ID: 1115852554

View in Genome Browser
Species Human (GRCh38)
Location 14:37599307-37599329
Sequence TTCACAACTCTGTAGTAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 110}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115852552_1115852554 3 Left 1115852552 14:37599281-37599303 CCATCATTAAATCTTTAAGGGAT 0: 1
1: 0
2: 1
3: 21
4: 253
Right 1115852554 14:37599307-37599329 TTCACAACTCTGTAGTAGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 110
1115852548_1115852554 12 Left 1115852548 14:37599272-37599294 CCCTTGGTTCCATCATTAAATCT 0: 1
1: 0
2: 0
3: 36
4: 276
Right 1115852554 14:37599307-37599329 TTCACAACTCTGTAGTAGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 110
1115852547_1115852554 19 Left 1115852547 14:37599265-37599287 CCTCTCTCCCTTGGTTCCATCAT 0: 1
1: 0
2: 1
3: 36
4: 644
Right 1115852554 14:37599307-37599329 TTCACAACTCTGTAGTAGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 110
1115852546_1115852554 23 Left 1115852546 14:37599261-37599283 CCTTCCTCTCTCCCTTGGTTCCA 0: 1
1: 0
2: 5
3: 145
4: 1851
Right 1115852554 14:37599307-37599329 TTCACAACTCTGTAGTAGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 110
1115852549_1115852554 11 Left 1115852549 14:37599273-37599295 CCTTGGTTCCATCATTAAATCTT 0: 1
1: 0
2: 1
3: 14
4: 258
Right 1115852554 14:37599307-37599329 TTCACAACTCTGTAGTAGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115852554 Original CRISPR TTCACAACTCTGTAGTAGGT AGG Intronic
900204095 1:1424299-1424321 TTCACAAGTCTGAAGGAAGTAGG + Intergenic
900823804 1:4910458-4910480 TCCACATTTCTGTACTAGGTGGG - Intergenic
901895713 1:12310305-12310327 TTTAAAACTCTGTTGTATGTCGG + Intronic
903908919 1:26707741-26707763 TTCAAAACTGTATAGGAGGTGGG + Intronic
907270716 1:53289363-53289385 TTCACAGCCCTCTTGTAGGTTGG - Intronic
908993557 1:70125297-70125319 TTTACATCTATGTACTAGGTTGG - Intronic
912887860 1:113494727-113494749 TAAACAACTCTGTTGTAGTTAGG + Intronic
916208490 1:162338594-162338616 TTAACGACTTTGTAGTTGGTTGG - Intronic
917182033 1:172308826-172308848 CTGACAAATCTGTAGTAAGTTGG + Exonic
1064340890 10:14484310-14484332 TTCTCAACTCTGTTTTAGTTGGG - Intergenic
1064751521 10:18535319-18535341 ATTACAAATCTGTAGGAGGTTGG + Intronic
1065128996 10:22601721-22601743 GTCACAACTCTGAATGAGGTTGG - Intronic
1065343453 10:24726096-24726118 TTCACAACACTATACTAGGCTGG + Intergenic
1067817523 10:49493564-49493586 TTCACTAATCTGTAGTAGAAGGG - Intronic
1071258534 10:83897131-83897153 TTTTCAACTCTGTTGAAGGTGGG + Intergenic
1073391413 10:103179730-103179752 ATGCCAACCCTGTAGTAGGTTGG - Intronic
1073551119 10:104402624-104402646 TTCAGAAATCTGTAGTTGATAGG - Intronic
1077865708 11:6219509-6219531 TTCCCAACTGGGAAGTAGGTGGG + Intronic
1081215470 11:40391344-40391366 TTCACAAATCTGATGTATGTAGG + Intronic
1085871849 11:80359296-80359318 TACACAACTGTGTGGGAGGTTGG - Intergenic
1086246297 11:84757211-84757233 TTCAATACTTTGTAGTAGATGGG - Intronic
1086429904 11:86726573-86726595 TTCACCACTCTCTTGTGGGTAGG + Intergenic
1086922046 11:92598505-92598527 TTCAAAACTCTGTGGAAGCTGGG - Intronic
1088168908 11:106972401-106972423 TTCTGAACTCTTCAGTAGGTTGG - Intronic
1090052240 11:123389736-123389758 TTCACAACTTTTTTCTAGGTGGG + Intergenic
