ID: 1115828242

View in Genome Browser
Species Human (GRCh38)
Location 14:37301749-37301771
Sequence TTTGAGTAGAAGAAGCAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 366}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115828242_1115828244 2 Left 1115828242 14:37301749-37301771 CCCTACTGCTTCTTCTACTCAAA 0: 1
1: 0
2: 1
3: 21
4: 366
Right 1115828244 14:37301774-37301796 TTCCTCCCTCCCCAACTCTGTGG 0: 1
1: 0
2: 7
3: 56
4: 536

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115828242 Original CRISPR TTTGAGTAGAAGAAGCAGTA GGG (reversed) Intronic
901344150 1:8524074-8524096 TTTTATTAAAAGAAGCAGGAAGG + Intronic
901353908 1:8625928-8625950 TTTGAGTAGAGAAATCAGTTGGG - Intronic
904674523 1:32190773-32190795 TTTGAGTGGCAGGAGCAGCAAGG - Intronic
906465151 1:46071903-46071925 TTTGTGAAGAAGAAGTGGTAGGG - Intronic
907673578 1:56498489-56498511 TTTTAGTACAAAAAGAAGTAAGG - Intronic
908006163 1:59731558-59731580 TTTGATTACAGGAAGCAGTGGGG + Intronic
908057521 1:60305652-60305674 TTTGAGTAGAGGAAGAAATAAGG - Intergenic
910294817 1:85633806-85633828 TTTGAGTAAAAGAGGGAGAAGGG - Intergenic
911372236 1:97007769-97007791 TTTTTGTAGAAGTAGCAGTAAGG + Intergenic
911429055 1:97760066-97760088 TTTTGGTGGAAGAAGCAGAATGG + Intronic
912406194 1:109439958-109439980 TATGAGGAGAAGATTCAGTAAGG - Intergenic
912894746 1:113575252-113575274 TTGGAGGAGAAGAAGCATTCTGG + Intronic
913408327 1:118520845-118520867 TTTGAGAAGAACAAGCAATGGGG - Intergenic
913451464 1:118995466-118995488 TTTGAGTAGGACCAGCAGTTGGG - Intergenic
915771651 1:158432097-158432119 TTAGAGGAGAAGAAGCATTCGGG + Intergenic
915893889 1:159796058-159796080 TTTGAGAAGAGGAATGAGTAGGG + Intergenic
916155390 1:161840436-161840458 TTTAAGGATAAGAAGCAGTATGG + Intronic
916391148 1:164332172-164332194 TAAGAGCAGAAGAAGCAGTCCGG - Intergenic
917719119 1:177769216-177769238 TTTGAGGAGAAGCAGGGGTAGGG - Intergenic
919223287 1:194659956-194659978 TTGGAGGAGAAGAAGCATTCTGG - Intergenic
920985711 1:210886473-210886495 TTGGAGGAGAAGAAGCATTCTGG - Intronic
921681742 1:218041539-218041561 TTTGAGGAGAAGAAAGACTATGG + Intergenic
921696653 1:218218500-218218522 TTTGAATAAAATAAGCAGTTTGG + Intergenic
922283531 1:224147942-224147964 TCTGAATGGTAGAAGCAGTATGG + Intronic
923240900 1:232084569-232084591 TTAGTGTAGAAGAATAAGTATGG - Intergenic
924412506 1:243820382-243820404 TTGGAGGAGAAGAGGCAGTCTGG - Intronic
1063770104 10:9187796-9187818 TTTGGGAAGAAGTAGCAGCAGGG + Intergenic
1063832048 10:9964440-9964462 CTTGAGCAGAAGCAGCAGCATGG - Intergenic
1064722567 10:18244883-18244905 TTTGAGTAGAAGAGACAGATAGG + Intronic
1068394226 10:56440836-56440858 TTGGACAAGAAGAAGCAATATGG - Intergenic
1068706130 10:60077987-60078009 TTTGAGTTGTAGAAGCAGAGAGG - Intronic
1070118566 10:73553032-73553054 TTTGAGTGGGAGAAACAGAATGG - Intronic
1070349397 10:75576964-75576986 TTTGAAGAGAAGAAGCATTCTGG - Intronic
1073055561 10:100698537-100698559 TTTGATGAGAAGATGCTGTATGG + Intergenic
1074162710 10:110847174-110847196 ATTCAGTGGAAGAAGCAGGATGG - Intergenic
1076539216 10:131203723-131203745 TGTGAGCAGAAGCAGCAGTTAGG - Intronic
1077780845 11:5327991-5328013 TTTGAAAATAAGAAGCAGAAAGG - Intronic
1077965924 11:7133360-7133382 TTTCAATATAAAAAGCAGTAAGG + Intergenic
1078641944 11:13104900-13104922 TTTGAGCAGGAAATGCAGTAGGG - Intergenic
1078734623 11:14008632-14008654 TTTTAGTAGGAGAAGAAGTGAGG - Intronic
1078834625 11:15015237-15015259 TTGGAGGAGAAGAAGCACTCTGG - Intronic
1079001810 11:16763924-16763946 TTTGAGTGGCAGAAGCACTTTGG + Intergenic
