ID: 1115814648

View in Genome Browser
Species Human (GRCh38)
Location 14:37150414-37150436
Sequence ATGTATATGAGTAAGAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 478
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 440}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115814648_1115814652 4 Left 1115814648 14:37150414-37150436 CCCTCTTTCTTACTCATATACAT 0: 1
1: 0
2: 0
3: 37
4: 440
Right 1115814652 14:37150441-37150463 CCATTTTTCCATACATACACAGG 0: 1
1: 0
2: 0
3: 15
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115814648 Original CRISPR ATGTATATGAGTAAGAAAGA GGG (reversed) Intronic
900809928 1:4794136-4794158 ATGGCTTTGATTAAGAAAGAAGG - Intergenic
901909764 1:12446833-12446855 ATTTATACTAGGAAGAAAGATGG - Intronic
902855819 1:19203955-19203977 AAGTATATGAGGTAGAAACAGGG - Intronic
903001751 1:20271153-20271175 ATGTATAAGAGGAAGATACAAGG - Intergenic
904099605 1:28013368-28013390 ATAATTATGAATAAGAAAGAGGG - Intronic
905249172 1:36636953-36636975 ATGGACATAAGCAAGAAAGAGGG + Intergenic
906313453 1:44770254-44770276 ATGTATAGGTGTTAGAAATATGG + Intergenic
906439720 1:45830720-45830742 AAGTATATGTATAAGAATGAGGG + Intronic
906846790 1:49201049-49201071 ATGGATATCAGGAAAAAAGAGGG + Intronic
906929989 1:50159842-50159864 ATTTATTTCATTAAGAAAGAGGG + Intronic
906983659 1:50659225-50659247 AGAAATATGAGGAAGAAAGAGGG + Intronic
907738215 1:57137295-57137317 ATGTCTATGAGTTAGTGAGAAGG + Intronic
907810626 1:57866322-57866344 ATGTAAATGAATAGGAGAGATGG - Intronic
908936168 1:69378709-69378731 ATGTATATAAATAAAAAACAAGG - Intergenic
908985911 1:70021182-70021204 ATCTATCTGAATAAGAAAAACGG - Intronic
910671813 1:89781336-89781358 ATGTATAATAATAATAAAGATGG + Intronic
910696288 1:90020431-90020453 ATGTGGATGAGTAAGAAAAGGGG - Intronic
911271877 1:95811862-95811884 ATCTATATGAGAAAGAAAATTGG + Intergenic
911444908 1:97979780-97979802 ATGGATAAGATTTAGAAAGATGG + Intergenic
911517358 1:98882715-98882737 ATGTATTTGTTTAAGAAATAGGG + Intergenic
911882543 1:103259622-103259644 ATGTGTATGAATAAGTAGGAGGG + Intergenic
912006456 1:104907536-104907558 ATGTGTATGAACAACAAAGAAGG - Intergenic
912033643 1:105282876-105282898 ATGTACATGATTTAGAGAGAAGG - Intergenic
912327331 1:108780444-108780466 ATGTTTTTGATTCAGAAAGAAGG - Intronic
912578921 1:110703012-110703034 ATGTATTTGAATAATGAAGAGGG - Intergenic
913940375 1:125098191-125098213 ATGAACACGAGAAAGAAAGAAGG - Intergenic
914684533 1:149966734-149966756 ATGTATATGGTTAATATAGAAGG + Intronic
915813017 1:158936021-158936043 ATGAATATGTGTGATAAAGAAGG - Intronic
915820153 1:159014539-159014561 ATGAATATGTGTGATAAAGAAGG - Intronic
916346705 1:163800163-163800185 AAATAAATGAGTAAAAAAGATGG - Intergenic
917605096 1:176619728-176619750 AAGTATATGAAAAAGAAAAATGG - Intronic
917690703 1:177465471-177465493 AGTTAAATGAGAAAGAAAGAAGG + Intergenic
917923436 1:179769801-179769823 CTGTTTATAAGTAAGAAAGCTGG - Intronic
918477265 1:184938261-184938283 ATGGAAATGAATAAGAAAGAAGG + Intronic
918886979 1:190206494-190206516 ATGTGTATGATAAAAAAAGAGGG + Intronic
918920926 1:190708737-190708759 AAGTAAATGTGAAAGAAAGAGGG - Intergenic
919285098 1:195547785-195547807 ATATACATGAGTAAGATATAAGG + Intergenic
919335577 1:196227325-196227347 AGATATATGAATAGGAAAGATGG + Intronic
919438775 1:197600071-197600093 ATGAGTATGAGTAAGCCAGATGG - Intronic
919467208 1:197936558-197936580 ATATATATTTTTAAGAAAGAAGG + Intergenic
919659431 1:200229408-200229430 GTGTATAGTAGTAAGAAAGATGG - Intergenic
920349896 1:205330990-205331012 AAGCATGAGAGTAAGAAAGAAGG + Intergenic
921418390 1:214917388-214917410 CTGTGGAGGAGTAAGAAAGAAGG - Intergenic
921494347 1:215819991-215820013 ATGTTTAAGAGTAAAATAGAAGG + Intronic
923117257 1:230953756-230953778 ATGTATAAGAGTTGCAAAGAAGG - Intronic
923186086 1:231574872-231574894 ATGTGTATGATGAAGTAAGAGGG - Intronic
923498733 1:234546911-234546933 ATGTGTATGAGAGAGAGAGAGGG + Intergenic
923580454 1:235206484-235206506 ATGGATATCAGAAAGAAATAGGG + Intronic
923621787 1:235585498-235585520 ATCTTTTTGTGTAAGAAAGAAGG - Intronic
923845338 1:237724421-237724443 GGGTATTTGAGTAAGCAAGAAGG - Intronic
924111743 1:240706648-240706670 ATGTGTATTACTAAGAAAGCAGG - Intergenic
1064788752 10:18931260-18931282 ATGTATATTTATTAGAAAGAAGG + Intergenic
