ID: 1115845615

View in Genome Browser
Species Human (GRCh38)
Location 14:37530108-37530130
Sequence TTGGTAGCAGTGAGAATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 229}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115845615 Original CRISPR TTGGTAGCAGTGAGAATGGG AGG Intronic
900369393 1:2324663-2324685 GAGGTAGCAGTGAGGATGGGAGG + Intronic
900389989 1:2429585-2429607 TTGGGAGCAGTGAGAATTAGGGG + Intronic
900459182 1:2792537-2792559 TTAGTAGCAGTGAAATTGGCTGG + Intronic
902567374 1:17321112-17321134 TTGGTTGGAGTGATAAAGGGAGG + Intronic
902701396 1:18174902-18174924 ATGGTAGCAGTGAGCACTGGAGG + Intronic
903350631 1:22714307-22714329 TTCATAGCAGGGAAAATGGGTGG - Intronic
903652252 1:24929491-24929513 TCGGGAGCAGTGGGGATGGGAGG - Intronic
904763573 1:32823187-32823209 TTGTAAGGAGTTAGAATGGGGGG + Intronic
905312309 1:37058174-37058196 CTCTTAACAGTGAGAATGGGTGG + Intergenic
905404676 1:37724819-37724841 TCGGTAGCTGTGGGACTGGGTGG + Intronic
905813425 1:40929818-40929840 TGGGTGGCAGTGACACTGGGTGG + Intergenic
908210049 1:61890943-61890965 TTGGTGGCAGTGACAATGATAGG + Intronic
911596505 1:99804115-99804137 TTTGTAGCTTGGAGAATGGGTGG - Intergenic
912417666 1:109521149-109521171 TTGGTGGGAGGGAGAAAGGGCGG - Intergenic
913257195 1:116964219-116964241 TAGGTACCAGAGAGAATGGAAGG - Intronic
913558329 1:119992011-119992033 GTGGAAGCAGTGAGCCTGGGCGG - Intronic
913639512 1:120798440-120798462 GTGGAAGCAGTGAGCCTGGGCGG + Intergenic
914278936 1:146151501-146151523 GTGGAAGCAGTGAGCCTGGGCGG - Intronic
914539983 1:148602443-148602465 GTGGAAGCAGTGAGCCTGGGCGG - Intronic
914626663 1:149468774-149468796 GTGGAAGCAGTGAGCCTGGGCGG + Intergenic
915087689 1:153399206-153399228 TTGGAGGCATTGAGGATGGGTGG - Intergenic
916089707 1:161298430-161298452 TGGGTTGAAGAGAGAATGGGAGG + Intergenic
917408434 1:174733919-174733941 GTGGGAGCAGTGGGAATGGTAGG + Intronic
917869166 1:179227026-179227048 GTGGTGGCAGTGGAAATGGGAGG - Intronic
921290184 1:213649850-213649872 ATGGTGGCGGTGAGGATGGGAGG + Intergenic
921372923 1:214443975-214443997 GTGGTGGGAGTGAGAGTGGGAGG + Intronic
924308775 1:242719076-242719098 TTGGTAGCGGTGGGAATGTGTGG + Intergenic
924590800 1:245402393-245402415 AAGGCAGCAGTGAGAATGAGAGG - Intronic
1063737685 10:8779125-8779147 TTGGAAGCAGTGAGAAAGCTTGG - Intergenic
1065410132 10:25417008-25417030 CTAGTAGCAGTGCAAATGGGAGG + Intronic
1071471536 10:85987318-85987340 TGGGAAGAAGTGAGAGTGGGAGG - Intronic
1072517729 10:96202381-96202403 GTGGAAGCAGTGAGAGTGGTTGG + Intronic
1074036313 10:109742374-109742396 TTGGTTGCAGTGGGAAGCGGAGG + Intergenic
1075011642 10:118875433-118875455 GTGGCAGAAGAGAGAATGGGAGG - Intergenic
