCACTGTGGCATGGG - Intergenic
1004269221 6:14179131-14179153 CAAAGCAACCACTCTGGAGTAGG - Intergenic
1008434372 6:51457685-51457707 AAGAGCTATCACTCTGGACCAGG - Intergenic
1008747000 6:54684208-54684230 AAGAGCTTTCTCTCTTGAGTGGG - Intergenic
1010191455 6:73201235-73201257 AGGAGCTCCCATCCTGGAGTGGG - Intergenic
1010244279 6:73648938-73648960 AAGAACTAACACTATTGAGTGGG + Intronic
1010913725 6:81589918-81589940 AAGAGCAAACATTCTGCAGTAGG - Intronic
1016727042 6:147383751-147383773 AAGAGCTACCACTACAGATTGGG - Intronic
1017239150 6:152147761-152147783 CAGAGCTTCCACTCTAGTGTGGG - Intronic
1030113796 7:106048353-106048375 ATGAGCCACCACTCTTTAGTTGG + Intergenic
1032757659 7:134906322-134906344 AAGAGCCCCCACTTTGGGGTTGG + Intronic
1035154786 7:156903607-156903629 CTCAGATACCACTCTGGAGTAGG + Intergenic
1036909773 8:12746809-12746831 AACAGCTAGAACTCTGGAGCTGG - Intronic
1039835140 8:41249964-41249986 AAGAGCCACCTCTCTGCGGTGGG - Intergenic
1045350920 8:101338886-101338908 AAAATGTACCACTCTGGTGTGGG - Intergenic
1045350965 8:101339199-101339221 AAAAGGTACCACTCTGGGCTGGG - Intergenic
1045755682 8:105538384-105538406 AAAATCTACCACTTTGGAATAGG - Intronic
1046106893 8:109677076-109677098 AAGAGCTAGAAATCTGTAGTTGG + Intronic
1048301165 8:133252488-133252510 CAGAGGCTCCACTCTGGAGTTGG - Intronic
1048301175 8:133252528-133252550 CAGAGACCCCACTCTGGAGTTGG - Intronic
1048301202 8:133252648-133252670 CAGAGGCCCCACTCTGGAGTTGG - Intronic
1048301212 8:133252688-133252710 TAGAGGCCCCACTCTGGAGTTGG - Intronic
1048301228 8:133252768-133252790 TAGAGCCTCCACTCTGGAGCTGG - Intronic
1048301236 8:133252808-133252830 TAGAGTCCCCACTCTGGAGTTGG - Intronic
1048301244 8:133252848-133252870 TAGAGGCCCCACTCTGGAGTTGG - Intronic
1049236419 8:141514585-141514607 AAGGGCCTCCACTCAGGAGTGGG - Intergenic
1050928138 9:11291798-11291820 AGGAAATACCATTCTGGAGTAGG - Intergenic
1052960401 9:34291262-34291284 GAGAGCTTCCACTGTGGAATAGG + Intronic
1055861535 9:80755893-80755915 AAGAGCTACCAATCAGGATAAGG + Intergenic
1056235005 9:84585943-84585965 AAGAGCTGCCACACTGGGGCGGG + Intergenic
1060186798 9:121568543-121568565 AAGAGCTCCCAGTCTGGAATGGG + Intronic
1060390305 9:123271037-123271059 AACAGTAACTACTCTGGAGTTGG - Intergenic
1060893364 9:127202418-127202440 AAGAGCTTCCACACGGGAGCTGG + Intronic
1061079726 9:128362605-128362627 AAGAGCTCTGGCTCTGGAGTCGG + Intergenic
1187471911 X:19577278-19577300 AAGAGCTTGGGCTCTGGAGTTGG - Intronic
1188407114 X:29825374-29825396 TAGAGCTTCCAGTTTGGAGTAGG - Intronic
1193387275 X:80886276-80886298 TGGATCTACCATTCTGGAGTCGG + Intergenic
1196389335 X:115191650-115191672 CAGAGCGACCACTATGGAGGAGG + Exonic
1198238037 X:134755277-134755299 AAGAGCTACCACTTAATAGTTGG - Intronic
1198531930 X:137556326-137556348 TAGAGATAGCAGTCTGGAGTGGG + Intergenic
1199036748 X:143060080-143060102 AAGAGCTCCCAGTCTGAATTAGG - Intergenic