ID: 1115813992

View in Genome Browser
Species Human (GRCh38)
Location 14:37142849-37142871
Sequence TGAGAGGTATCCAGCTAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 83}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115813992_1115813995 -6 Left 1115813992 14:37142849-37142871 CCAGTCTAGCTGGATACCTCTCA 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1115813995 14:37142866-37142888 CTCTCAGTTGTCAAGGACACAGG 0: 1
1: 0
2: 0
3: 16
4: 142
1115813992_1115813996 -2 Left 1115813992 14:37142849-37142871 CCAGTCTAGCTGGATACCTCTCA 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1115813996 14:37142870-37142892 CAGTTGTCAAGGACACAGGAAGG 0: 1
1: 0
2: 1
3: 34
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115813992 Original CRISPR TGAGAGGTATCCAGCTAGAC TGG (reversed) Intronic
904270623 1:29347601-29347623 TGAGAGGTCTGCATCCAGACAGG + Intergenic
906491368 1:46271332-46271354 GGAGAGGTAGCCAGGTAGCCAGG - Intronic
911992273 1:104715236-104715258 TTAGAGGTATTAAGCTAAACTGG + Intergenic
916263077 1:162861891-162861913 TGAGAGGCAGGCAGCTAAACAGG + Intronic
922545710 1:226455196-226455218 TGAGAGGTGTCCAGGTATCCTGG - Intergenic
924111212 1:240701609-240701631 TGAGATGTATCCAGTTACCCTGG + Intergenic
1072414014 10:95231803-95231825 TGAGATGTATCCAGTTAACCAGG + Intergenic
1074492389 10:113950494-113950516 TGATAGGTAGATAGCTAGACAGG + Intergenic
1074907699 10:117879485-117879507 TGAGAGTTATCCAGCTGGGGAGG - Intergenic
1074950243 10:118327459-118327481 TGAATGGTCTCCAGCTACACAGG - Intronic
1087932386 11:103992941-103992963 TGGGAGGTATGCAGGTAGAGAGG + Intronic
1089659105 11:119974392-119974414 TCAGAGGTATCTAGATAGACAGG - Intergenic
1090113694 11:123943374-123943396 CCAGAGGAATCCAGCTAGCCAGG + Exonic
1090604824 11:128410633-128410655 TGAGAGGGTTCCAGCTACAGCGG - Intergenic
1096234050 12:49913789-49913811 GGAGAGGTTTCCAGCTTGAGTGG + Intergenic
1097727433 12:63090960-63090982 TGGGAGGGATCCGGCTAGAATGG + Intergenic
1104222588 12:126799368-126799390 TGAAAGGTAACCAGTAAGACTGG - Intergenic
1107444072 13:40454242-40454264 TGAGAGGTGACCAGATAAACTGG - Intergenic
1110678513 13:78279404-78279426 TGAGAACTATCCAACTACACTGG - Intergenic
1115813992 14:37142849-37142871 TGAGAGGTATCCAGCTAGACTGG - Intronic
1121899620 14:97681996-97682018 TGAGATGCAACCAGCTAGAAAGG + Intergenic
1123129306 14:105972776-105972798 TGAGTGGTTTCCAGCTTGACGGG - Intergenic
1124853205 15:33361063-33361085 TGAGAAGCCTCCAGCTAGAGGGG - Intronic
1125607445 15:40949177-40949199 TGAGAGGTAGCCACCTGGAGGGG + Intergenic
1135949521 16:26900981-26901003 TGAGAGGCACCTAGGTAGACTGG - Intergenic
1136536024 16:30900008-30900030 TCAGAGGTAGCCAGGTAGCCTGG + Intronic
1136870988 16:33808090-33808112 TGAGTGGTTCCCAGCTTGACGGG + Intergenic
1138450269 16:57089717-57089739 TGAGAGGTCTCCACCTGGGCAGG + Intergenic
1138680583 16:58680991-58681013 TGAGAAGAAACCAGCTAGAGTGG - Intronic
1140229273 16:73104111-73104133 TGGGAGGTCTCCAGATGGACAGG + Intergenic
1142298749 16:89243947-89243969 GGAGCGGTATCCAGGGAGACGGG + Intergenic
1203101184 16_KI270728v1_random:1307968-1307990 TGAGTGGTTCCCAGCTTGACGGG - Intergenic
1143013499 17:3879314-3879336 TGAGAGGCAGCCAGCTGGCCAGG - Intronic
1146073878 17:29709815-29709837 TGAGATGAATCCAGCTGGGCTGG + Intronic
1147618812 17:41848214-41848236 TGAGGAATATGCAGCTAGACGGG + Exonic
1149699379 17:58642757-58642779 TGAGAGGTTTCCAGAAAGATTGG - Intronic
1150576557 17:66435801-66435823 AGAGAGGTTTCCAGATAGAGAGG + Intronic
1153580267 18:6566077-6566099 TCTGAGGTATCCAGACAGACAGG - Intronic
1157516556 18:48315600-48315622 TGGGAGGTAACGAGGTAGACTGG + Intronic