1081188951 11:40080216-40080238 TTTCAGAAGAAGAAACAGTGTGG + Intergenic
1085536459 11:77223281-77223303 TTGGAGGAGAAGAGGCAGTCTGG + Intronic
1085717779 11:78888535-78888557 TTTGAGTGGCATAAGCTGTAAGG - Intronic
1086129695 11:83388218-83388240 TTTGAGAAGAAGAAGCCATCAGG - Intergenic
1086422037 11:86646130-86646152 TTTGAGGAGAAGAAGCATTCTGG - Intronic
1086588956 11:88488867-88488889 TTTGACCAGAAAAAGCAGTTAGG + Intergenic
1086608567 11:88725964-88725986 TTGGAGGAGAAGAGGCAGTCTGG - Intronic
1086848288 11:91778821-91778843 TGTGAGGAGAAGAAGAATTAAGG - Intergenic
1087410550 11:97785639-97785661 TTGGAGGAGAAGAAGCATTCTGG + Intergenic
1089283609 11:117391712-117391734 CTGGAGTAGAAGAGGGAGTATGG - Intronic
1089804998 11:121078739-121078761 CTAGAGCAGCAGAAGCAGTAAGG - Intronic
1090116998 11:123984192-123984214 TTTGAGGAGAAGAGGCATTCTGG + Intergenic
1090211327 11:124922860-124922882 TGTGAGTAGAAGATCCAGTGGGG + Intronic
1091779814 12:3206642-3206664 TTTCAGTGGAAGAAACAGAAAGG - Intronic
1091825567 12:3510105-3510127 TCTGAGCAGAAGATGCAGTGGGG + Intronic
1093808578 12:23465325-23465347 TTGGAGGAGAAGAAGCACTCTGG - Intergenic
1094054750 12:26257244-26257266 TTGGAGGAGAAGAGGCAGTCTGG - Intronic
1094272018 12:28627338-28627360 GTTGAGAAGAAGAATGAGTAGGG + Intergenic
1094755525 12:33463793-33463815 TTGGAGGAGAAGAAGCATTCTGG - Intergenic
1095356542 12:41281293-41281315 TTGGAGTAGAAGAGGCATTCTGG - Intronic
1095381062 12:41592663-41592685 TTGAAGTAGAAGTAGGAGTAGGG + Intergenic
1098725565 12:73961638-73961660 TTTGATTAGAATAAGTAGTATGG - Intergenic
1100028238 12:90154252-90154274 TTGGAGGAGAAGAGGCAGTCTGG - Intergenic
1100161346 12:91864632-91864654 ATTGAGCAAAAGAAGCAGCAAGG + Intergenic
1101690533 12:107075897-107075919 TTTGAGTACAAAAAGAAGAAAGG + Intronic
1102709144 12:114910008-114910030 TTTGAGGAGAAAAAACAGAATGG - Intergenic
1102792887 12:115662274-115662296 TTTGAGTACAAGAAGCTTTGGGG - Intergenic
1103891100 12:124239703-124239725 TATGAGTACAAGAAACAGTGGGG - Intronic
1105286190 13:19006788-19006810 TTTGAGGAGAAGAGGCATTCTGG + Intergenic
1105314100 13:19241969-19241991 TACAAGTAGAAGAAGCAGCAGGG + Intergenic
1105645678 13:22315508-22315530 TTGGAGGAGAAGAAGCATTCTGG + Intergenic
1106733250 13:32563546-32563568 TCTGAGTAGATTAAGCAGAAGGG - Intergenic
1106919648 13:34549744-34549766 TTTAAGTAGAGGAATCAGAAAGG - Intergenic
1107654833 13:42581104-42581126 TCTGAGGAGGAGAAACAGTAAGG - Exonic
1108130151 13:47290257-47290279 TTTGGGTAGAAGTAGAAGTGTGG + Intergenic
1108858316 13:54822713-54822735 TTGGAGGAGAAGAAGCATTCTGG - Intergenic
1109644920 13:65241225-65241247 TTAGAGTAGAAAAAGTAGAAGGG - Intergenic
1109756732 13:66770711-66770733 TATGAGTAGAAGAGGCTGTCTGG - Intronic
1109968866 13:69738325-69738347 TTGGAGAAGAAGAAGCACTCTGG - Intronic
1110017790 13:70429881-70429903 TTTAAGTAGAAAAAGCAGGCCGG - Intergenic
1110797569 13:79657845-79657867 TTTGAGTGGAAGACCCAGTGGGG + Intergenic
1111092299 13:83462891-83462913 TTTGAGGAGAAGAGGCACTTTGG - Intergenic
1111722691 13:91966647-91966669 TTTGACTAGAAGAGTCAGTGAGG - Intronic
1113130899 13:107035646-107035668 TTTGATTTTAAGAAGCAGAAAGG - Intergenic
1114502232 14:23179116-23179138 TTTGAGGAGAAGATGAAGTAGGG - Intronic
1114961827 14:27901475-27901497 TTGGAGTAGGAAAAGCAGAAAGG + Intergenic
1115265493 14:31495479-31495501 TTGGAGGAGAAGAAGCATTCTGG - Intronic
1115378128 14:32701594-32701616 ATAGAGTACAAGAAGAAGTATGG + Intronic
1115828242 14:37301749-37301771 TTTGAGTAGAAGAAGCAGTAGGG - Intronic