1091663007 12:2398578-2398600 ATGACAACTCTGTGGAAGGTGGG - Intronic
1095551293 12:43443113-43443135 TTCACCAAGCTGGAGTAGGTAGG - Intronic
1097140539 12:56899273-56899295 TTCTCAACTCTGTTTTAGTTAGG + Intergenic
1100276972 12:93080452-93080474 ATAACATCTCTGTTGTAGGTTGG - Intergenic
1101523010 12:105502480-105502502 TTCCCAAATCTGTAAGAGGTTGG + Intergenic
1102245442 12:111353013-111353035 TTCACAGCTCTTGAGAAGGTTGG + Intergenic
1108028548 13:46204551-46204573 TTCACAACTCTGTTTGGGGTAGG + Intronic
1108246480 13:48519717-48519739 TTCACATCTCTGTTGTACTTAGG - Intronic
1109859243 13:68175658-68175680 TTCACGAATCTGTAGTTGGATGG + Intergenic
1110317406 13:74126689-74126711 GTCACAGTTCTGTAGCAGGTGGG + Intronic
1110456055 13:75691672-75691694 TTCTCAGCCCTGTAGTATGTAGG - Intronic
1111893092 13:94107429-94107451 TTCACAACTCTATAATATGTAGG + Intronic
1115852554 14:37599307-37599329 TTCACAACTCTGTAGTAGGTAGG + Intronic
1122282705 14:100633514-100633536 TGCTCATCTCTGTAGTAGGGGGG + Intergenic
1129573401 15:76715043-76715065 TCAACACCTCTGTAGTAGCTTGG - Intronic
1130631214 15:85570672-85570694 GTCACAACTCAGGAGTAGGAGGG - Intronic
1134662309 16:15993358-15993380 CTCTAAACTCTGTAATAGGTGGG + Intronic
1140680508 16:77380439-77380461 TTCAAAACTCTGTATTGGTTTGG + Intronic
1152207795 17:78984336-78984358 TTCACAACTCTGTTCTCTGTGGG + Intergenic
1158541339 18:58357656-58357678 TTCAAAAATCTGTAGAAGTTTGG + Intronic
1164807453 19:31127919-31127941 TTCACACATCGGTACTAGGTTGG + Intergenic
1167315419 19:48760176-48760198 TTCTCAGCTCTGGAGTAGCTAGG + Intergenic
927225589 2:20762806-20762828 GTCACTAGTCTGTAGTATGTGGG - Intronic
927345753 2:22037338-22037360 TTCATAAATGTGTAGAAGGTTGG - Intergenic
929150783 2:38746807-38746829 TACTCAACACTGTATTAGGTTGG + Intronic
931007423 2:57867821-57867843 TTCACAACTCTCTCGGAAGTAGG - Intergenic
931087113 2:58844776-58844798 TTCACAGATTTGCAGTAGGTAGG + Intergenic
931876897 2:66523534-66523556 TTCATAACGCTGTAGTTGGAAGG + Intronic
933707031 2:85299025-85299047 TTCCCTACTTTGTATTAGGTTGG + Intronic
938873707 2:135510491-135510513 TTCACCATTCTGTAGGAGCTAGG + Intronic
940688876 2:156889243-156889265 TTCACAACTCTGTAGATTGAGGG + Intergenic
942911999 2:181255053-181255075 TTCCAAAGGCTGTAGTAGGTTGG - Intergenic
945569904 2:211453679-211453701 TTCACAAGTCTGTAGCAGACAGG + Intronic
947195723 2:227565168-227565190 TTCATAAATCTGTATTAGGTCGG - Intergenic
1174960914 20:55155784-55155806 TTCACAACTCACCAGTAGGGAGG + Intergenic
1176988981 21:15471434-15471456 TTCACATCTCTGGAGTAGTGTGG - Intergenic
1183679218 22:39317364-39317386 TTCTCAGCTCTGTAGCAGGCAGG - Intronic
949115626 3:318076-318098 TTCACAACTTTTTTGGAGGTGGG + Intronic
951941917 3:28088690-28088712 CTCACAACTCTCTTGTAGGCAGG - Intergenic
960192421 3:114722850-114722872 TTCACAGCTCTGTTTCAGGTGGG + Intronic
960924761 3:122783621-122783643 TTAACATCTATATAGTAGGTTGG + Intronic
961544432 3:127622514-127622536 TTCAGAGTTCTGTAGGAGGTAGG + Intergenic
962232842 3:133681054-133681076 TTTACAAATCTGTAGTATTTAGG - Intergenic
963529808 3:146460741-146460763 TTCTCAACACTGTAGTATTTTGG - Intronic
966605661 3:181819355-181819377 TACGCAACTCTGGAGTAGGTTGG - Intergenic
967311885 3:188113992-188114014 AACACACTTCTGTAGTAGGTTGG - Intergenic