1160656863 19:277284-277306 GGGGAGGTTTCCAGCCAGACAGG + Intergenic
1164484991 19:28647972-28647994 GAAGAGGTATCCTGCTATACTGG - Intergenic
1165757995 19:38305171-38305193 TGAGAGATCTCCAGCTGCACAGG - Exonic
926853019 2:17221782-17221804 TTAGAAGTAACCAGCTACACTGG - Intergenic
926883840 2:17578775-17578797 TGTGAAGTATCCAGCAAGGCTGG - Intronic
928072090 2:28227271-28227293 TGAGGGGTATCTACCTAGAGAGG - Intronic
931461838 2:62456769-62456791 TGAGAGGTCTCTAGCATGACTGG - Intergenic
932040162 2:68291085-68291107 TGAGAAGTAGCCAGAGAGACTGG + Intronic
940269041 2:151871558-151871580 TGAGTTGTACCCAACTAGACTGG - Intronic
944341678 2:198608737-198608759 CGAGATGTGTCCAGCTAGATAGG - Intergenic
947972118 2:234333270-234333292 TCAGAGTTATCCAGGCAGACAGG + Intergenic
1175458740 20:59134926-59134948 TGACAGGTATCCACCTCCACTGG + Intergenic
1176290754 21:5043448-5043470 AGACAGGTGTCCAGGTAGACAGG - Intergenic
1179866501 21:44220193-44220215 AGACAGGTGTCCAGGTAGACAGG + Intergenic
950915373 3:16639083-16639105 TGAGAGTTATCCAGCGGGAGGGG + Intronic
952430260 3:33217068-33217090 TGACCCGTATCAAGCTAGACAGG + Intronic
958784382 3:98581658-98581680 TGAGAGCTCTCCATCTGGACAGG + Intronic
960743477 3:120860332-120860354 TGAAAGGAACCCAGCTAGAAGGG + Intergenic
962126594 3:132625789-132625811 TGAGAGGTCTACAGCTAGCCTGG - Intronic
963534843 3:146514536-146514558 AGAGAAGAATCCAGCTGGACAGG + Intergenic
970204765 4:13644784-13644806 GGGGAGCTATCCAGGTAGACAGG + Intergenic
973317048 4:48772474-48772496 TGAGAGGGATCAAGTTACACAGG + Intronic
975378035 4:73668064-73668086 TGATAGGTTTCCAGCTCAACCGG - Intergenic
975910414 4:79259638-79259660 ACAGAGGTATCCAGCCAGAAAGG + Intronic
976772310 4:88666101-88666123 TGAAAGCTATCCATCTAGAACGG - Intronic
977475295 4:97499816-97499838 TGAGAAACAGCCAGCTAGACAGG + Intronic
980471431 4:133257528-133257550 TGAGTGGTTTCCAGCTTGAAGGG + Intergenic
981857002 4:149306778-149306800 TGAGATGAATACAGCTAGAGGGG + Intergenic
983966803 4:173822846-173822868 TCAGATGTACTCAGCTAGACTGG + Intergenic
984651580 4:182276077-182276099 TGAGAAGTCTCCAGCTGGGCAGG + Intronic
986423050 5:7603260-7603282 TGGGAGGTAGCCAGGTAGAAGGG + Intronic
987373357 5:17213110-17213132 TGAGAGCTATTCAGGTAGACAGG + Intronic
997162729 5:131625920-131625942 TTATAGGTATACAGGTAGACTGG - Intronic
1004142459 6:13031641-13031663 GGAAAGGTGTCCTGCTAGACAGG - Intronic
1005843172 6:29757904-29757926 TGAGAGGAAACCAGGTAGACAGG + Intergenic
1006068469 6:31479345-31479367 TGAGAGGGAACCAGGCAGACAGG - Intergenic
1011283820 6:85703772-85703794 TGAGAGGTTTCCAGCTGTCCAGG - Intergenic
1014281366 6:119445666-119445688 TAATAGGGATCCAGCTTGACAGG + Intergenic
1019617552 7:1972821-1972843 TAAGTGGGGTCCAGCTAGACCGG - Intronic
1020405678 7:7831434-7831456 TGAAAGGTACCCAGAAAGACAGG - Intronic
1022470091 7:30676761-30676783 TGAGTGGTCTCCAGCCAGAGGGG - Intronic
1028516039 7:91679255-91679277 AGAGAGGAAGCCAGATAGACAGG - Intergenic
1033536020 7:142312861-142312883 TGAGAGGGATCCTGAAAGACAGG + Intergenic
1037980229 8:23247849-23247871 AGAGAGGTATCACGCTAGGCTGG - Intronic
1046669348 8:117041027-117041049 TGAGAGGTTTCCAGCCACACAGG + Intronic
1049881124 8:145064158-145064180 TGATAGGTTTCCAGCTCAACCGG + Intergenic
1052839713 9:33281985-33282007 TGTGAGGCACCCAGCTAGGCTGG - Intronic
1187356544 X:18578387-18578409 TGATAGGTATACAACTTGACTGG + Intronic
1189726193 X:43969961-43969983 AGAAAAGAATCCAGCTAGACTGG - Intronic
1196782169 X:119393361-119393383 TGAGACTTATCCACCTAGAATGG + Intergenic
1197085763 X:122472890-122472912 TGACAGGAAACCAGCCAGACTGG + Intergenic