ID: 1115832827

View in Genome Browser
Species Human (GRCh38)
Location 14:37361636-37361658
Sequence TTGCCTCTCTCGCAGTCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115832826_1115832827 12 Left 1115832826 14:37361601-37361623 CCTCTCTCTCTTTTTTTTTTTTT 0: 115
1: 566
2: 3875
3: 23720
4: 87212
Right 1115832827 14:37361636-37361658 TTGCCTCTCTCGCAGTCTGAAGG 0: 1
1: 0
2: 0
3: 15
4: 104
1115832824_1115832827 27 Left 1115832824 14:37361586-37361608 CCTTTTTTGTTTCTCCCTCTCTC 0: 1
1: 2
2: 78
3: 694
4: 4005
Right 1115832827 14:37361636-37361658 TTGCCTCTCTCGCAGTCTGAAGG 0: 1
1: 0
2: 0
3: 15
4: 104
1115832825_1115832827 13 Left 1115832825 14:37361600-37361622 CCCTCTCTCTCTTTTTTTTTTTT 0: 91
1: 488
2: 2683
3: 15559
4: 73806
Right 1115832827 14:37361636-37361658 TTGCCTCTCTCGCAGTCTGAAGG 0: 1
1: 0
2: 0
3: 15
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115832827 Original CRISPR TTGCCTCTCTCGCAGTCTGA AGG Intronic
904402447 1:30265779-30265801 TTGCGTGTCTCGCAGTCTGTGGG - Intergenic
909879241 1:80852212-80852234 TTGCCTCTCTTCCAGTATTAAGG + Intergenic
910162186 1:84285288-84285310 TTTATTCTCTCCCAGTCTGAAGG + Intergenic
916567465 1:165993779-165993801 TTGACTTTCTCACAGTCTGAAGG - Intergenic
916663729 1:166947272-166947294 TTGTATCTGTGGCAGTCTGATGG - Intronic
917529197 1:175818763-175818785 TTCTCTCTCTCTCAGTCTGCTGG - Intergenic
918383650 1:183983744-183983766 TGGCCCCTCTCTCAGTCTGAAGG + Intronic
919453573 1:197799043-197799065 TTGCTCCTTTCCCAGTCTGAGGG + Intergenic
920216023 1:204361970-204361992 TTTCCTCTCTGGCAGGCAGAGGG + Intronic
921006114 1:211095119-211095141 TTGCCTCTCTAGCATCTTGATGG - Intronic
1063226257 10:4017744-4017766 TTGACTCTCTGGCAATTTGATGG + Intergenic
1063895975 10:10682503-10682525 TTGCTTCTTGCGCAGACTGAAGG + Intergenic
1067848910 10:49742958-49742980 AGGCCTCTCTCGCATTCTGCGGG - Exonic
1073282314 10:102363512-102363534 TTCCCTCTCTCTGAGTCTGAAGG - Intronic
1074025943 10:109635115-109635137 TTTCCTCTCTCGAAGAATGAAGG + Intergenic
1074102671 10:110365804-110365826 TTGCCTCTCAGGCAGTCTGTTGG - Intergenic
1075718199 10:124569210-124569232 TGGCCTGTCTCACAGTCTCAGGG - Intronic
1076285203 10:129288920-129288942 TTGCCTGTCTCAAAGCCTGAGGG - Intergenic
1078085150 11:8229473-8229495 TTGGCTCTGTCGCAGGCTGCTGG - Intronic
1080741795 11:35072090-35072112 TTGCCTCTTTCCCAATCTTAGGG - Intergenic
1083294427 11:61707492-61707514 CTGCCTCTCTCCCAGCCTGTGGG - Intronic
1089672955 11:120069145-120069167 TAGCCTCTCTTGCAGTTAGATGG + Intergenic
1093708357 12:22300646-22300668 TCTCCTCTCTCGAAGACTGAAGG + Intronic
1096977748 12:55708899-55708921 TTGCCTCTGTCCCAGCCTGAGGG - Intronic
1097884902 12:64719281-64719303 TTCCCTCTCTTACAGTCTGAAGG + Intronic
1098632490 12:72740923-72740945 TTGCTTCTTTCCCAGTCTGAGGG - Intergenic
1102001869 12:109562470-109562492 GTGGCTCTTTTGCAGTCTGAGGG + Intronic
1102816056 12:115867505-115867527 ATGCATCTATCTCAGTCTGACGG - Intergenic
1107821454 13:44289342-44289364 TTGCCTCTCCCGGTGTCTGGTGG + Intergenic
1108910015 13:55537270-55537292 TTCCTTCTCTGGCAGTGTGATGG + Intergenic
1115832827 14:37361636-37361658 TTGCCTCTCTCGCAGTCTGAAGG + Intronic