1064907876 10:20367439-20367461 ATGTAAATGAATAAAAAAGCTGG - Intergenic
1064918757 10:20492243-20492265 ATTTGTATGAGAAAGATAGATGG + Intergenic
1064970417 10:21060492-21060514 ATGTCTTTGAGTAGGCAAGAGGG - Intronic
1065237095 10:23663717-23663739 ATGTATATTAGAAAAACAGAAGG + Intergenic
1065621116 10:27582760-27582782 ATCTATATGAACAAGAAACATGG - Intergenic
1065832004 10:29623049-29623071 GTGTATATGTGAAAGAAATAAGG + Intronic
1066779523 10:38928473-38928495 AGGTATCTGAGTAAGAGATATGG + Intergenic
1067730005 10:48803727-48803749 ATGTAAAAGAGAAGGAAAGAAGG + Intronic
1067763331 10:49067085-49067107 ATTTAGATGTGAAAGAAAGATGG + Intronic
1067979266 10:51065307-51065329 AAGCCTAAGAGTAAGAAAGAAGG + Intronic
1067980341 10:51077303-51077325 ATATGTATGTTTAAGAAAGATGG - Intronic
1069178106 10:65320228-65320250 ATGTAAATGAATAAGAAAGGAGG + Intergenic
1069206109 10:65688207-65688229 ATGTATCTCACTAAGAAAGATGG + Intergenic
1069305074 10:66959015-66959037 ATGTGTATAATTAAGAGAGAAGG - Intronic
1070310373 10:75269001-75269023 ATGTACAACAGCAAGAAAGAAGG - Intergenic
1071222476 10:83485449-83485471 ATGTCTCTGAGGCAGAAAGAGGG + Intergenic
1071781404 10:88849891-88849913 ATATATATTTTTAAGAAAGAAGG - Intronic
1072094515 10:92163949-92163971 ATGTGTAAGAGTAAAAGAGAAGG - Intronic
1073847431 10:107573781-107573803 ATGTATATTGGTAAGAGACAGGG + Intergenic
1075219328 10:120570940-120570962 CTGTCTGTGAGTAGGAAAGATGG - Intronic
1077760998 11:5097812-5097834 TTATAAATGTGTAAGAAAGAGGG + Intergenic
1078200335 11:9176788-9176810 AGGTCTATGAGCAAGAAAGAAGG - Intronic
1079817176 11:25076470-25076492 ATGTATATGATAAAGAAGAAAGG + Intronic
1079900370 11:26175558-26175580 ATGTTTATGAGTAAAGAAGTAGG + Intergenic
1080456637 11:32425477-32425499 TTGTTTAGGAGTAGGAAAGAGGG + Intronic
1080516583 11:33027509-33027531 ATGTTTATGCTTGAGAAAGAAGG + Intronic
1080693711 11:34582439-34582461 ATGTTAATGAGTAAGAAGAAAGG + Intergenic
1081220825 11:40459138-40459160 GTGTATATGCATATGAAAGAGGG - Intronic
1081419487 11:42856770-42856792 ATGAATATCAGTAATAAAGGGGG + Intergenic
1081748757 11:45492247-45492269 CTGAATAACAGTAAGAAAGAAGG - Intergenic
1082049325 11:47757827-47757849 ATGTATATATGTAAGAGATACGG + Intronic
1083186446 11:61020561-61020583 AAGAAAATGAGGAAGAAAGAGGG + Intergenic
1083930142 11:65837849-65837871 AAGTATATTAGAAATAAAGAAGG + Intronic
1086737972 11:90330165-90330187 ATGTATATGAATAAATAATAAGG - Intergenic
1086956202 11:92936732-92936754 ATGCTTATGAGAAAGAAAGCAGG - Intergenic
1087026699 11:93657037-93657059 GTGTATATTAGGGAGAAAGAGGG + Intergenic
1087033580 11:93731977-93731999 ATGTTTATGAGTAAAAATGTAGG - Intronic
1087343068 11:96933764-96933786 ATCTACATGATAAAGAAAGAAGG - Intergenic
1087900792 11:103638185-103638207 ATGTATATGAGAAAAGAATAGGG - Intergenic
1088458810 11:110061074-110061096 ATGTTCTTGAGTAAGCAAGAGGG + Intergenic
1090138938 11:124232468-124232490 ATGTATATGTTCAAAAAAGAAGG + Intergenic
1090166694 11:124556431-124556453 ATATATCTGAGACAGAAAGAAGG - Intergenic
1090271929 11:125392753-125392775 ATGTATGTGTGTGAGAAAGAAGG + Intronic
1090683817 11:129092597-129092619 TTGTATATAAATAAGTAAGATGG - Intronic
1090715383 11:129425957-129425979 ATGTAAATGAATTAGAAACACGG - Intronic
1091316724 11:134619074-134619096 ATGGAGATGAATAAGAAAGCAGG + Intergenic
1091742690 12:2971304-2971326 GTGTATATGTGTAAGAGAGAGGG + Intronic
1092503284 12:9068581-9068603 ATGTATAAGAGACAAAAAGAGGG + Intronic
1092972990 12:13716610-13716632 ATGAAGGTGAGAAAGAAAGAAGG + Intronic
1093106022 12:15088067-15088089 ATGGATATGAATAAAAAAAAGGG + Intergenic
1093375613 12:18423705-18423727 TTGTATATGGATAAGAAATAAGG - Intronic
1093993079 12:25611662-25611684 ATGTGTATGAGAAAGAGAAAGGG - Intronic
1094190890 12:27697211-27697233 AATTGTCTGAGTAAGAAAGACGG + Exonic
1094246484 12:28302000-28302022 AAGTAGATTAGTAAGAAAAAAGG - Intronic
1094794288 12:33952478-33952500 TTGAAAATGAGTAAGGAAGATGG - Intergenic
1095148983 12:38768236-38768258 TTGTATATGATTAAGAAAGTAGG - Intronic
1095376615 12:41536664-41536686 ATGTATGTGTGAAAGAAGGATGG + Intronic
1095464709 12:42478114-42478136 ATACATATGAGAGAGAAAGAGGG - Intronic
1096874790 12:54619500-54619522 ATGTTTGCAAGTAAGAAAGATGG + Intergenic
1097538023 12:60898524-60898546 ATATATATGAATAAGTAGGATGG + Intergenic
1097633381 12:62092073-62092095 ATCTATATTATCAAGAAAGAAGG - Intronic