1075287832 10:121202512-121202534 TGGGTAGCAGTCAGATTGGGAGG - Intergenic
1075338001 10:121622600-121622622 TTAGTAGCAATGTGACTGGGTGG - Intergenic
1075455896 10:122584776-122584798 TTGGAAGGAGTGAGGAAGGGAGG - Intronic
1075458017 10:122597479-122597501 TTGGAAGGAGTGAGGAAGGGAGG - Intronic
1076170700 10:128317375-128317397 TAGGTAGCAGCGAGCATGGATGG + Intergenic
1077264292 11:1641428-1641450 CTGTTAGCAGAGAGAAGGGGAGG + Intergenic
1078441292 11:11371057-11371079 TTGGAAGCAGTCAAAATGCGTGG - Intronic
1079752123 11:24212772-24212794 CTGGTGCCAGTGAGACTGGGTGG + Intergenic
1080249658 11:30218792-30218814 TTTGTGGCAGTGTGACTGGGGGG - Intergenic
1081703320 11:45165378-45165400 TTGGAAGCAGCCAGAATGGGAGG + Intronic
1081763699 11:45594598-45594620 GTGGTAGAAGTGAGAAAGGAGGG - Intergenic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1084744524 11:71160276-71160298 TTCGTAGCAGTGAGAATTTGAGG - Intronic
1085157485 11:74309538-74309560 TGGGTAGCAGGGAGAATGCTGGG + Intronic
1085806530 11:79641878-79641900 TTGGCAGCAGAGAGGATGGAAGG - Intergenic
1087350934 11:97031012-97031034 TTGGGAGCAGTGAGACTGCATGG + Intergenic
1089649681 11:119904689-119904711 TTGGTAGCAGTCAGCCTGGCAGG - Intergenic
1090624945 11:128598667-128598689 TTGGTAACAGTGACAAGGAGGGG - Intergenic
1091609514 12:1993152-1993174 TTGGTATCAGTGGCTATGGGGGG - Intronic
1091925874 12:4348226-4348248 GAGATAGCAGAGAGAATGGGAGG + Intronic
1092119494 12:6034128-6034150 TTGGTACAATTCAGAATGGGAGG - Intronic
1092559477 12:9595910-9595932 TTGGAAGCAGTGAGAAAAAGTGG + Intronic
1093044773 12:14430369-14430391 TGGGTTTCAGAGAGAATGGGAGG + Intronic
1093981603 12:25481015-25481037 CTGGGACCAGTGAGTATGGGAGG - Intronic
1094675097 12:32612099-32612121 TTGGTGCCAATGAGCATGGGAGG + Intronic
1095898944 12:47307533-47307555 TTGATACCAGTCAGAATGAGGGG - Intergenic
1096200115 12:49675414-49675436 TTGGCTGCAGGGAGAATGCGAGG - Intronic
1096257727 12:50073318-50073340 TTGATGGCAGTGGGAAAGGGAGG - Intronic
1096262920 12:50104146-50104168 TGGGTAGGAGGCAGAATGGGTGG + Intronic
1098637590 12:72803178-72803200 TTACTAGCAGTGAGAAGTGGAGG - Intergenic
1099941554 12:89195130-89195152 TTAGTGGCAGTGAGGATTGGGGG - Intergenic
1100188828 12:92168209-92168231 TCTATAGCAGTGAGGATGGGTGG + Intergenic
1101764651 12:107686502-107686524 ATGGTAGCAGGGAGGATGAGAGG + Intronic
1103232372 12:119342352-119342374 TTTCTAGCAGTAAGAATGGCTGG + Intronic
1107597407 13:41977224-41977246 GAGGGAGCAGTGAGACTGGGTGG - Intergenic
1109229643 13:59741452-59741474 TTGCTAGCAGTAAGAAAGTGGGG + Intronic
1112688535 13:101861881-101861903 CTGGTGACAGTGAGAATGAGTGG - Intronic