1116439532 14:44936507-44936529 TTTCAGTAGAATAAGAGGTAAGG + Intronic
1117123580 14:52595881-52595903 TTGGAGGAGAAGAGGCAGTCTGG + Intronic
1117892746 14:60444125-60444147 TTTGAGGAGAAGAGGCACTCTGG - Intronic
1118297239 14:64581743-64581765 TTTTAGTAGAACCAGCAGTTTGG + Intronic
1118635062 14:67741115-67741137 TTGGAATAAAAGAAGCAGTTGGG - Intronic
1119329675 14:73784759-73784781 TTTGAGCAAAAGCAGCACTATGG - Intronic
1120079750 14:80202520-80202542 TTTGAGTAGTGAAAGAAGTATGG + Intronic
1121936038 14:98019832-98019854 CTTGAGGAGAAGCAGCAGGATGG - Intergenic
1121953136 14:98189647-98189669 TTTCACTAGAAGAAACGGTAAGG + Intergenic
1122524000 14:102367176-102367198 TTTGAGTAGAATGGGTAGTATGG + Intronic
1123688748 15:22819582-22819604 TTGCAGTAGTAGAAGTAGTATGG - Intronic
1124438908 15:29673150-29673172 TTAGAGTATAATAAGCAGTGAGG + Intergenic
1126715153 15:51508067-51508089 TTTCATTAGAAGAAACAGTCTGG + Intronic
1126854549 15:52825046-52825068 TTGGAGGAGAAGAAGCACTCTGG - Intergenic
1126956360 15:53936960-53936982 TTGGAGGAGAAGAGGCACTATGG - Intergenic
1129915632 15:79267467-79267489 TTTGAGTAGCTGAGGCAGGAAGG + Intergenic
1129987903 15:79934952-79934974 CTTTAGTACAAGAAGCAGGAAGG + Intergenic
1137792735 16:51188447-51188469 TTTGATTAAAAGAAAAAGTATGG + Intergenic
1138104799 16:54282309-54282331 TTTGACTTGAAGAAGTTGTAGGG - Intergenic
1138151671 16:54662741-54662763 TTTGAGGAGAAGAAGCATTCTGG - Intergenic
1138824813 16:60306387-60306409 TTTGAATAGTATAAGCAGAAAGG - Intergenic
1139089695 16:63630334-63630356 TTTGAGTTAAAGAAGGAGAAGGG + Intergenic
1139256567 16:65548528-65548550 TCTGAGTAGAAGGAGAAGTAAGG - Intergenic
1139484318 16:67247452-67247474 TTTGAGTAGAAGCTGCACTGGGG - Exonic
1140218912 16:73029374-73029396 CTTTAGTAGAAGGAGCAGCATGG - Intronic
1141275545 16:82584645-82584667 ATGGAGAAGAAGAAGAAGTAGGG + Intergenic
1146169896 17:30624896-30624918 TTTGACTAAAAGAAGCGGCAGGG + Intergenic
1146343349 17:32040926-32040948 TTTGACTAAAAGAAGCGGCAGGG + Intronic
1146607970 17:34278108-34278130 TTGGAGTAGAAGAGGCATTCTGG - Intergenic
1147270957 17:39270714-39270736 TTTCAGAAGAACAAGCAGCAAGG - Intronic
1148526222 17:48338595-48338617 TTTTAGTGAAAGAAGCATTATGG + Intronic
1149629893 17:58114063-58114085 ATTGAGTAGAATATGCAGGAAGG - Intergenic
1149653531 17:58295137-58295159 TTTCTGTAGAAGATGCCGTATGG - Intergenic
1150065867 17:62108942-62108964 TTTGAGTTGAAGAACCTATACGG - Intergenic
1150782596 17:68135084-68135106 TTTGACTAAAAGAAGCGGCAGGG - Intergenic
1151305009 17:73257686-73257708 TTGGAGTAGAAGTAGCACTCAGG + Exonic
1153936540 18:9930585-9930607 TTGGGGTTGAAGAAGCAGCAAGG + Intronic
1154082098 18:11267687-11267709 TTTTAGTAGAAACAGAAGTAGGG + Intergenic
1154964088 18:21339295-21339317 TTAGAATAGAAGAAACAATATGG - Intronic
1155429951 18:25744516-25744538 TTGGAGGAGAAGAGGCAGTCTGG - Intergenic
1155705812 18:28810793-28810815 TTTGAGTAGTTGATTCAGTAGGG + Intergenic
1155746003 18:29356955-29356977 TTTGAAAAGAAGGAGCTGTAAGG - Intergenic
1156028190 18:32681385-32681407 TTTTAGTAGAAGAAATAGAAAGG + Intronic
1157130353 18:45001591-45001613 TTTGAGGAGGAGCAGCAGGAAGG + Intronic
1157627977 18:49067419-49067441 GTTCAGTAGAGGAAGGAGTAGGG + Intronic
1157781830 18:50446324-50446346 TTTGAGTAGAAGCCCCAGGAGGG - Intergenic
1158729043 18:60003061-60003083 TTGGAGGAGAAGAGGCAGTCTGG + Intergenic
1158731068 18:60022962-60022984 TTTAAGAAGAAGAAGCAAGAAGG + Intergenic
1160480563 18:79236595-79236617 TTTGTATATAAGAAGAAGTAGGG + Intronic