1098288741 12:68934394-68934416 ATCTATATCTGTAAGAAAGAAGG - Intronic
1098705332 12:73681146-73681168 AGGTTTATGAGAAATAAAGAGGG - Intergenic
1099354311 12:81614582-81614604 ATCTTGATGAGTAAGAAATAAGG - Intronic
1099566584 12:84256016-84256038 TTTTATATGTGTAAGCAAGAAGG - Intergenic
1099744602 12:86686374-86686396 TTGAATAGGAGTAAGGAAGAGGG + Intronic
1099782688 12:87218663-87218685 ATATATAAGAGTGAGATAGAAGG + Intergenic
1099901922 12:88721781-88721803 ATGCATTTGAGTAAGAAGGTGGG - Intergenic
1099967361 12:89463380-89463402 ATCAAAATGTGTAAGAAAGAAGG + Intronic
1100510371 12:95265161-95265183 ATGTGTATATATAAGAAAGAGGG - Intronic
1100563260 12:95770202-95770224 ATGGGAATGAGTAAGAAAGGTGG + Intronic
1102075998 12:110060650-110060672 AAGTAGATGAGAAAGCAAGAGGG - Intronic
1103466371 12:121145119-121145141 ATGTAGATGAGAAAGCAAAAGGG + Intronic
1104119871 12:125789022-125789044 ATGTATATGTATAAGAAAAAGGG + Intergenic
1104398729 12:128458419-128458441 TGGTATGTGAGCAAGAAAGAAGG - Intronic
1105049855 12:133038594-133038616 AAGTTTATGTGTAAGAAAAAAGG - Intronic
1105314015 13:19240611-19240633 GTGTAGATGAATAAGAAATATGG + Intergenic
1105320562 13:19316886-19316908 AAATAGATGAGGAAGAAAGAAGG - Intergenic
1105650028 13:22367167-22367189 AAGGAAATGAGAAAGAAAGACGG - Intergenic
1107181517 13:37466391-37466413 ATGTTTGTGTGTATGAAAGATGG + Intergenic
1107734381 13:43382609-43382631 ATGGGGATGAGTAAGAAAGGGGG + Intronic
1109082103 13:57917329-57917351 ATGTATATGAGAAAAATAGTTGG + Intergenic
1109084180 13:57949579-57949601 ATATATATGAATAAGATAAAGGG - Intergenic
1109302064 13:60599927-60599949 ATGAATATTATTGAGAAAGAGGG + Intergenic
1109934808 13:69267635-69267657 ATGAATATGAGTATCAAATAAGG + Intergenic
1110420731 13:75304787-75304809 ATGTAGAGAAGTAAGGAAGAAGG + Intronic
1110616414 13:77547047-77547069 TTAGATATCAGTAAGAAAGAAGG + Intronic
1110801085 13:79695885-79695907 ATGTATATGTTTAGGGAAGAAGG + Intergenic
1111387443 13:87545181-87545203 ATATATATGGGTAAGCATGAAGG - Intergenic
1111977496 13:94982121-94982143 ATGTACATGAGTTAGAAATATGG - Intergenic
1112128036 13:96491623-96491645 ATGTCTATGAGTATGCAAGTTGG - Intronic
1114360338 14:21965310-21965332 ATGAATAAGAGCAAGACAGAGGG + Intergenic
1114909792 14:27176490-27176512 ATGTATGCGAATCAGAAAGACGG - Intergenic
1115503325 14:34068520-34068542 TTGTTTATGAATAAGAAAGTGGG - Intronic
1115814648 14:37150414-37150436 ATGTATATGAGTAAGAAAGAGGG - Intronic
1116006289 14:39295401-39295423 ATGTATGTGGGGGAGAAAGAGGG - Intronic
1116139387 14:40971116-40971138 ATGTCTTTGAGTGGGAAAGAAGG - Intergenic
1116350716 14:43859197-43859219 AATTATGTGAGTAAGAGAGAAGG + Intergenic
1116687854 14:48064833-48064855 ATGTATAGGAGTAATGAAAATGG - Intergenic
1117562544 14:56956082-56956104 ATGTATTTCAGTAAGATACATGG + Intergenic
1117695280 14:58355762-58355784 AAGAATCTGAGGAAGAAAGAAGG - Intronic
1118383813 14:65239012-65239034 ATTTATATCAGTAATAAATAGGG + Intergenic
1119492276 14:75045804-75045826 GTGTGTATGTGTAAGAAAGGGGG - Intronic
1120106801 14:80505422-80505444 ATGTATATGAGTAAAACATTGGG - Intronic
1120281162 14:82439572-82439594 ATGTCTTTGAGTAAGTAAGTGGG - Intergenic
1120298593 14:82677140-82677162 ATGTAAAAGAGATAGAAAGAAGG + Intergenic
1120408931 14:84126112-84126134 CTGCATAAGAGTAGGAAAGAGGG + Intergenic
1121454367 14:94028879-94028901 ATGTATATGAGTGTTCAAGAAGG + Intronic
1121497290 14:94402409-94402431 ATGAAAATAAGAAAGAAAGAAGG - Intergenic
1123894273 15:24812934-24812956 ATGTGTATGAACAGGAAAGATGG - Intergenic
1124112227 15:26801725-26801747 ATCTAAATGAGGAAGAAGGAAGG + Intronic
1124292111 15:28462518-28462540 ATATGAAGGAGTAAGAAAGATGG - Intergenic
1124335477 15:28853263-28853285 AGGTATATGAGAGATAAAGAGGG - Intergenic
1126377685 15:48012572-48012594 ATGTATATGAGCATGAGTGAGGG - Intergenic
1126506331 15:49407606-49407628 ATATATATTAGTACGAATGAGGG - Intronic
1126570526 15:50145925-50145947 ATGAAAATGAATGAGAAAGATGG + Intronic
1126850407 15:52793380-52793402 ATGTATATATGTAAGAAAAAAGG + Intergenic
1127131568 15:55870023-55870045 AGGCATATGAGTAAAGAAGAGGG + Intronic
1127634118 15:60852903-60852925 ATGAATATGAGAAGGAAACATGG + Intronic
1128357527 15:66938500-66938522 AGGTCTATGCGTAAGAAAGAAGG - Intergenic
1129571064 15:76684070-76684092 ATAAATATGAATAGGAAAGATGG + Intronic