1112727119 13:102317733-102317755 TTGGTAGAAGCCAGAAGGGGTGG - Intronic
1112813904 13:103250727-103250749 CTGGCAGCAGGGAGAAAGGGAGG - Intergenic
1113075728 13:106466435-106466457 ATGGGAGTAGTAAGAATGGGTGG - Intergenic
1115845615 14:37530108-37530130 TTGGTAGCAGTGAGAATGGGAGG + Intronic
1116388250 14:44359389-44359411 TTGGTAGCAGAGAGATGGGGGGG + Intergenic
1118457955 14:65961803-65961825 ATGGCAGCAGAGAGAATGGAAGG + Intronic
1119772097 14:77226466-77226488 TTCGTAGCATTCAGAATGGGAGG + Intronic
1119871748 14:78023652-78023674 TGGGTAGCAGTGGGGGTGGGTGG + Intergenic
1121501950 14:94444893-94444915 TTGGTGGCAGAGCCAATGGGTGG - Intronic
1121795753 14:96733813-96733835 TTGGCAGCAGTGACTTTGGGGGG - Intergenic
1124408262 15:29411302-29411324 TTGGTGGGAGTGGAAATGGGTGG - Intronic
1126450926 15:48808195-48808217 CTGGTAGCAGTGATAATGAGTGG - Intronic
1128223950 15:65988913-65988935 TTGGTAGCTGGGAGAAGGGCTGG - Intronic
1129754013 15:78085068-78085090 TGGGTAGCAGGGAAAATGGCTGG + Intronic
1131456641 15:92587103-92587125 TTTGTAGCAGTCAGCAAGGGTGG + Intergenic
1133587717 16:7211966-7211988 TTGATGGGAGTGAGAAGGGGTGG - Intronic
1136482527 16:30551422-30551444 GTGGTAGCAGAGAGAAAAGGAGG + Intronic
1137386793 16:48049446-48049468 GCAGTAGCAGTGAGAATTGGAGG - Intergenic
1137704720 16:50526614-50526636 TTGGGAGGAGTGGGGATGGGAGG + Intergenic
1139360561 16:66396873-66396895 TTGGCAGAAGTGAGTCTGGGTGG - Intronic
1140218514 16:73026978-73027000 GTAGTTGCAGTGAGAATGCGTGG - Intronic
1140267993 16:73436626-73436648 CTGGTAGCAGTGGCAGTGGGTGG - Intergenic
1140810458 16:78572224-78572246 GAGATAGCAGTGATAATGGGTGG + Intronic
1141131154 16:81437920-81437942 TTGGTGACAGTGAGAAGGGAAGG + Intergenic
1143029717 17:3961177-3961199 TTGGGAGGACTGGGAATGGGTGG + Intronic
1148618252 17:49015635-49015657 GTGGAAGCACAGAGAATGGGGGG - Intronic
1149735235 17:58987627-58987649 TTGGTAGATGTGAGAATGAGAGG + Intronic
1151743044 17:75996947-75996969 TTGGCAGCAGGGAGACAGGGAGG - Intronic
1152696370 17:81799208-81799230 TTGGGAACAGGGAGAATGTGAGG - Intergenic
1155799317 18:30081455-30081477 TTGCTGGCAGTGATAATGGAAGG + Intergenic
1157766214 18:50299027-50299049 TTGAAAGCAGTGAGAATGTCAGG + Intergenic
1159172957 18:64796712-64796734 AGACTAGCAGTGAGAATGGGTGG + Intergenic
1161576691 19:5058378-5058400 ATGGAGGCAGGGAGAATGGGGGG + Intronic
1163032359 19:14553018-14553040 TGGGTACCACTGAGAATGGGGGG + Intronic
1165007807 19:32820761-32820783 TGGGCAGCAGTGAGTATGGAAGG + Intronic
1165299768 19:34961391-34961413 AAGGTAGCAGTGGCAATGGGAGG - Intronic
1165849806 19:38843217-38843239 TTGGTAGCAGGGAGAGGTGGAGG - Intronic
1165947111 19:39450253-39450275 TTCGTTGAAGTGTGAATGGGAGG + Intronic