1162688586 19:12409488-12409510 ATTGAGTAGAAAAATCACTAAGG + Intronic
1163189660 19:15667258-15667280 TTTGAATTCAAGAAGCAGAAGGG + Intergenic
1167496935 19:49825078-49825100 CTTGAACAGAAGAAGCACTATGG - Intronic
1167724017 19:51198994-51199016 TTTGAGGAGAAGATGGAGCAGGG - Intergenic
925042346 2:741432-741454 TTTCAGTGCAAGAAGCAGTCTGG - Intergenic
925820018 2:7791153-7791175 TTTGTGCAGAAGGAGCAGTAAGG + Intergenic
926475242 2:13314023-13314045 TTAGGGTAGAAGAAGCATTCTGG + Intergenic
928488400 2:31755435-31755457 TTGGAGGAGAAGAAGCACTCCGG - Intergenic
929617219 2:43321274-43321296 TGTGAGTAGTAGAGACAGTAGGG + Intronic
930219201 2:48728446-48728468 CCTGAGTAAAAGCAGCAGTAGGG + Intronic
930223226 2:48766948-48766970 TTGGAGTAGAAGAGGCATTCTGG + Intronic
930533753 2:52621561-52621583 TTTCATTAGAAGAAGCTGTCAGG + Intergenic
930994625 2:57701433-57701455 TTTGCACAGAAGAAACAGTAGGG - Intergenic
931421395 2:62131304-62131326 TTTCAGTAAAGGATGCAGTATGG - Intronic
931479015 2:62621449-62621471 TTAGAGTAGAAGAGGCATTCTGG + Intergenic
931653987 2:64493246-64493268 CCTGAGCAGAAGAAGAAGTAAGG + Intergenic
934514127 2:94974189-94974211 TTTAAGCAGAAGACACAGTAAGG - Intergenic
935603393 2:104945736-104945758 TTTCTTTAGGAGAAGCAGTAAGG + Intergenic
936687072 2:114840273-114840295 TTTGAAAGGAAGAAGGAGTAAGG + Intronic
937573639 2:123392753-123392775 TTGGAGGAGAAGAAGCATTCTGG - Intergenic
938193517 2:129304138-129304160 TTTGAGTAGAGAAAGCAGGAGGG - Intergenic
939537902 2:143455304-143455326 TTAGTGTATAAGGAGCAGTAAGG + Intronic
939617940 2:144381222-144381244 TTTAAATAGAGGAAGCAGCAGGG + Intergenic
939836091 2:147131356-147131378 TTTGAGCAGTAGAAACAATATGG + Intergenic
940134307 2:150418592-150418614 TTGGAATGGAAGAAACAGTAAGG + Intergenic
940615957 2:156048523-156048545 TTGGAGGAGAAGAAGCACTCTGG - Intergenic
941904554 2:170708136-170708158 TTCGAGTTTAAGAAGCAGTGAGG - Intergenic
941950827 2:171154677-171154699 ATGAAGTAGTAGAAGCAGTATGG - Intronic
942074866 2:172348234-172348256 TTGGAGTAGAAGAATAAGTTCGG + Intergenic
942588124 2:177509358-177509380 TTTGAGTAGTAGAAATAGTTTGG + Intronic
943630178 2:190242484-190242506 TTGGAGGAGAAGAGGCATTATGG + Intronic
944294686 2:198048922-198048944 TTTGTGTAGAAGAAGAACTTGGG + Intronic
944984990 2:205166379-205166401 TTTGGGTAGAAGAAAGAATATGG + Intronic
946065199 2:216981771-216981793 TTGGAGTAGAAGAGGCATTCTGG + Intergenic
946083861 2:217151327-217151349 TTTGATGGGATGAAGCAGTAAGG - Intergenic
947335256 2:229075930-229075952 GGTGAGTAGAAGCAGTAGTAAGG - Intronic
947603051 2:231466077-231466099 TTTAGGTAGAAGCAGCAGCAGGG + Intronic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
1170308995 20:14972185-14972207 ATTGAGTAGAAAGAGCACTATGG - Intronic
1170351412 20:15446148-15446170 TTTGGCTAGAAGCAGCAGTTTGG - Intronic
1173527283 20:43742908-43742930 TTAGTGTAGAGGAAGCAGAATGG - Intergenic
1173751438 20:45479920-45479942 TCTGGGTAGAAAAAGGAGTAAGG - Exonic
1174259127 20:49280656-49280678 TTTGAGTCGTACAAGAAGTAGGG - Intergenic
1174797513 20:53534550-53534572 GTTGAGTCCAAGAAGCAGTGTGG - Intergenic
1177388229 21:20434038-20434060 TTGGAGGAGAAGAAGAAATACGG - Intergenic
1177388740 21:20440073-20440095 TAAAAGTAGAAGAAGCAGAAGGG + Intergenic
1177628576 21:23698287-23698309 TTTGGGGAAAAGAATCAGTAAGG + Intergenic
1177691256 21:24510565-24510587 TGTTTCTAGAAGAAGCAGTATGG + Intergenic
1177693660 21:24542915-24542937 TGGGAGCAGAAGAAGTAGTATGG + Intergenic
1178032821 21:28547071-28547093 TCAGAGTAGAAGAACCAGTAAGG - Intergenic