1129654217 15:77512553-77512575 AAGTATATGAATAAAAAATAGGG + Intergenic
1131227246 15:90635210-90635232 ATGTAAATGAGAAAAAAAAAAGG + Intronic
1131514723 15:93069554-93069576 AAGTATAAGGGGAAGAAAGAAGG + Intronic
1132781388 16:1628217-1628239 TTGTATATGAGAAAGAGCGAGGG + Intronic
1133384123 16:5355001-5355023 GTGTATATGAGAGAGAGAGAGGG + Intergenic
1134812757 16:17181351-17181373 AAATATAAGAGGAAGAAAGAAGG + Intronic
1135121546 16:19770588-19770610 AGAGATATGACTAAGAAAGAGGG - Intronic
1135692767 16:24556708-24556730 ATGTGAATGAGGAAGAAAGCAGG - Intronic
1136956152 16:34788466-34788488 ATCTATCTGAGTAAGAGATATGG + Intergenic
1137906543 16:52328004-52328026 ATGTAAAAGAGAAAGAAACAGGG + Intergenic
1137968902 16:52964235-52964257 AAGTACAAGAATAAGAAAGATGG + Intergenic
1138725536 16:59134625-59134647 ATATTTATGAGTTAGAAATAAGG + Intergenic
1138796225 16:59972463-59972485 ATATATATGAGAAACAGAGAAGG + Intergenic
1138845124 16:60555542-60555564 ATGAATATGATTATGAAACAGGG - Intergenic
1138932391 16:61676348-61676370 ATGAATATTAGTGATAAAGAGGG + Intronic
1140230430 16:73113086-73113108 GAGAATATGAGAAAGAAAGAGGG + Intergenic
1140561575 16:75988393-75988415 CAGAATATGAGTAGGAAAGAGGG - Intergenic
1140641790 16:76982787-76982809 ATGTAGATCAGTAACAAACATGG - Intergenic
1141197661 16:81872971-81872993 ATGTATCTGAGTTAGAGAAATGG + Intronic
1144335662 17:14266986-14267008 ATGCATATGAGGAGGAAGGAAGG - Intergenic
1144427946 17:15162057-15162079 ATGACTAGGAATAAGAAAGATGG + Intergenic
1145708830 17:26949142-26949164 AGGTATCTGAGTAAGAGATATGG + Intergenic
1145853656 17:28130273-28130295 ATGTAAATGAGTAAGTGAGAAGG - Intronic
1149002955 17:51775820-51775842 ATGTATGTGGGGAAGAATGAGGG + Intronic
1151124981 17:71834833-71834855 ATGCATAAGAGGAAGAAAGTTGG + Intergenic
1151689282 17:75671390-75671412 GTGTATATGAAAAGGAAAGAAGG + Intronic
1154067188 18:11118329-11118351 AAGGAAATGAGTATGAAAGAAGG - Intronic
1154224718 18:12492894-12492916 ATGTATATGAGAGAGTGAGAGGG + Intronic
1155034099 18:22009868-22009890 ATGTAAATGAGTGAGATTGATGG + Intergenic
1155796547 18:30044698-30044720 ATGTTTATGAGTAAGAAGCAAGG - Intergenic
1155966584 18:32041207-32041229 ATGTATATGTGAAAGAACAAGGG + Intronic
1156698035 18:39791543-39791565 ATGGATGTGAGTAAGTAATATGG - Intergenic
1157241752 18:46016443-46016465 ATGTAAATGAGTGAAAAAGGAGG - Intronic
1158657557 18:59352858-59352880 ACAAATATGAGTAAGACAGATGG - Intronic
1159528225 18:69621495-69621517 ATGTATATGAGGAAACAAGAGGG + Intronic
1160220133 18:76969823-76969845 ATGTATATAAGTAATATTGACGG + Exonic
1164002098 19:21110759-21110781 TTGTATAAGTGTAAGAAAGGGGG + Intronic
1164006389 19:21153566-21153588 ATGTATATGACAAAGAAAAGAGG - Intronic
1164723733 19:30451449-30451471 ATGTAAAGGGGTCAGAAAGATGG - Intronic
1168522103 19:57060669-57060691 TTGTGTGTGTGTAAGAAAGACGG - Intergenic
925504406 2:4544678-4544700 GTGTATATGAGCCAGAAAGCAGG - Intergenic
926525649 2:13976669-13976691 ATGTAGATAAATAAGGAAGAAGG + Intergenic
928256051 2:29723438-29723460 ACATATATGTGTAAGAAATAGGG - Intronic
928507716 2:31971194-31971216 AGGTTTATGCCTAAGAAAGAGGG - Intronic
928725412 2:34167514-34167536 ATGTATATGTGTGAGAAAGTAGG + Intergenic
928820076 2:35351132-35351154 ATGTATAAGAGAAAGCAATAAGG - Intergenic
929624761 2:43395233-43395255 CTGTATCTGAGTTAGAAGGAAGG - Intronic
931081549 2:58777696-58777718 ATGTAGATAAGAAAGATAGATGG + Intergenic
931083015 2:58796849-58796871 ATTAATGAGAGTAAGAAAGATGG - Intergenic
931521227 2:63099315-63099337 ATGGAAATGAGTAAGTAAAATGG - Intergenic
931588373 2:63853692-63853714 ATGTATTTCAGCAAGTAAGAGGG - Intronic
932288803 2:70557854-70557876 CTGTGTATGAGAAAGAAAGAGGG + Intergenic
932929599 2:76018406-76018428 CGGTATGTGATTAAGAAAGAAGG + Intergenic
933119165 2:78514948-78514970 ATGTATATGTGTTAAAAATATGG + Intergenic
933149745 2:78900190-78900212 ATGTGTATGAGGCAGATAGATGG + Intergenic
933556647 2:83838469-83838491 CTGTAAATGTGTTAGAAAGAAGG - Intergenic
935224573 2:101042173-101042195 ATGTTGATGAGGAGGAAAGAAGG + Intronic
937102640 2:119283415-119283437 ATGGATATGGGGAAGAGAGAGGG - Intergenic
937125384 2:119472152-119472174 ATGTATTTTAGTGAGAGAGATGG + Intronic
938044734 2:128108029-128108051 TTGTAGCTGAGTAAGAACGAAGG - Exonic
938724395 2:134094219-134094241 ATGTCTGTAGGTAAGAAAGATGG - Intergenic