970285789 4:14513030-14513052 TTCAGAAATCTGTAGTGGATCGG - Intergenic
972255023 4:37344776-37344798 TTCACAATTGTGTAATAGTTAGG + Intronic
973033027 4:45368363-45368385 TTCCCAACTCTACAGTAGCTTGG + Intergenic
973092302 4:46152577-46152599 TTCACAAACATGTAGTAGTTTGG + Intergenic
973102107 4:46285458-46285480 ATCTCAACTCTGTACTAGGATGG + Intronic
978247397 4:106590662-106590684 TTCAAAACTTTATATTAGGTTGG - Intergenic
983643912 4:169970364-169970386 TACACAAGTCTGTAGTATATTGG - Intergenic
987154006 5:15069515-15069537 TTCAAAACTCTGTCGGAGGAAGG + Intergenic
989634565 5:43520461-43520483 CACAAAACTCTGTAGTAGATAGG - Intergenic
989759350 5:44993852-44993874 TTCACAGATCTGTAGTAATTTGG - Intergenic
990370884 5:55117171-55117193 ATTACAACTCTTGAGTAGGTGGG + Intronic
990833123 5:59983059-59983081 TTCACAAGATGGTAGTAGGTGGG + Intronic
991197020 5:63946748-63946770 TTTACAGCTTAGTAGTAGGTGGG - Intergenic
991696390 5:69277441-69277463 ATCACAAATCTGTAGTAGCATGG + Intergenic
993378230 5:87175195-87175217 TTCACATATCTATAGTAGTTAGG - Intergenic
995303985 5:110621856-110621878 TTAACAACACTTTTGTAGGTGGG - Intronic
997102320 5:130982295-130982317 TTCACAAGTCGGCAGGAGGTAGG + Intergenic
998418904 5:141965801-141965823 TCCTCTACCCTGTAGTAGGTAGG - Intronic
1000171169 5:158704501-158704523 ATCACAATTCTGAACTAGGTGGG + Intronic
1002771726 6:295819-295841 TTCACAACTGTGTTGTTGTTGGG - Intronic
1019789676 7:3002937-3002959 CTCCCAACTCTGTTTTAGGTGGG - Intronic
1022789622 7:33673905-33673927 TTCACAAAACTGTAGTAAGCTGG + Intergenic
1025277121 7:57592725-57592747 CTGAGAACTCTGTAGTATGTCGG - Intergenic
1026254710 7:68700669-68700691 TTCTCAACTCTGTTGTAGTTGGG + Intergenic
1027759445 7:82259571-82259593 TTCATCACTCTGTAGTATTTAGG - Intronic
1028603538 7:92629495-92629517 TTCAGAAATCTGAAGTAGTTTGG - Intronic
1032103194 7:129000559-129000581 TTCAGAACTCTGTAGAAGACAGG + Exonic
1032953520 7:136943981-136944003 TTCACAACTCTGTGGCAGATAGG + Intronic
1034428985 7:151031094-151031116 TGCAAAACCCTGTAGTAGTTAGG + Intronic
1034493485 7:151406814-151406836 CTCACAACTCTGAGGTGGGTGGG - Intronic
1034531498 7:151698675-151698697 TTCACAATTCTGTAGGCTGTAGG - Intronic
1035884613 8:3278721-3278743 ATCACTACTCTTTTGTAGGTGGG - Intronic
1037698848 8:21253415-21253437 ATCACACACCTGTAGTAGGTAGG + Intergenic
1039584032 8:38690584-38690606 TTCAGAACCCTATGGTAGGTAGG - Intergenic
1041769906 8:61461742-61461764 CTCAGAACCCTGTAGTTGGTGGG + Intronic
1050727301 9:8665582-8665604 ATCACAACTCTGGATTAGATGGG - Intronic
1051969996 9:22876862-22876884 TTGACAACTCTGGAGAACGTGGG - Intergenic
1052498448 9:29258450-29258472 TTCACAACTCTGGCATAGTTGGG - Intergenic
1055317848 9:75052146-75052168 GTCACAACTCTGTTGGAGGTAGG + Intergenic
1055847054 9:80578272-80578294 TTCACTACTGAGTACTAGGTTGG - Intergenic
1056340727 9:85629009-85629031 TTCAAAACTCTGTTGTTGGCTGG - Intronic
1056534881 9:87518559-87518581 CTCACAACTGTTTACTAGGTGGG + Intronic
1058955961 9:109949025-109949047 TTCACAGCTCTGAAGAAGGCTGG - Intronic
1187682259 X:21779140-21779162 TACAAAACTCTGTGGTGGGTAGG + Intergenic
1189368225 X:40406419-40406441 TTCACAAATCTGTAATAGGCAGG - Intergenic
1191776887 X:64824094-64824116 CTGACAACTCTCTAGTGGGTTGG - Intergenic
1198126623 X:133650550-133650572 TTCAAAAATCTGTTGAAGGTTGG + Intronic