1178521997 21:33294307-33294329 TTTGAGTTAAAAAAGCACTAGGG + Intronic
1178692839 21:34763978-34764000 GTTGAGTAGAAAAGGCAGCAGGG - Intergenic
1182195039 22:28506989-28507011 TTTGAGGAGAAGAGGCACTCTGG - Intronic
1182799533 22:33020303-33020325 ATTGAGAAGAAGAAGAAGTGAGG - Intronic
1183475569 22:38034119-38034141 TGGGAGTAGAGGAAGCAGAAGGG - Intronic
1183821335 22:40348211-40348233 CTTGAGGGGAGGAAGCAGTATGG + Intronic
949870051 3:8580674-8580696 GTTGAGTAGGAGAAGAACTATGG + Intergenic
949950213 3:9222836-9222858 TTGGAGTACAAGAAGCGGAAGGG - Intronic
949971548 3:9410689-9410711 TTTTAGCAGAAGAAGCATTTAGG + Intronic
951000102 3:17548491-17548513 TTTGGGTAGAAGATGCACAAAGG - Intronic
951300839 3:20994614-20994636 TTTTAGGAGAAAAAGCATTAGGG + Intergenic
952822110 3:37494497-37494519 CTAGAGTATAAGAAGAAGTACGG + Exonic
955838377 3:63084047-63084069 TTTGTGAAGATGAAGCAGGAAGG + Intergenic
956178571 3:66497599-66497621 TGTGAATAGAAGAAACAGAATGG - Intronic
956844645 3:73171378-73171400 TTTTAGGTGAAGAGGCAGTATGG + Intergenic
956879875 3:73499710-73499732 TTAGATTACAAAAAGCAGTAAGG + Intronic
957553558 3:81736960-81736982 ATGGAGTAGTAGAAGCAGGAAGG + Intronic
957934349 3:86923238-86923260 TTTGAGTAGAATCTGCAGTCTGG + Intergenic
958492821 3:94799211-94799233 TTTGAGAAGTTGAAGCAGGAGGG - Intergenic
958742798 3:98095473-98095495 TTGGAGGAGAAGAAGCACTCTGG + Intergenic
962003097 3:131320634-131320656 TTTCAGTAGAGGATGCTGTATGG + Intronic
963756116 3:149236286-149236308 TTGGAGTAGAAGAGGCACTCTGG - Intergenic
964371247 3:156003148-156003170 TTTGAGGAGAAGAGGCATTCTGG + Intergenic
964377910 3:156068226-156068248 TTGGAGGAGAAGAAGCATTCTGG + Intronic
964415658 3:156444967-156444989 ATTGAGTAAAAGAAGAAGAAAGG + Intronic
964784926 3:160386084-160386106 TATAAATAGTAGAAGCAGTATGG + Intronic
965727750 3:171736875-171736897 TTGGACTAGAAGAAGCTGTTAGG - Intronic
967662611 3:192131727-192131749 TTTGAGAAGAAGAAAAACTAAGG + Intergenic
968077190 3:195822635-195822657 TTTGAGAAGCAGAAGCAATGAGG + Intergenic
970871101 4:20817898-20817920 TATGAGGAGAAGGAGCAGTTGGG + Intronic
971088293 4:23306299-23306321 TTTGAGGAGAAGGAGCCATAGGG - Intergenic
971429934 4:26555575-26555597 TTTGAGGAGAAGAGGCATTCTGG + Intergenic
972720292 4:41689813-41689835 TCAGATTAGAAGAAGCAGAAAGG + Intronic
973178568 4:47240226-47240248 TTTGAGAGGAAGAAGGAGCAAGG + Intronic
974014124 4:56633731-56633753 TTGGTGGAGAAGAAGCACTAGGG - Intergenic
974302182 4:60082364-60082386 TTGGAGGAGAAGAGGCATTATGG - Intergenic
974864527 4:67563814-67563836 TTTGAGTTTGAGAAGCAGCATGG - Intronic
976543375 4:86304325-86304347 TTTGAATAGATTAAGCATTAAGG - Intronic
976580427 4:86729905-86729927 TTGGAGGAGAAGAAGCACTCTGG + Intronic
976786102 4:88823339-88823361 ATTGAGGAGCAGAAGGAGTAGGG - Intronic
976798568 4:88961684-88961706 GGTGTGTGGAAGAAGCAGTAGGG + Intronic
976807260 4:89062389-89062411 TTTGAGTACCAGAAGGAGAAGGG - Intronic
977092612 4:92697397-92697419 TTTGAGTAGAAAATTGAGTAGGG + Intronic
977825611 4:101527968-101527990 ATTTGGTAGAAGAAGCAGTTTGG + Intronic
977888009 4:102274026-102274048 TTGGAGGAGAAGAAGCATTCTGG - Intronic
978150409 4:105427276-105427298 TTTGAGGAGAAGAGGCATTCTGG - Intronic
979668842 4:123341493-123341515 TTTGAGTAGAAGGAACAGATGGG + Intergenic
979844346 4:125489877-125489899 TGGGAGAAGAAGAAGGAGTAAGG - Intronic
980093718 4:128468017-128468039 TCTGAGTGGAGGAAGCAGTATGG - Intergenic
980114102 4:128662869-128662891 TTTGAGAAGGAGCAGCAGGAGGG - Intergenic