939021865 2:136966819-136966841 ATGTATAGGACTTAGAAAGAAGG - Intronic
939148397 2:138444218-138444240 ATATATATAAGTAATAAAGAGGG + Intergenic
939614456 2:144346899-144346921 ATGTGTATGTGAAAGAAAGAGGG - Intergenic
939648034 2:144725403-144725425 TTGAATATGAGTAATAAAAATGG - Intergenic
940076495 2:149748014-149748036 CTGTATATTAATAAGAAAAAAGG + Intergenic
940311819 2:152287070-152287092 ATGTATTTAAGTAAAAAAGGTGG + Intergenic
940569972 2:155418392-155418414 ATGTATGCGAGTAAGAGAGGAGG + Intergenic
940822417 2:158371846-158371868 ATTTATATGAATTATAAAGAGGG - Intronic
941047803 2:160696047-160696069 ATGTATCTGAGTATTAAAAAGGG - Intergenic
941213227 2:162669797-162669819 AAGTATGTGCTTAAGAAAGAAGG + Intronic
941413845 2:165194235-165194257 GTTTATGTGAGTAAAAAAGAAGG + Intronic
942836498 2:180305033-180305055 ATGTACACAAGTAAAAAAGAGGG - Intergenic
943569244 2:189553585-189553607 ATGTATTTGTGTAAAGAAGAAGG - Intergenic
944260600 2:197671968-197671990 ATGTATATGAGTATGTTACAGGG - Intronic
944622774 2:201534104-201534126 ATATATCTGAGACAGAAAGAAGG + Intronic
945197469 2:207250749-207250771 ATTTATATGAGGTAGTAAGAGGG + Intergenic
947458656 2:230282829-230282851 ATGTACATTAGTAAGGGAGAAGG + Intronic
948923144 2:241076124-241076146 GTGTATATGTGGAAGAAAAAAGG - Intronic
1169589369 20:7123131-7123153 GTGTATATGTGTTAGAAATAGGG + Intergenic
1169694408 20:8370744-8370766 ATGTATATGTGTAAGACAAGGGG - Intronic
1170814616 20:19703017-19703039 ATGTAAATGAACAAGAAACAGGG + Intronic
1172473282 20:35217101-35217123 ATGTATATGAGTGAGGAGGTTGG - Intergenic
1172564108 20:35915018-35915040 ATGTATATATGTAAAAAAAAAGG + Intronic
1174759082 20:53188682-53188704 ATGTATATGTGTGTGTAAGATGG - Intronic
1174888676 20:54365158-54365180 ATGCATATGCTTATGAAAGATGG + Intergenic
1176925857 21:14748075-14748097 ATGTTTAAGAATAAGAAAAATGG + Intergenic
1177069563 21:16486470-16486492 ATGGGTATGAGGAAGAGAGATGG + Intergenic
1177520785 21:22221287-22221309 GTTTATCTGGGTAAGAAAGATGG - Intergenic
1177854836 21:26388896-26388918 GTGTATAACAGGAAGAAAGAAGG + Intergenic
1178909602 21:36663988-36664010 ATGAATATGAATATGAAAGGCGG + Intergenic
1180870970 22:19147244-19147266 ATGTAAATGTGGCAGAAAGATGG + Intergenic
1181597859 22:23928862-23928884 ATGTTTACGAGTAAGAAGCAAGG - Intergenic
1183252268 22:36738501-36738523 GTGAATATGAGCCAGAAAGAAGG - Intergenic
1183792432 22:40083674-40083696 GAGTTTATGAGTAAGAGAGAGGG + Intronic
1185032714 22:48453124-48453146 ATGCAAAGGAGGAAGAAAGAAGG + Intergenic
1185195325 22:49465734-49465756 ATGTGTATGGGAAAGAGAGAAGG + Intronic
1203290346 22_KI270735v1_random:31373-31395 AGGTATCTGAGTAAGAGATATGG - Intergenic
949454432 3:4223991-4224013 AAGGATAAGAGTAAGCAAGAAGG + Intronic
949745619 3:7288982-7289004 ATGTATATGGGGAAAAAAGCAGG - Intronic
950276908 3:11669418-11669440 ATGAATATCATTAAAAAAGAAGG - Intronic
951137361 3:19118949-19118971 ATGAAGATGAGAAAGAAATAAGG + Intergenic
952476454 3:33716032-33716054 ATGTCCTTGAGTAAGCAAGAAGG + Intronic
952875463 3:37941058-37941080 ATGTGTATGAGTGGGAAACAGGG + Intronic
953900659 3:46840254-46840276 CTGTCTCTGAGAAAGAAAGAAGG + Intergenic
954040746 3:47885466-47885488 AAGAATATGAGGTAGAAAGAAGG - Intronic
955950943 3:64241457-64241479 ATGTATATATGTAAGTAACATGG + Intronic
956105574 3:65814225-65814247 ATGTAGATGAATATGAAAGAAGG - Intronic
956202839 3:66724707-66724729 ATGTATATAATTAAGAAAATAGG + Intergenic
956833406 3:73075545-73075567 ATGTGTATGAGAAAGAGAGATGG - Intergenic
957124834 3:76145614-76145636 ATGTATATGAGAGAGATACATGG + Intronic
957274435 3:78072938-78072960 ATGTAGATGAATCAGAATGATGG - Intergenic
957450733 3:80378605-80378627 CTGTCTATGAATCAGAAAGAAGG - Intergenic
957682952 3:83461350-83461372 ATGAATATCAGTAATAAAAAAGG - Intergenic
958700131 3:97578452-97578474 ATCTGGATGAGTAAGAAAGCTGG + Intronic
958804206 3:98790020-98790042 ATATATATTAACAAGAAAGAAGG + Intronic
958866072 3:99503255-99503277 AAGTATATGTGTAAAACAGAAGG + Intergenic
959274679 3:104263183-104263205 ATGGATATAAGCAAGATAGATGG + Intergenic
959432767 3:106275330-106275352 ATGAATAGGAGAAAGAAAGGCGG - Intergenic
959928349 3:111950860-111950882 ATGTATACAAGGAAGAAACAAGG + Intronic
960285020 3:115818755-115818777 ATATATATATATAAGAAAGAAGG + Intronic
960364297 3:116752211-116752233 ATGTCTATGAAAAATAAAGAAGG + Intronic
