ID: 1115818399

View in Genome Browser
Species Human (GRCh38)
Location 14:37187906-37187928
Sequence GAGGGTTAACCAAAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115818388_1115818399 24 Left 1115818388 14:37187859-37187881 CCTGGTTCATCTCATTGGGACTG 0: 382
1: 896
2: 894
3: 968
4: 678
Right 1115818399 14:37187906-37187928 GAGGGTTAACCAAAGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115818399 Original CRISPR GAGGGTTAACCAAAGGAGGA TGG Intergenic
No off target data available for this crispr