980684871 4:136214226-136214248 TTTGAGATGATCAAGCAGTAAGG + Intergenic
980787288 4:137572140-137572162 TTGGAGTAGAAGAGGCACTCTGG + Intergenic
981666931 4:147239102-147239124 TTTGAGTAGAAGAAGCAACATGG - Intergenic
981758206 4:148164327-148164349 TTTTAATAAAAGAAGTAGTAGGG - Intronic
983047358 4:163003780-163003802 TTGGAGTAGAAGAGGCATTCTGG + Intergenic
984055627 4:174926021-174926043 TTTGTGTAAAAAAAGGAGTATGG + Intronic
984835069 4:184011775-184011797 TTTGAGTAGAATAAATAGTCTGG + Intronic
985313694 4:188631634-188631656 TTGGAGTAGAAGTAGCACTCGGG - Intergenic
986432377 5:7693824-7693846 TTTGAGCACAAGAAGCACTGTGG + Intronic
987490242 5:18571077-18571099 ATTGATTAGAAGAAGAAATAGGG + Intergenic
987939849 5:24519902-24519924 TTCCAGTAGCAGAAGCAGCAAGG - Intronic
988816148 5:34837004-34837026 ATTGCATAGAGGAAGCAGTATGG - Intergenic
989409259 5:41098824-41098846 TTTGTGTAGATGAGGCAGAATGG + Intergenic
989671049 5:43917470-43917492 TTGGAGGAGAAGAAGCACTCTGG + Intergenic
990230206 5:53705248-53705270 TTTGAGAAGAAGAGGCACTCTGG + Intergenic
990619985 5:57549479-57549501 TTGGAGGAGAAGAAGCACTCTGG + Intergenic
990647423 5:57859913-57859935 TTTAAGGAGCAGAACCAGTATGG + Intergenic
991915061 5:71597435-71597457 TGTGAGTAGATGGAGCAGCAAGG + Intronic
991917590 5:71620346-71620368 TTTGAATTGAAAAAGAAGTAAGG + Intronic
991917945 5:71623927-71623949 TTTGAGTAGGGGAAGAAGGATGG - Intronic
992483440 5:77173537-77173559 TTTGGGGAGAAGAAACAGAAGGG + Intergenic
993143105 5:84059069-84059091 TGTGAGTATAAGAAAAAGTAAGG + Intronic
993565091 5:89464260-89464282 TTTGAGTAGGAAAAGCAGAAAGG + Intergenic
994437943 5:99762860-99762882 TTTGAGGAGAAGAGGCATTCTGG + Intergenic
994802399 5:104395840-104395862 TTGGAGGAGAAGAAGCATTCTGG - Intergenic
995567904 5:113450998-113451020 TTAGAATAAAAGAAGCAGAAAGG - Intronic
995666292 5:114545558-114545580 TTGGAGGAGAAGAGGCAGTCTGG - Intergenic
995694933 5:114867848-114867870 TTGGAGGAGAAGAAGCACTCTGG - Intergenic
995790530 5:115882264-115882286 TTGGAGGAGAAGAGGCAGTCTGG + Intronic
995960040 5:117829005-117829027 TTGGAGGAGAAGAGGCAGTCTGG + Intergenic
996207585 5:120760681-120760703 TTTGTGTAGAATAAGCTGCAAGG + Intergenic
996970035 5:129356034-129356056 CTTGAGATGAAGAAGCAGAAAGG - Intergenic
997928840 5:138055551-138055573 TTTGAAAACAAGGAGCAGTAGGG - Intergenic
998342547 5:141431109-141431131 ATGGAGTAGAAGTAGAAGTAAGG + Exonic
999074963 5:148786788-148786810 CTGGAATAGAAAAAGCAGTAGGG + Intergenic
999106263 5:149073899-149073921 TTGGAGTAGAAGAGGCATTCTGG - Intergenic
999969280 5:156842981-156843003 TTTAAGTAGAAAAAGCAGGTTGG + Intergenic
1000112109 5:158118119-158118141 TTTGAGTAGATGAAGTATTTAGG + Intergenic
1001367716 5:171160970-171160992 TTTTAGTAGAAGTAGAAGCAGGG + Intronic
1001654287 5:173337465-173337487 TTTGGGTAGGAGAAGGAATAAGG - Intergenic
1003998145 6:11564784-11564806 TTTGGGTAGCTGAAGCAGAAAGG - Intronic
1004524116 6:16390160-16390182 TTAGAGTACTAGTAGCAGTAGGG - Intronic
1005778245 6:29161086-29161108 TTTGAGTAGAAGAGGCATTCTGG + Intergenic
1006020652 6:31115830-31115852 TTTGAGAAGAGGAAGGAGGAAGG + Exonic
1008499513 6:52166953-52166975 ATTGAGGAGAGGAAGCAGTGGGG - Intergenic
1008977423 6:57444257-57444279 TTTGAGTAGAATAAAAATTATGG + Intronic
1009165559 6:60337208-60337230 TTTGAGTAGAATAAAAATTATGG + Intergenic
1009336186 6:62493097-62493119 TTGGAGTAGAAGAAGCATTCTGG - Intergenic
1009570303 6:65375465-65375487 TTGGAGGAGAAGAAGCATTCTGG - Intronic
1009652183 6:66490124-66490146 TTGGAGGAGAAGAAGCATTGTGG - Intergenic