960574140 3:119213105-119213127 ATGTAGATGAGGATGAATGAAGG + Intronic
960784515 3:121357186-121357208 ATTTGCATGAGTCAGAAAGATGG + Intronic
961902397 3:130225681-130225703 AGGAATAGAAGTAAGAAAGAAGG + Intergenic
963249523 3:143090290-143090312 ATGGAAAAGAGAAAGAAAGAGGG - Intergenic
964093709 3:152906723-152906745 ATGTTTATAACTAAGAAACAAGG - Intergenic
964903128 3:161685420-161685442 ATTTGAATGAGTAAGAAGGATGG + Intergenic
966246993 3:177819655-177819677 ATGACTATGAGAAGGAAAGATGG + Intergenic
966702012 3:182863881-182863903 ATGTAGATCAGGAAGAATGAGGG - Intronic
967272990 3:187745882-187745904 GAGTTTATGGGTAAGAAAGAAGG - Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967477333 3:189937208-189937230 ATGTATATAAGTAAGTAAATAGG - Intergenic
967516762 3:190378734-190378756 ATGTAGATGAGTCAGGGAGATGG - Intronic
969309065 4:6341697-6341719 CTGTATAGGAGGAAGAAGGAAGG + Intronic
969834437 4:9828664-9828686 ATGAAGAGGAGTAAGAAAGCAGG - Intronic
970076661 4:12229635-12229657 CTGTCTATGAATAAGAAAGCAGG + Intergenic
970144997 4:13026703-13026725 ATCTATAAAAGCAAGAAAGACGG + Intergenic
970509432 4:16766219-16766241 ATGTATATTAATATAAAAGATGG - Intronic
970609889 4:17715088-17715110 ATGTGTATGTGTATAAAAGACGG - Intronic
971596150 4:28531464-28531486 ATGTATATGAATTAAATAGATGG + Intergenic
971700337 4:29965024-29965046 ATATATATTAGAAAGAAAGTGGG + Intergenic
973665923 4:53159355-53159377 ATGTATATTTTGAAGAAAGATGG - Intronic
974198486 4:58608763-58608785 ATGAAAATGAGTAAAAAACAAGG + Intergenic
974968554 4:68796399-68796421 ATGTATTAAAGTATGAAAGAAGG - Intergenic
976578763 4:86708971-86708993 GTGTAAGAGAGTAAGAAAGAAGG - Intronic
976775317 4:88699486-88699508 ATATATGGGAGTGAGAAAGAAGG - Intronic
978360591 4:107927329-107927351 AAGTAAATGAGGAAGAAATAAGG + Intergenic
980801841 4:137761702-137761724 ATGTGTATGAATAAAAGAGAGGG + Intergenic
980939748 4:139262440-139262462 ATATATATAGCTAAGAAAGAAGG + Intergenic
981130226 4:141150327-141150349 TTGGATATGAGTATGAAAGAAGG - Intronic
981185138 4:141792473-141792495 ATGAATATGAGTAGGAAAAGGGG + Intergenic
981640205 4:146933892-146933914 ATGTAAATGAGTAAGCAAGCAGG - Intronic
982038616 4:151372558-151372580 ATGCATATTATTATGAAAGAAGG + Intergenic
982325689 4:154126412-154126434 TTGGATGTGAGAAAGAAAGAAGG - Intergenic
983213048 4:164977834-164977856 ATGTATATGAGTAAACTTGAGGG + Intergenic
983437972 4:167740306-167740328 ATGTATATAAACAAGAAAGAGGG + Intergenic
984472734 4:180197060-180197082 CTGTATACCTGTAAGAAAGATGG + Intergenic
984539176 4:181016067-181016089 ATATATATGGGAAAGAATGAAGG + Intergenic
984842508 4:184081194-184081216 ATATATATGAGAATGAAGGAAGG + Intergenic
984866206 4:184282745-184282767 ATGTGTTTGAGAGAGAAAGAGGG - Intergenic
986615769 5:9615879-9615901 GTGTAAATGTGTAAGAAAGATGG - Intergenic
986811441 5:11363867-11363889 ATATATATCATTAGGAAAGAAGG + Intronic
988914347 5:35877291-35877313 ATGGCTATGAGAAAGAAAGAGGG + Exonic
989377675 5:40781809-40781831 ATGTATAAGAGAAAGAAGGAAGG + Intronic
989569223 5:42929678-42929700 AGGGTTATGATTAAGAAAGAAGG - Intergenic
990934396 5:61132289-61132311 ATGAATAAGTGAAAGAAAGAGGG + Intronic
992197170 5:74351369-74351391 ATGTAAATTAATAAGAATGATGG - Intergenic
993062025 5:83050078-83050100 AGGTATATGAGAAAGGAAAAGGG + Intergenic
993640065 5:90391851-90391873 ATGTATATTAACAAAAAAGACGG + Intergenic
993843621 5:92911481-92911503 ATGTAGATAAGCAGGAAAGAAGG - Intergenic
994011943 5:94915019-94915041 AGGAATATGAGTAGCAAAGAAGG + Intronic
994675384 5:102814911-102814933 ATGGATTTGTATAAGAAAGAGGG - Intronic
994791317 5:104229942-104229964 ATGTAAATGATTCAAAAAGATGG + Intergenic
994820503 5:104644782-104644804 AAGTATAAGATGAAGAAAGAGGG - Intergenic
994901049 5:105769739-105769761 ATGTATGTCAGAAAGAAAAATGG + Intergenic
995660143 5:114472670-114472692 ATGTATATGGGGTAGAAATAAGG - Intronic
997415948 5:133728791-133728813 ATGTATATCAGAAGGAAAGAAGG + Intergenic
998012104 5:138703621-138703643 ATGAACAAGAGAAAGAAAGAAGG - Intronic
998298339 5:140993449-140993471 GTGTGTGTGAGAAAGAAAGAAGG - Intronic
998919287 5:147050066-147050088 ATGTGCTTGAGTAAGAGAGAGGG + Intronic
999349608 5:150856787-150856809 ATGTATATGGATGAGGAAGAGGG - Intronic
1000424839 5:161078525-161078547 CTATATATGTGTAAGCAAGAAGG + Intergenic
1001451997 5:171833773-171833795 ATGTTACTGATTAAGAAAGATGG - Intergenic