1118438107 14:65789681-65789703 CTGCCTCTGTCGCAGACAGATGG + Intergenic
1121502637 14:94450476-94450498 TTGCCTCTCTCCTAGTTTGCTGG - Intronic
1121516297 14:94553207-94553229 TTGCCTCTCTCTCTGTCTTGTGG + Intergenic
1122957326 14:105076775-105076797 TCGCCTCTCCCACAGCCTGAGGG - Intergenic
1124687523 15:31795238-31795260 TGGCCTCTCTCCCAGTCAGTGGG + Intronic
1125005622 15:34813302-34813324 TTCCCTATCTCGGTGTCTGAGGG + Intergenic
1127822680 15:62673812-62673834 ATGTCTCTCTCTTAGTCTGAAGG + Exonic
1131050708 15:89346108-89346130 TTGCTTCCCTCGCAGTCAGAGGG - Intergenic
1132997700 16:2831781-2831803 TTGCCTCTCTCCCAGTGTCCAGG + Exonic
1142930956 17:3283848-3283870 TTGTATCTCTAGCTGTCTGAGGG - Intergenic
1142944459 17:3412661-3412683 TTGTATCTCTAGCTGTCTGAGGG + Intergenic
1146582710 17:34053198-34053220 CTGCCTCTCTCTCAGGCTGGCGG + Intronic
1148752009 17:49950746-49950768 CTGCCTCTCTGACAGGCTGAAGG + Intergenic
1149653218 17:58291513-58291535 TTGCCTCATTCCCAGTCTTAGGG - Intergenic
1151618355 17:75229556-75229578 CTGTCTCTCTCTCACTCTGAAGG - Intronic
1152063710 17:78098226-78098248 TTGCCTATCACACAGTCTGCTGG + Intronic
1153045564 18:852756-852778 TTCCCTCTGTCGCAGTCTCAGGG - Intergenic
1153424279 18:4945334-4945356 TTGCTTCTTTCCCAGCCTGAGGG - Intergenic
1155639168 18:27992833-27992855 TTGTCTTTCTCGCAGTTTTATGG - Exonic
1158756180 18:60328306-60328328 TGGATTCTCTCACAGTCTGAAGG + Intergenic
1161548276 19:4895730-4895752 ATGCCTCTCTCCCACCCTGAGGG + Intronic
1161743110 19:6036812-6036834 TTGCCTTTTTCCCAGTCTTAAGG - Intronic
1162520017 19:11174167-11174189 ATGCCGCCCTCCCAGTCTGATGG - Intronic
1164904115 19:31953046-31953068 TTGCCTTCCTCAAAGTCTGAAGG - Intergenic
929863714 2:45700240-45700262 TTGCAGCACTCGAAGTCTGATGG + Intronic
935661551 2:105471042-105471064 TTGCCTCTCTCTCAGGCTGGTGG + Intergenic
937631092 2:124101951-124101973 TTGCCCCTCTCACAGGCTGGTGG + Intronic
938814526 2:134886673-134886695 TTGCCTCTCTCCCCATCTTAGGG - Intronic
941077032 2:161017484-161017506 TTGCCTCTCTCTCTTTCTGTGGG - Intergenic
944568314 2:201014644-201014666 TTCCATCTCTAGAAGTCTGAAGG - Intronic
945465121 2:210160261-210160283 TTGCCTCATTCCCAGTCTTAGGG - Intronic
947985468 2:234444024-234444046 TTTCTTCTCTCACAGTCTGGAGG - Intergenic
948724736 2:239927565-239927587 TTGCCACTCTCACAGCCTGGAGG + Intronic
948823874 2:240564977-240564999 CTGCCTCTCCCGCCGTGTGAGGG + Intronic
949053319 2:241909527-241909549 TTGCTTCTCTTGCTTTCTGAGGG - Intergenic
1172118468 20:32584667-32584689 TTGCCTTTCTCGCCGGCTGCGGG + Intronic
1172497546 20:35399238-35399260 TTGCTTCTCTGGCAGTTTGCTGG - Intronic
1173529228 20:43755855-43755877 CTGCCTCTCTCGCTGGCTAAGGG + Intergenic
1174929090 20:54793914-54793936 TTGCTCCTTTCCCAGTCTGAGGG + Intergenic
1178633235 21:34280678-34280700 TGGCCTCTCCCGCTGTCTGCAGG + Intergenic
1179055022 21:37923352-37923374 TTGCTTCTCCTTCAGTCTGAAGG + Intergenic
953682685 3:45051712-45051734 TTTCCTCACTCACAGGCTGATGG + Intergenic
957792949 3:84961919-84961941 GTGCCTCTCTCTCAGCCTGGAGG + Intronic
962360091 3:134733227-134733249 GTGCCTCACTCACAATCTGATGG + Intronic