1010282868 6:74040879-74040901 TTGGAGGAGAAGAAGCACTCTGG + Intergenic
1010961615 6:82151996-82152018 TTGGAGGAGAAGAAGCACTCTGG - Intergenic
1011377531 6:86706176-86706198 TTGGAGGAGAAGAGGCAGTCTGG + Intergenic
1011865899 6:91826561-91826583 GTTGAGTAGAGGAAGGAGGAAGG - Intergenic
1013838593 6:114362386-114362408 TTAGAGAAGAAGAAGCAGGTAGG + Intergenic
1013975268 6:116070240-116070262 TTTGAGAAGAAGCAGCTGTGTGG - Intergenic
1014455363 6:121627384-121627406 TTTGATTAAAAGAAGCAGAAAGG - Intergenic
1014922553 6:127229568-127229590 TTGGAGGAGAAGAAGCATTCTGG - Intergenic
1015049618 6:128823959-128823981 TTTGAGTAGAAGTTGCCGCAAGG + Intergenic
1015433100 6:133154127-133154149 TTGGAGGAGAAGAAGCATTCTGG + Intergenic
1015829300 6:137350626-137350648 ATTGCGTTGAAGAAGCAGCAGGG + Intergenic
1018457101 6:163962371-163962393 CTTGAGTGGAAGATGCAGAAAGG + Intergenic
1019167646 6:170109162-170109184 TTTAAGGAGAAGAAGGACTAAGG - Intergenic
1020970573 7:14932385-14932407 TTTAAGTAGATGAAGCATGATGG + Intronic
1021163495 7:17304920-17304942 TTTGCGTAGAAGAAGGGGGAGGG + Intronic
1021916912 7:25443388-25443410 TTGGAGGAGAAGAAGCACTCTGG + Intergenic
1024105701 7:46083037-46083059 TCTGAGTAGAACAAACAGAAAGG + Intergenic
1025797793 7:64756178-64756200 ATTGGGTAGAAAAAGCAGGAAGG - Intergenic
1027940933 7:84678470-84678492 CTTCAGTAGAATAAGCAATAGGG - Intergenic
1028599055 7:92580887-92580909 TTTGAGTTAAATAAGAAGTAAGG - Intronic
1028648381 7:93122417-93122439 TTGGAGTAGAAGAGGCATTCTGG - Intergenic
1028812090 7:95099115-95099137 TTGTAGTAAAAGAAGCAGGAAGG + Intronic
1028998250 7:97125897-97125919 TTGGAGGAGAAGAAGCATTCTGG + Intronic
1029041574 7:97581166-97581188 TTGGAGGAGAAGAAGCACTCTGG - Intergenic
1029282915 7:99448246-99448268 TTGGAGTAGAAGTAGCACTCGGG - Exonic
1030469601 7:109947122-109947144 TTGGAGGAGGAGAAGAAGTAGGG - Intergenic
1030534155 7:110744827-110744849 TTGGAGGAGAAGAAGCATTCTGG - Intronic
1030701446 7:112646154-112646176 TTGGAGGAGAAGAAGCACTCTGG + Intergenic
1031426351 7:121610194-121610216 GTTTAATAGAAGAAGGAGTAAGG - Intergenic
1031552783 7:123135048-123135070 TTGGGGTAGAAGAAACAGAAAGG - Intronic
1031905139 7:127452023-127452045 TTGGAGGAGAAGAGGCAGTCTGG - Intergenic
1032214890 7:129950345-129950367 TTTTAGTAGAAGATGAAGAAAGG - Intronic
1032585123 7:133139340-133139362 TCTGAGTAGCAGCAGCAGAAGGG + Intergenic
1034135440 7:148763517-148763539 TTTGAGGAACAGAAGCATTAAGG - Intronic
1034574368 7:151984693-151984715 TTTGAGCAGAAGAGGCAGCGTGG - Intronic
1035435383 7:158855854-158855876 TTTGATAAAAACAAGCAGTAAGG - Intergenic
1037575620 8:20199531-20199553 TTTGAGTAGAATAAAAAATATGG - Intronic
1037773535 8:21817676-21817698 TTTGACTGCAAGAAGCAGTAAGG - Intergenic
1040444312 8:47478093-47478115 TGTGAGGAAAAGATGCAGTATGG + Intronic
1041037374 8:53808081-53808103 TTTGTGTTGCAGAAGCAGTCTGG - Intronic
1041114317 8:54519911-54519933 TTTGAAAAGAAGAATCAGAAGGG + Intergenic
1041323196 8:56636396-56636418 TTGGAGGAGAAGAGGCAGTCTGG + Intergenic
1042089242 8:65140759-65140781 TTTGAGCAGAGAAATCAGTAAGG + Intergenic
1043532558 8:81166740-81166762 TTGGAGGAGAAGAAGCATTCTGG - Intergenic
1045475886 8:102551884-102551906 TTGGAATAGCACAAGCAGTACGG - Exonic
1046185342 8:110707397-110707419 TTTGAGTAGCAGAATCATAAAGG - Intergenic
1047048950 8:121087926-121087948 TGTGAGTAGAATAAGAAGAAAGG - Intergenic
1048787603 8:138066961-138066983 TTGGAGAAGCAGAAGCAGAAGGG + Intergenic
1050130027 9:2402733-2402755 TTGGAGAAGAAGAGGCATTATGG + Intergenic