1002369784 5:178742477-178742499 ATGTTTGTGAGTAAGAAGCAAGG + Intergenic
1002675909 5:180912390-180912412 ATATATTTGAGAGAGAAAGATGG - Intronic
1004460857 6:15834584-15834606 ATGTAACTGAGTAAGGAAAAAGG - Intergenic
1004773155 6:18809990-18810012 AGGTAAATCAGTAACAAAGAGGG - Intergenic
1004773237 6:18810990-18811012 AGGTAAATCAGTAACAAAGAGGG + Intergenic
1006672873 6:35740554-35740576 TTGTATATGTGTAAGTTAGAAGG + Intronic
1006960554 6:37925766-37925788 ATTTATATGAGTGGAAAAGATGG + Intronic
1007342702 6:41201466-41201488 ATGTATATATGTAAGAAACTAGG - Intergenic
1007465141 6:42046394-42046416 TGGTAGATGAGTAAGGAAGATGG - Intronic
1008014737 6:46505559-46505581 ATGTGTGTGAGAAAGAGAGAAGG - Intergenic
1008066553 6:47055699-47055721 ATTTATATCATAAAGAAAGAGGG + Intergenic
1008356467 6:50559925-50559947 GGGTATATGAGTAATAAATAAGG + Intergenic
1008814339 6:55545619-55545641 ATATATAAGTGTAAGATAGAAGG + Intronic
1009563889 6:65284974-65284996 ATGCACATGTTTAAGAAAGAAGG - Intronic
1009931868 6:70185962-70185984 ATGTATTAGAGTGAGAGAGATGG - Intronic
1010029343 6:71256918-71256940 CTATGTATGAGTAAGGAAGAGGG + Intergenic
1010885942 6:81240519-81240541 ATGAAAATGAGAGAGAAAGAGGG + Intergenic
1011221584 6:85060307-85060329 ATAAATATAAGTAAGAAAAAAGG - Intergenic
1012145509 6:95675638-95675660 ATGGATAAGAGGATGAAAGAAGG - Intergenic
1012883446 6:104817590-104817612 ATATAGAGGAGAAAGAAAGATGG + Intronic
1012934432 6:105351329-105351351 ATGAATATGAGGAAGAATAAAGG - Intronic
1013077382 6:106783324-106783346 ATGAAACTGAGAAAGAAAGACGG + Intergenic
1013440533 6:110161412-110161434 ATCAATATGTGGAAGAAAGAGGG - Intronic
1013914706 6:115321500-115321522 CTGTATATGATTCAGAAAAAGGG - Intergenic
1014460590 6:121690268-121690290 ATGTATATGTGTAAGTTAAATGG - Intergenic
1014864616 6:126513082-126513104 ATGGATGTGGGTAAAAAAGAGGG - Intergenic
1015721257 6:136244917-136244939 ATTTATATAAGTATGAAAAAAGG + Intronic
1015827850 6:137335041-137335063 ATGTGCATGTGCAAGAAAGAGGG + Intergenic
1016633662 6:146261306-146261328 TTGTAAATGAGTAGGAAAGGAGG + Intronic
1017308366 6:152947749-152947771 ATGTATACAGGTAAGAAAAATGG - Intergenic
1017581897 6:155874263-155874285 ATGCAAATGTGTAGGAAAGAGGG - Intergenic
1018139736 6:160818598-160818620 ATGCACATGTTTAAGAAAGAAGG - Intergenic
1018359302 6:163050602-163050624 ATGTATTTGACTAAGACTGAAGG - Intronic
1018591906 6:165435175-165435197 AAGTATTTAATTAAGAAAGATGG - Intronic
1018595951 6:165480597-165480619 AAGTATATGAGAAAGAGAAAGGG + Intronic
1020747320 7:12093744-12093766 ATGTATATATGTATGAAAAAGGG - Intergenic
1021048408 7:15952247-15952269 TTTTATATGAATAGGAAAGAAGG - Intergenic
1021072873 7:16264488-16264510 ATGGATATTAGGAATAAAGATGG + Intronic
1021242449 7:18220524-18220546 TTGTACAAGAGTAAGAGAGAAGG + Intronic
1022623145 7:32005656-32005678 GTGTATATTAGTATAAAAGAAGG + Intronic
1023008209 7:35898781-35898803 TTGTGTATGAGTGAAAAAGAGGG + Intronic
1023726238 7:43145289-43145311 ATATATACGTGTATGAAAGAAGG - Intronic
1027669417 7:81077454-81077476 ATGTATAAGAGGAAGACAGCAGG - Intergenic
1028229484 7:88289296-88289318 ATGGAGAAGAGTAAGAAAGAAGG + Intronic
1028303422 7:89230531-89230553 ATGTAAATAAGTAAATAAGACGG + Intronic
1028766154 7:94562258-94562280 AAGTATATGAGAAGGAAAAAGGG - Intergenic
1029043866 7:97606284-97606306 ATGTATATGTATGAGAGAGAGGG - Intergenic
1029445221 7:100608137-100608159 ATTTATTTGGATAAGAAAGAAGG - Exonic
1030050599 7:105533583-105533605 ATGTGTAGCAGTAAGAAAAACGG + Intronic
1030356553 7:108549570-108549592 ATGTATATTGGGAAGATAGAAGG - Intronic
1030852485 7:114507864-114507886 ATGTTTGTTAGTAAGGAAGAAGG + Intronic
1030921136 7:115389602-115389624 ATATTTAAGAGTAGGAAAGAAGG - Intergenic
1031438005 7:121756696-121756718 ATATGTAGGAGTAAGAAAAATGG + Intergenic
1032782583 7:135176031-135176053 AGGGTTATGAGTCAGAAAGATGG - Intergenic
1033851204 7:145497749-145497771 ATGCATCTAATTAAGAAAGAAGG - Intergenic
1033915332 7:146317099-146317121 ATGTATATGAATAAATAAAAAGG - Intronic
1034016091 7:147588166-147588188 ATGTAAAAGAGAAAGAGAGATGG + Intronic
1036079452 8:5538799-5538821 ATTGATATGAAGAAGAAAGAAGG + Intergenic
1036105851 8:5837988-5838010 ATGAAAATCAGTAAGAGAGATGG - Intergenic
1036175877 8:6538263-6538285 ATGTGTGTGTGTAAGACAGATGG - Intronic