1166696708 19:44855967-44855989 TTGGTAGTAGGGAGAGAGGGAGG - Intronic
1167852696 19:52214065-52214087 TTGGAAGCATTGAGGAGGGGAGG + Intronic
925037150 2:696820-696842 ATGATAGCAGAGATAATGGGGGG - Intergenic
925431753 2:3800815-3800837 TTGGTGGCAGTGAGTACGGCTGG + Intronic
926817411 2:16813696-16813718 TTGAGAGCAGTGTGAAGGGGTGG - Intergenic
926993190 2:18702454-18702476 TTGGTGGAAGTGTGAGTGGGTGG + Intergenic
927705886 2:25296378-25296400 TGGGGAGCAGTGAGAAGGTGAGG + Intronic
929631589 2:43468577-43468599 TTGGTAGCAGTGAGTATAATTGG - Intronic
930246924 2:48993298-48993320 TTGGTGGAGGTGATAATGGGGGG - Intronic
930316466 2:49802441-49802463 TGAGTAGGATTGAGAATGGGAGG - Intergenic
930330009 2:49970884-49970906 CTGGGAGCAGGGAAAATGGGAGG + Intronic
930334114 2:50024094-50024116 TAGGTATCAGTGAGAAAGGTAGG - Intronic
931710626 2:64987174-64987196 GTGGTAGCAGTGGGAATAGATGG + Intergenic
933558303 2:83859558-83859580 TTGCTAAAAGTGAGAATGTGAGG - Intergenic
933771764 2:85749145-85749167 GTGCTAGCACTGTGAATGGGAGG + Intergenic
935089594 2:99882103-99882125 TGGGTTGCAGTGAGAGAGGGTGG - Intronic
935466141 2:103400276-103400298 TTGGGAGCAGTGAGTATGAAAGG - Intergenic
936245949 2:110827455-110827477 TGGGTAGCAGTGAGGAGGTGAGG + Intronic
936400413 2:112160316-112160338 TTGGTGGCAGTGGGGGTGGGGGG + Intronic
945042196 2:205751821-205751843 TTGGTAGCAGGGAGAAAGTGGGG - Intronic
945714109 2:213336550-213336572 TAGGTGCCAGTGAGACTGGGTGG + Intronic
946460350 2:219863297-219863319 TTGGGAGCAGTTATAATGGGTGG + Intergenic
946522854 2:220485565-220485587 TTGGTAGGGGAGAGAATGGAGGG + Intergenic
947673510 2:231958062-231958084 TTGGTGGCAGTGGAATTGGGTGG + Intergenic
948655433 2:239473915-239473937 GTGGTGGCAGTGAGAAGGAGAGG + Intergenic
1170328547 20:15183030-15183052 GTGGTGGAAATGAGAATGGGAGG - Intronic
1174980749 20:55391984-55392006 TTGGTAGCAGCTAGCAGGGGTGG - Intergenic
1175862375 20:62157216-62157238 TTGGTAGAAGTGGGGAGGGGTGG - Intronic
1176014175 20:62920378-62920400 TTTGCAGCAGTGAAAATCGGGGG - Intronic
1176988842 21:15469842-15469864 TATGTAGCACTGAGAAGGGGGGG - Intergenic
1177344394 21:19851349-19851371 TTGATAAAAGTTAGAATGGGAGG + Intergenic
1177926871 21:27227775-27227797 TTAATACCACTGAGAATGGGGGG - Intergenic
1178532366 21:33386251-33386273 TTGGTACCAGTGAGGTTGTGGGG + Intergenic
1179081667 21:38176930-38176952 TTGGTGGGAGGGAGAAAGGGAGG + Intronic
1184327425 22:43799846-43799868 TTGGTGCCAGGCAGAATGGGGGG - Intronic
1184378250 22:44128719-44128741 CTGGTAGCAGGGACAGTGGGAGG - Intronic
1184444865 22:44541097-44541119 ATGGGTGCTGTGAGAATGGGTGG + Intergenic
1185142813 22:49112806-49112828 CTGGGAGCAGTGAGAAACGGAGG + Intergenic