1050726273 9:8652794-8652816 TTTGAGTAACAGAAGCATTTGGG + Intronic
1050823104 9:9907800-9907822 TTTCATTACAAGAATCAGTAGGG - Intronic
1051998587 9:23248816-23248838 TTGGAGGAGAAGAAGCATTCTGG - Intergenic
1052273668 9:26654254-26654276 GTTGAGTTGTAGAAGCAGCATGG + Intergenic
1052602958 9:30661791-30661813 TGTGAGGAGAAAAAGCTGTAGGG - Intergenic
1054457426 9:65441494-65441516 TTTGATTGCAAGCAGCAGTATGG - Intergenic
1055773820 9:79746249-79746271 TTTGAGTGGCAGAAGCACTTAGG + Intergenic
1056016234 9:82391233-82391255 TTGGAGGAGAAGAAGCTGTCTGG + Intergenic
1060553818 9:124498369-124498391 TTTGAGAAGGGGAAGCAGGAAGG + Intronic
1186209430 X:7234014-7234036 TTTGAGGAGAAGAAAAAGCAAGG - Intronic
1186913279 X:14192871-14192893 TTGGAGGAGAAGAAGCACTCTGG + Intergenic
1186919497 X:14262513-14262535 TTTGGGTAGAAGAAGGAAGAGGG - Intergenic
1187140244 X:16586308-16586330 TTTGAGTATAATGAGCAGTGAGG - Intergenic
1187850083 X:23583104-23583126 TTTGGGTAGAAGAAGGAAGAGGG + Intergenic
1188454032 X:30341273-30341295 TTTGAGTGGCAGAAGCACTTAGG + Intergenic
1188915333 X:35903916-35903938 TTGGAGTAGAAGAGGCATTTTGG + Intergenic
1189144745 X:38644092-38644114 TTTGAGAAGAAGAGGGAGTTTGG - Intronic
1189551050 X:42094205-42094227 TTTGGGGAGAAAAAGCAATAGGG + Intergenic
1189652209 X:43202867-43202889 TTGGAGGAGAAGAAGCACTCTGG + Intergenic
1189903079 X:45728292-45728314 TTTGAGTGGAGGAAGCACTTTGG - Intergenic
1191115504 X:56847830-56847852 TTGGAGGAGAAGAAGCATTCTGG - Intergenic
1192537577 X:71941416-71941438 TGTGAGTAAAACAAGCAGAATGG + Intergenic
1193035974 X:76951429-76951451 TTTGAGGAGAAGAGGCACTCTGG - Intergenic
1193768423 X:85560480-85560502 TTGGAGGAGAAGAAGCACTTTGG + Intergenic
1193780683 X:85698254-85698276 TTGGAGGAGAAGAAGCACTTTGG + Intergenic
1194281263 X:91957319-91957341 TTGGAGGAGAAGAAGCACTCTGG + Intronic
1194315162 X:92368559-92368581 TTGGAGGAGAAGAAGCATTCTGG + Intronic
1194405823 X:93494540-93494562 TTGGAGTAGAAGAGGCACTCTGG - Intergenic
1194524793 X:94966230-94966252 TGTGGGTAGAAGGAGCAGTGGGG - Intergenic
1194623144 X:96197365-96197387 TTGCAGGAGAAGAAGCAGTCTGG - Intergenic
1194783014 X:98048417-98048439 TTGGAGGAGAAGAGGCATTATGG + Intergenic
1195808474 X:108801900-108801922 TTGGAGGAGAAGAAGCACTCTGG - Intergenic
1195810504 X:108824284-108824306 TTGGAGGAGAAGAAGCATTCTGG + Intergenic
1196038407 X:111173360-111173382 TTTCTCTAGAAAAAGCAGTAGGG + Intronic
1196600008 X:117590547-117590569 TTGGAGGAGAAGAAGCACTCTGG - Intergenic
1196603618 X:117629877-117629899 TATGATTAGAAAATGCAGTAGGG - Intergenic
1196960093 X:120992111-120992133 TTGGAGGAGAAGAAGCATTCTGG + Intergenic
1197146960 X:123182488-123182510 TTTCAGTGGAAGAAGCATTAGGG - Intergenic
1198072282 X:133160414-133160436 TTGGAGGAGAAGAAGCATTCTGG - Intergenic
1198244662 X:134818576-134818598 TTTCAGTAGAAGGAGGAGTGGGG + Intronic
1198295272 X:135281550-135281572 TTTGAGGAAAAGAGGCATTACGG + Intronic
1199092633 X:143709610-143709632 ATTGAGTAAAAGATACAGTATGG + Intergenic
1200365290 X:155656659-155656681 TTGGAGGAGAAGAAGCATTCTGG + Intronic
1200598853 Y:5181983-5182005 TTGGAGGAGAAGAAGCACTCTGG + Intronic
1200623213 Y:5480095-5480117 TTGGAGGAGAAGAAGCATTCTGG + Intronic
1200871950 Y:8111318-8111340 TTTGAGTAGAGGTAGGGGTATGG - Intergenic
1201955646 Y:19619528-19619550 TTTGAGTAGAAGTGGAGGTATGG - Intergenic
1202244019 Y:22797735-22797757 TTTGAGTAGAGGAAGGAGTGTGG + Intergenic
1202397007 Y:24431485-24431507 TTTGAGTAGAGGAAGGAGTGTGG + Intergenic
1202473776 Y:25238607-25238629 TTTGAGTAGAGGAAGGAGTGTGG - Intergenic