ID: 1115853077

View in Genome Browser
Species Human (GRCh38)
Location 14:37602735-37602757
Sequence CTCTCCCCCACCGCGGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115853077_1115853084 -8 Left 1115853077 14:37602735-37602757 CCAGTCACCGCGGTGGGGGAGAG 0: 1
1: 0
2: 0
3: 6
4: 136
Right 1115853084 14:37602750-37602772 GGGGAGAGGGGGTCGGAACTTGG 0: 1
1: 0
2: 0
3: 29
4: 324
1115853077_1115853086 22 Left 1115853077 14:37602735-37602757 CCAGTCACCGCGGTGGGGGAGAG 0: 1
1: 0
2: 0
3: 6
4: 136
Right 1115853086 14:37602780-37602802 CTCACCCACCTTAGAGACTCAGG 0: 1
1: 0
2: 0
3: 8
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115853077 Original CRISPR CTCTCCCCCACCGCGGTGAC TGG (reversed) Intronic
900348692 1:2224668-2224690 CTGGCCCCTACCACGGTGACAGG - Intergenic
901060739 1:6470878-6470900 CACTCCCCCACCGCAGTGGGCGG - Exonic
902018616 1:13328275-13328297 CTCTGCCCCACCGCCCTGTCTGG + Intergenic
902363066 1:15952664-15952686 CTTTCCTCCAGCTCGGTGACTGG - Intronic
902368755 1:15992908-15992930 CTCTCACCCACCGTGGAAACAGG + Intergenic
903638020 1:24834179-24834201 CTCTGCCCCACCGCCCTGTCTGG - Intronic
905807010 1:40884469-40884491 CTCACCACCACCGCGGAGGCCGG + Intergenic
906010913 1:42524689-42524711 CTCTCCTCCACCCCTGTGGCAGG - Intronic
906238689 1:44228245-44228267 CTCCACCCCACCGAGGTGCCTGG + Intronic
916534370 1:165689607-165689629 CCCTCACTCACCGTGGTGACCGG + Intronic
916848493 1:168678431-168678453 CTCTCCCCCAACCCCATGACAGG + Intergenic
919064978 1:192683102-192683124 CTCTCCCCCAACCCCATGACAGG + Intergenic
1063360112 10:5446615-5446637 CTCTGCTCCACCGCGGCGAGAGG + Intronic
1064768639 10:18700680-18700702 CTCTCTCCCACCACGATGACAGG - Intergenic
1064981729 10:21173317-21173339 CTCCCCCTCGCCGCGGTCACAGG + Intronic
1066085282 10:31969721-31969743 CTCTGCCCCACCGCCCTGTCTGG + Intergenic
1066599399 10:37088430-37088452 CTCTCCCCCAACCCCATGACAGG + Intergenic
1071716317 10:88099770-88099792 CTATCCCCCACCACTGTGATTGG - Intergenic
1077889244 11:6406788-6406810 CTCTCCCCCACCACTCTCACAGG + Intronic
1079816844 11:25071662-25071684 CTCTCCCCCAACCCCATGACAGG - Intronic
1085604351 11:77883831-77883853 CTCTCCCACACCGCTTGGACAGG - Exonic
1088042998 11:105411297-105411319 CTCCTCACCACCTCGGTGACCGG - Intergenic
1088732208 11:112693645-112693667 CTGCCCCCCACCCCTGTGACTGG + Intergenic
1091235707 11:134020796-134020818 CTCTCCTCCACCGCGGGGTTAGG + Intergenic
1091378532 12:41895-41917 CTCTGCCCCACCGCCCTGTCTGG + Intergenic
1096007395 12:48184056-48184078 CCCTCCCCCACCCCGGAGGCCGG + Exonic
1096695220 12:53344659-53344681 ATCTCCCCCACAGCTGTGGCTGG - Intronic
1096778038 12:53975532-53975554 CTGGCCCCCACCGCTGTGGCCGG + Exonic
1096890200 12:54761899-54761921 CTCTCCCCCAACCCCATGACAGG - Intergenic
1099264220 12:80424130-80424152 CCCTCCCCGACCTCCGTGACAGG - Intronic
1100570798 12:95841734-95841756 CTCTGCCCCACCGCCCTGTCTGG - Intergenic
1104901587 12:132192192-132192214 CACTCCCCCAGCCCGATGACCGG - Intergenic
1105746716 13:23383892-23383914 CTCTCCCCAACCCCAGTGCCTGG + Intronic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1108541666 13:51452268-51452290 CCCTCCCCCACCGCGCGGGCGGG - Intronic
1110706251 13:78603636-78603658 CGCGGCCCCACCGCGCTGACAGG + Intergenic
1113654288 13:112058313-112058335 CTGTCCGCCGCTGCGGTGACAGG - Intergenic
1115576314 14:34714905-34714927 CTCTCTCCCACCGGCTTGACGGG - Intergenic
1115853077 14:37602735-37602757 CTCTCCCCCACCGCGGTGACTGG - Intronic
1116609302 14:47046445-47046467 CTCTCCCCCAACCCCATGACAGG - Intronic
1116928701 14:50668393-50668415 CCCTCCCCCACCGCGGCTCCAGG + Intergenic
1118341293 14:64896039-64896061 CTCTGCCCCACCGCCCTGTCTGG - Intergenic