964933266 3:162051361-162051383 TTTCCTCTCTCTCTGTCTGCTGG + Intergenic
965338766 3:167460083-167460105 TTGATTCTCTCACAGTCTGGAGG - Intronic
969697247 4:8741769-8741791 TTGATTCTCTCACCGTCTGAAGG - Intergenic
970613349 4:17745536-17745558 ATGGCTGTATCGCAGTCTGAGGG + Intronic
976089577 4:81442196-81442218 TTTCCTCTGTCGTAGTCTGATGG + Intronic
977905328 4:102471238-102471260 TTGCCTTGCTCCCAGTCTTAGGG - Intergenic
981424875 4:144591639-144591661 TTCTCTCTCTCCCAGCCTGATGG + Intergenic
985791012 5:1926761-1926783 CTGCCTCTCTTGCAGCCTCAGGG + Intergenic
986300340 5:6473515-6473537 CTGCCTCCCTTGCAGTCAGATGG - Intronic
996402844 5:123082177-123082199 ATGCCTCTCTCGCAGACTTTGGG - Intergenic
999566150 5:152864250-152864272 TTGCCTCACTTGGAGTCAGATGG + Intergenic
1004289238 6:14351306-14351328 TTGCCTCTCCCAGTGTCTGATGG + Intergenic
1006396744 6:33792218-33792240 TTTCCTCTCTCTAGGTCTGAGGG + Intergenic
1013041493 6:106438385-106438407 TTTTCTCTCTCACAGTCTGGGGG + Intergenic
1018088474 6:160325541-160325563 TTCCCTCTCTCTCAGCCTGAGGG + Intergenic
1022197492 7:28082919-28082941 TTGACTTTCTCACAGACTGAAGG - Intronic
1022524769 7:31029768-31029790 TTGCCTATCTGGCTGCCTGATGG - Intergenic
1026170619 7:67950861-67950883 TTGCATCTCTCGTGGTCTGTGGG + Intergenic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1029609225 7:101617875-101617897 TTGGCTCTGACCCAGTCTGATGG - Intronic
1030153228 7:106426792-106426814 TTGTCTCTCTCCCTTTCTGAAGG - Intergenic
1030185423 7:106757146-106757168 TGGCCTCTCTCTCAGTCTTCAGG + Intergenic
1034104943 7:148482221-148482243 CTGGAGCTCTCGCAGTCTGAAGG + Intergenic
1045743016 8:105384571-105384593 TTGCTTCTCTCACAATGTGATGG - Intronic
1046264862 8:111817479-111817501 TTGCCTCTTTTGCTGTGTGAAGG - Intergenic
1052501580 9:29298609-29298631 TGGCCTCACTCACAGGCTGAGGG + Intergenic
1056488548 9:87083407-87083429 TTGCATTTCACGCAGTTTGAAGG + Intergenic
1056568481 9:87795895-87795917 CTGCCCCTCTCGCAGTCTTGGGG - Intergenic
1056686162 9:88762277-88762299 TTGCCTTGCTCCCAGTCTTAGGG - Intergenic
1057421876 9:94919415-94919437 TTCCCTCCCACGCAGTCTCAGGG + Intronic
1057642279 9:96835996-96836018 TTGCTGCTCTCACAGGCTGAAGG - Intronic
1060197498 9:121633001-121633023 TTCCCTCTCTCCCAGACTGAGGG + Intronic
1060990575 9:127846539-127846561 TGGCCTCTCCCGCTGGCTGACGG - Intronic
1061043804 9:128153776-128153798 ATGCCCCTGTCGCACTCTGATGG - Intergenic
1061398374 9:130355507-130355529 CTGCCTCCCTGGCAGACTGAGGG - Intronic
1062401718 9:136375728-136375750 CTGCCTCTCTTGCAGGCTGGGGG + Exonic
1062455093 9:136632551-136632573 TTCACTCTCTCGCTGTCTGTGGG - Intergenic
1062455157 9:136633006-136633028 TTCACTCTCTCGCTGTCTGTGGG - Intergenic
1062455180 9:136633176-136633198 TTCACTCTCTCGCTGTCTGTGGG - Intergenic
1187497924 X:19812418-19812440 TTGCCCCACTCGCAGGCTAAGGG - Intronic
1190666207 X:52698039-52698061 TTTTCTCTCACGCAGTCTGTGGG + Exonic
1190673211 X:52760371-52760393 TTTTCTCTCACGCAGTCTGTGGG - Exonic
1191156794 X:57283196-57283218 TTGCTTCTTTCCCAGTCTGAGGG + Intergenic
1194899948 X:99497769-99497791 TTGTTTCTCTCCCAGACTGAGGG - Intergenic
1199154673 X:144533596-144533618 TTGCCTCTGAGGCAATCTGAGGG - Intergenic