950332578 3:12168256-12168278 GAGGGAGCAGTGGGAATGGGAGG + Intronic
951041521 3:17993543-17993565 TAGGTAGCAGTGGGAAGGTGGGG + Intronic
952385135 3:32835462-32835484 TTGATAGGAGTGAAAAAGGGAGG + Intronic
952751004 3:36824869-36824891 TTTGTTGCAGAGAGAATGTGAGG + Intergenic
953210410 3:40870257-40870279 TTGGAGGGGGTGAGAATGGGTGG - Intergenic
954293221 3:49660633-49660655 TTGGTAGCAGGGACAGTGGTGGG - Exonic
957311702 3:78528140-78528162 ATGGTACCAGTTAGAATGGAAGG + Intergenic
961489615 3:127245508-127245530 TTGGCAGATGTGAGAATGGCTGG + Intergenic
964847796 3:161062512-161062534 TTGGGAGCAGTGAGAACAGGTGG - Intronic
965843092 3:172930131-172930153 CTGGTAGCAGTGAGACTGGTGGG - Intronic
966427267 3:179792702-179792724 TGGGTTGAAGAGAGAATGGGAGG + Intergenic
966836272 3:184051597-184051619 GTGGAAGGAGTGAGAAAGGGAGG - Intergenic
968141855 3:196264619-196264641 TTGGTTGAAATGAGATTGGGAGG + Intronic
970384662 4:15544077-15544099 TGGGAAGCAGTGAAGATGGGAGG - Intronic
970439602 4:16068817-16068839 TTGGTAGAAGTGAGGAAGGTGGG - Intronic
972431258 4:38984562-38984584 TAGGCAGCAGTGAGAATGTACGG - Intronic
973178533 4:47239867-47239889 GTGGCAGCAGTGAGAAAGGCCGG - Intronic
973529676 4:51823271-51823293 TTGGTAGTTGTCAGAAGGGGTGG - Intergenic
973921464 4:55690006-55690028 ATGGTAGCAGGGAGAATGGAAGG + Intergenic
974891554 4:67890271-67890293 GTGGTGGCAGTGAGGATGAGAGG - Intergenic
975197398 4:71541688-71541710 CTGGCAGCAGTGAGGATGGATGG + Intronic
975742800 4:77446550-77446572 TTGGTAGAAGTTGCAATGGGAGG + Intergenic
975804027 4:78093970-78093992 TTGGTGGAAGTGGGAAGGGGAGG - Intronic
975911652 4:79274206-79274228 TTGGGAGCAGTGAGGATAGGAGG - Intronic
977631780 4:99251136-99251158 TTGTTAACAGTGATAATAGGTGG - Intergenic
978227655 4:106357028-106357050 ATGGTAGCAGTGAAAATTGAAGG - Intergenic
978671444 4:111251760-111251782 GTTGTAGCAATGAGAAAGGGAGG - Intergenic
979556830 4:122057415-122057437 TTGGGAGTAGTGACAGTGGGAGG - Intergenic
979813150 4:125064913-125064935 TTGGTGGCAGTGAGTAGGGAGGG - Intergenic
980281277 4:130724010-130724032 TTGGTAGCAGAGAGACAGTGTGG - Intergenic
981969429 4:150648951-150648973 TTGGTAGCATGGAGAAAGTGGGG - Intronic
984230789 4:177096345-177096367 TTCCTAGCAGTGAGAATGCAAGG + Intergenic
986586744 5:9326146-9326168 TTGACAGCAGTGAGGATGGAAGG - Intronic
990289537 5:54334347-54334369 TTGGTAGCAGTGGGCAGGGCAGG - Intergenic
990623364 5:57584370-57584392 ATGGTAGCAGTGGGAATGAGGGG - Intergenic
990906875 5:60813283-60813305 TTGTTAGCAGTGAGAATTGTGGG - Intronic
994236193 5:97365747-97365769 GTGGTAGCAGTGAGAAGTGTGGG + Intergenic
995220697 5:109644417-109644439 CTGGCTGCAGTGAGAATGGAGGG + Intergenic