1036488734 8:9203996-9204018 ATATGTATGAGTGAGAAAAATGG + Intergenic
1036774473 8:11600754-11600776 ATGTATAGAAGTAGGAATGAGGG + Intergenic
1038457434 8:27686513-27686535 AAGTATTTTAGTAAGAAACAAGG + Intergenic
1038468718 8:27791728-27791750 ATGTATATGACTATAAAACAAGG - Intronic
1038988291 8:32837408-32837430 ATGTAAATAAGTAATAAGGACGG - Intergenic
1041724445 8:61004972-61004994 GTGTATATCGGTAAGAAGGAGGG - Intergenic
1041879530 8:62733315-62733337 GTGTATTTCAGGAAGAAAGAAGG - Intronic
1041919159 8:63163903-63163925 ATGTTTATTACTAAGGAAGAGGG - Intergenic
1042566953 8:70121315-70121337 ATGGATATGATTAAGCAGGAGGG - Exonic
1042831846 8:73038729-73038751 CTGACTATGAATAAGAAAGAAGG + Intronic
1042891123 8:73611346-73611368 ATGTATATGAGGAAAAATGCAGG + Intronic
1044082171 8:87898634-87898656 ATGTGTATAAGTAATACAGAAGG - Intergenic
1044539279 8:93391737-93391759 ATATATTTGAGACAGAAAGAGGG - Intergenic
1046217532 8:111168720-111168742 TTTAATATCAGTAAGAAAGATGG + Intergenic
1046647700 8:116803966-116803988 ATGTATATGACTAGGAAATACGG + Intronic
1047072788 8:121365679-121365701 ATTTATATCAGGAAGAAAAATGG - Intergenic
1049730461 8:144175018-144175040 ATGTATATGAGGAAGTTTGAGGG - Intronic
1050481256 9:6089355-6089377 ATCTATATGAATAACAATGAAGG - Intergenic
1051170138 9:14313476-14313498 ATGTACCTGAGTGAGACAGATGG + Exonic
1051559894 9:18428787-18428809 ATCAGAATGAGTAAGAAAGAAGG - Intergenic
1052432179 9:28380903-28380925 AGGCATATGAGGAAGAAATAAGG + Intronic
1053299606 9:36939560-36939582 ATGAAAATGAGAAACAAAGAGGG - Intronic
1054883037 9:70164995-70165017 ATGTATATTAGTATCTAAGAGGG - Intronic
1055085400 9:72308562-72308584 ATGTAAATTAGGAAGAAAGGGGG + Intergenic
1055154428 9:73042823-73042845 ATGGAGATGAGGAAGAAATATGG + Intronic
1056256343 9:84803264-84803286 AGGATTATGAGGAAGAAAGAAGG - Intronic
1057930949 9:99192455-99192477 ATTTATGTGACTAAGAAAAATGG + Intergenic
1058564902 9:106272544-106272566 TTGTATTTGAGAAAGAGAGAAGG + Intergenic
1059788945 9:117618719-117618741 ATGTATATGGGGAAAACAGATGG + Intergenic
1059844991 9:118265320-118265342 ATGTGTATGAGAAAGAGAGGAGG + Intergenic
1059999665 9:119946919-119946941 ATGTTTGTGAGCAAGAAAGAAGG - Intergenic
1060068224 9:120523849-120523871 ATTAAAATGAGGAAGAAAGAGGG + Intronic
1060840371 9:126788790-126788812 ATGTGTATGAGTCAGGAAGGTGG - Intergenic
1186287874 X:8065243-8065265 ATGTGGAGGAGAAAGAAAGAGGG + Intergenic
1186746273 X:12572963-12572985 AAGTATCTGTGTCAGAAAGAGGG - Intronic
1187028735 X:15463268-15463290 AGATAAAGGAGTAAGAAAGATGG - Intronic
1187226473 X:17378318-17378340 TTGTACATGAATAATAAAGATGG + Intronic
1187598772 X:20803485-20803507 ATATATATGAATAATAAAGTAGG + Intergenic
1187866437 X:23727292-23727314 AAGTTAATGAGCAAGAAAGAGGG + Intronic
1188529223 X:31120346-31120368 TTGTAAGTAAGTAAGAAAGAAGG - Exonic
1189059239 X:37735359-37735381 ATGTATATGTCTAAGGGAGATGG - Intronic
1189217796 X:39342205-39342227 ATGTATATGACTTAGAATAATGG + Intergenic
1189642578 X:43088744-43088766 ATGAATATGATATAGAAAGATGG - Intergenic
1191654031 X:63576694-63576716 ATGTATATGAGAACAAAACAAGG + Intergenic
1193616977 X:83700939-83700961 TTGTATATGATTAAGAAAGGAGG + Intergenic
1193843109 X:86433808-86433830 GTGTATTGTAGTAAGAAAGAAGG + Intronic
1194245141 X:91501378-91501400 ATTGATATTACTAAGAAAGAAGG + Intergenic
1194312978 X:92337782-92337804 ATGAATATGTGTATAAAAGACGG + Intronic
1195405732 X:104511234-104511256 AGGAATACAAGTAAGAAAGAAGG - Intergenic
1196153624 X:112403198-112403220 AAGTAAATGAAAAAGAAAGAAGG - Intergenic
1196278342 X:113795194-113795216 ATGTATCTGTATCAGAAAGAGGG + Intergenic
1196326712 X:114414210-114414232 ATGTGTATTGGTAAGAAACATGG + Intergenic
1197195449 X:123695106-123695128 TTATATATGACTAAGAAAGAGGG - Intronic
1197370140 X:125616189-125616211 ATATATATAAGCAACAAAGAAGG - Intergenic
1197443036 X:126513484-126513506 ATGTACATGAGTAAGTAAAATGG - Intergenic
1197966011 X:132062501-132062523 ATGTAAATGGATAAGAAAAAGGG - Intergenic
1198784744 X:140274440-140274462 ATGAATATCAGTTACAAAGATGG - Intergenic
1199017789 X:142839185-142839207 ATGTATGTGAGAGAGAGAGAAGG - Intergenic
1200311530 X:155083522-155083544 ATGTAGATGTGTAAAAAAGAGGG - Intronic
1200621245 Y:5451896-5451918 ATGAATATGTGTATAAAAGATGG + Intronic
1202052693 Y:20797401-20797423 AGGGTTATGAGTCAGAAAGATGG + Intergenic