995859288 5:116624775-116624797 TTGTAAGAAGTGACAATGGGAGG + Intergenic
997067243 5:130575879-130575901 TTAATAGCAGAGAGATTGGGAGG - Intergenic
997487844 5:134246701-134246723 CTGGTGGAAGTGAGAATGAGGGG - Intergenic
997780805 5:136656203-136656225 TTGGTTGCAGTTAGAATAGGGGG - Intergenic
998074073 5:139222031-139222053 GAGGTAGTAGTGAGAATGGAGGG + Intronic
998773987 5:145578262-145578284 TTTGTAGGAGGTAGAATGGGTGG - Intronic
998887959 5:146714328-146714350 TAGGTTTCAGAGAGAATGGGAGG + Intronic
999819879 5:155216055-155216077 GTGGTAGCAATGAGATTTGGAGG + Intergenic
1001269782 5:170302577-170302599 TTGGTGGGAGTGAGGCTGGGTGG - Intergenic
1001381431 5:171309016-171309038 TTATTAGCAGGGATAATGGGCGG - Intergenic
1003312573 6:4982557-4982579 TTGGGAGGCGTGAGAATAGGGGG - Intergenic
1003794926 6:9590494-9590516 TGGGTTGCAGTAAGCATGGGAGG + Intergenic
1007462914 6:42030946-42030968 TTGGGAGAAGTGGGAATTGGGGG + Intronic
1009533304 6:64848587-64848609 TTGTTTCCAATGAGAATGGGAGG + Intronic
1013531324 6:111021480-111021502 TGGGGAGCATTGAGGATGGGAGG + Intronic
1013612333 6:111806830-111806852 ATGGTAGGAGTGGGAGTGGGAGG + Intronic
1018186772 6:161272229-161272251 GTGGAAGCAGGAAGAATGGGTGG - Intronic
1020820841 7:12965233-12965255 ATGGTAGCAGTGAGGATGAGAGG - Intergenic
1022162996 7:27730852-27730874 TTAGTAGCAGTGTGAAGGGATGG + Intergenic
1023186342 7:37537065-37537087 TTGGTAGCCAGGAGAAGGGGAGG + Intergenic
1027204554 7:76087141-76087163 TAGGCTGCAGTGAGTATGGGTGG + Intergenic
1027372521 7:77521189-77521211 GTGGTAGCATTGAGTATGTGGGG - Intergenic
1029072839 7:97913985-97914007 TGGGTAGCTGAGTGAATGGGTGG + Intergenic
1029234951 7:99107624-99107646 TCGTTTGCAGTGAGAATGGCTGG - Intronic
1029703749 7:102264629-102264651 TTGGTAGGAGTGAGTAAGGAGGG + Intronic
1030581489 7:111361275-111361297 ATGGTAGCAGTGAGAATAATAGG - Intronic
1031192839 7:118576628-118576650 TGGGTATCAGAGATAATGGGAGG + Intergenic
1032522058 7:132552969-132552991 TTGTTAGCAGTTAGAATGCTTGG + Intronic
1033870897 7:145752236-145752258 TTGACAGCAGGGAGAAAGGGAGG - Intergenic
1034590164 7:152131830-152131852 TTGGCAGCAGTGGGAATAGCAGG + Intergenic
1037611974 8:20483381-20483403 TGTGTAGCAGTGAGGGTGGGGGG + Intergenic
1037689575 8:21170796-21170818 GTGGTAGCAGTGAGAAGGTAGGG + Intergenic
1037988237 8:23302944-23302966 TTGGTGGCAGCCAGAGTGGGAGG + Intronic
1038560654 8:28576398-28576420 TTGGGAACAGGGAGAATGTGAGG - Intergenic
1038899771 8:31829393-31829415 TTTGTAGCCGTGAGCATGGTAGG - Intronic
1039198736 8:35062077-35062099 TTGGTGGCAGTGACAGTGGCTGG - Intergenic
1040683999 8:49848358-49848380 TTGGATGCAGAGAGAATGGTAGG + Intergenic
1041031860 8:53745007-53745029 TTGACTACAGTGAGAATGGGAGG - Intronic
1042615849 8:70648187-70648209 TTGGGAGCTCTGAGAATGTGGGG - Intronic
1043414606 8:80034081-80034103 TGGGCACCAGTGAGCATGGGAGG - Intronic
1047085090 8:121507114-121507136 GTGGTAGCACTGAAAATTGGTGG + Intergenic
1049535986 8:143182418-143182440 TTGGTAGTAGTGAGGTGGGGAGG - Intergenic
1049943641 9:573605-573627 TCGGTATCAGTGAGAAAAGGTGG + Intronic
1051365836 9:16320629-16320651 AGTGGAGCAGTGAGAATGGGAGG - Intergenic
1052069914 9:24069229-24069251 CTGGTAGTACTGAGAATGAGCGG + Intergenic
1055310628 9:74976035-74976057 TTGGTTGAATTGAGCATGGGTGG + Intergenic
1055818471 9:80234444-80234466 TTTGTAGCAGTAATCATGGGAGG + Intergenic
1056786114 9:89593691-89593713 TTGGAAGCTGTGAGCTTGGGAGG + Intergenic
1057042056 9:91855250-91855272 TTGCTAGGAGTGAGGATGGATGG - Intronic
1057912788 9:99033376-99033398 TTGGCAGGAGTGAGGGTGGGAGG + Intronic
1059322267 9:113479117-113479139 TTGGAAGGAGTGAAAATGGAGGG - Intronic
1061664081 9:132150241-132150263 TTGGGAGAAGGGGGAATGGGGGG - Intergenic
1061899084 9:133663834-133663856 TTGGGACCTGTGAGAATGGATGG + Exonic
1190755249 X:53395872-53395894 TTGGTAGGAGTGGGAATTGAGGG - Intronic
1191728265 X:64304720-64304742 TGGGTATGAGTGAGAATGAGTGG - Intronic
1192341803 X:70269199-70269221 TTGGCAGAAGGGAGAATAGGAGG + Intronic
1194970363 X:100336690-100336712 TTGGTATCAGTTAGCATGGAGGG + Intronic
1195244850 X:102986377-102986399 GGGGTAGCAGTGAGATTGGTAGG - Intergenic
1195746501 X:108123936-108123958 TTGGTAGGGGTGAGGATGGATGG - Intronic
1195958536 X:110360803-110360825 ATGGTAGCAGTGGGAATGGAAGG + Intronic
1196763736 X:119224077-119224099 TGAGTAGAAGAGAGAATGGGAGG + Intergenic
1197413837 X:126150744-126150766 CTGGTGCCAGTGAGACTGGGTGG - Intergenic
1197984647 X:132254708-132254730 TTGGTAGAACAGAGAAGGGGAGG + Intergenic
1198848649 X:140941310-140941332 ATGGTAGCAGTGAAGATGGGGGG - Intergenic
1199387721 X:147242181-147242203 ATGGTAGCACTGAGACTGGGTGG - Intergenic
1201148175 Y:11077949-11077971 TTCATAGCAGTGAGAATTTGAGG - Intergenic
1201781580 Y:17729169-17729191 TTGGTAGCTGTGACAATGCGTGG + Intergenic
1201819973 Y:18176821-18176843 TTGGTAGCTGTGACAATGCGTGG - Intergenic
1201854860 Y:18529961-18529983 TTGGTAGCCGTTAAAATGCGTGG - Intergenic
1201878461 Y:18790424-18790446 TTGGTAGCCGTTAAAATGCGTGG + Intronic
1202173068 Y:22071963-22071985 TTGGTAGCTGTGACAATGCGTGG + Exonic
1202195709 Y:22297043-22297065 TTGGTACCAGGGAAACTGGGTGG - Intergenic
1202218292 Y:22514408-22514430 TTGGTAGCTGTGACAATGCGTGG - Exonic
1202324894 Y:23681647-23681669 TTGGTAGCTGTGACAATGCGTGG + Intergenic
1202545877 Y:25988407-25988429 TTGGTAGCTGTGACAATGCGTGG - Intergenic