1118955553 14:70477572-70477594 CTCTGCCCCACCGCCGTGTCTGG + Intergenic
1119998905 14:79280831-79280853 CTCTCCACCCCCACGGAGACAGG + Intronic
1122844796 14:104487009-104487031 TTCTCTCCCACAGCAGTGACCGG - Intronic
1127584205 15:60366446-60366468 CTCTGCCCCACCGCCCTGTCTGG + Intronic
1130956137 15:88628819-88628841 CTCTCCCCCACCGCACTGTAAGG - Intronic
1132589996 16:722396-722418 CCCTCGCCAACCGCGGTCACAGG - Exonic
1134828695 16:17305868-17305890 CTCCCCACCACGGCGGTGTCAGG - Intronic
1139528424 16:67530058-67530080 CTCTCTCCCGCCGCAGTCACAGG - Intronic
1141172163 16:81698279-81698301 CTCCCCCCAGCCCCGGTGACCGG + Intronic
1142240383 16:88941934-88941956 CTCGCCCCCAGCGCGGCGCCTGG + Intronic
1142980494 17:3668483-3668505 CTCACCACCACGGCGGTGACCGG + Exonic
1144307258 17:13979770-13979792 CTCTCCCCCCACGCCATGACAGG - Intergenic
1146216467 17:30980718-30980740 CTCTGCCCCACCGCCCTGTCTGG - Intronic
1148441353 17:47713265-47713287 CTCCCCCTCACCCTGGTGACAGG - Intergenic
1148615116 17:48996048-48996070 CCCTCCCCCACCGCCCAGACGGG + Intergenic
1150130186 17:62664935-62664957 CTCTGCCCTACCACGGTGAGGGG + Exonic
1150488686 17:65560619-65560641 CCCCTCCCCAGCGCGGTGACCGG - Intronic
1152020960 17:77780021-77780043 CTCTCCCCCAGCCCCGGGACAGG + Intergenic
1152357215 17:79813181-79813203 CCCACCCCCACCCCGGTGCCCGG - Intergenic
1154322534 18:13366780-13366802 CTCTCCAGCACCGCAGTGATGGG + Intronic
1154420853 18:14225077-14225099 CTCTGCCCCACCGCCCTGTCTGG + Intergenic
1155053888 18:22169251-22169273 CTCGCCCCCACTCCGGGGACAGG + Intergenic
1160379651 18:78443132-78443154 CTCTCCCCCAACCCCATGACAGG - Intergenic
1161169978 19:2807797-2807819 CCCTCACCCACCGCGGGTACAGG - Exonic
1161816224 19:6501719-6501741 CTCTCCCCCAGCAAGGTGAACGG + Intronic
1162810915 19:13163971-13163993 CTCTCCCGCACCTCGGCGGCTGG + Intergenic
1163323226 19:16586706-16586728 CACTCCCCCACCTCGGTGTCCGG + Intronic
1163913082 19:20214537-20214559 CTCTGCCCCACCGCCCTGTCTGG + Intergenic
1164066398 19:21720986-21721008 CTCTGCCCCACCGCCCTGTCTGG + Intergenic
1166852504 19:45767371-45767393 CTCTCCCCCACCTCGGCCTCGGG + Intronic
1167924469 19:52811532-52811554 CTCTGCCCCACCGCCCTGTCTGG + Intronic
928556009 2:32425912-32425934 CTTTCCCCCACAGCTGTGTCAGG + Intronic
932473155 2:71977718-71977740 CTCTCCCCCAACCCCATGACAGG + Intergenic
933313667 2:80690553-80690575 CTCTCCCCCAACCCCATGACAGG + Intergenic
934477148 2:94601420-94601442 GGCTCCCCCACAGAGGTGACGGG + Intronic
937864036 2:126734710-126734732 CTGTCCCCCTCCGCTGGGACTGG - Intergenic
938034688 2:128027019-128027041 CGCACCCCCACCCCGGAGACGGG - Intronic
943323407 2:186472889-186472911 CTCTGCCCCACCGCCCTGTCTGG + Intergenic
944051244 2:195472526-195472548 CTCTTCCCCACCGCCTTCACTGG + Intergenic
944598918 2:201284034-201284056 CTCTGCCCCACCGCCCTGTCTGG - Intronic
945835859 2:214835712-214835734 CTCTGCCCCACCGCCCTGTCTGG - Intergenic
945970484 2:216226913-216226935 CTCTGCCCCACCGCCCTGTCTGG - Intergenic
946952260 2:224889850-224889872 CTCTCCCCCACTCCTGTGAGAGG + Intronic
947797768 2:232905742-232905764 CTCTGCCCCACCGCCCTGTCTGG + Intronic
948402331 2:237692775-237692797 CTCTCCCCGCCCGAGGTGATGGG + Intronic
948749412 2:240122581-240122603 CTCTCCCCCAACCCCATGACAGG + Intergenic
948861166 2:240753228-240753250 CTCTCCCCCACTGCCCTGAAAGG + Intronic
948874457 2:240819553-240819575 CCCTCCCCCACCCCGGGAACCGG + Intronic
948910311 2:240999261-240999283 CTCGCCCCCGCCTCGGTGCCCGG - Intronic
1169085619 20:2823707-2823729 CTCTGCCCCACCGCCCTGTCTGG + Intergenic
1169246857 20:4032527-4032549 CTCTGCCCCACCGCCCTGTCTGG + Intergenic
1170248383 20:14249893-14249915 CTATCCCCCACCCCCGTGTCTGG - Intronic
1172033845 20:31998531-31998553 TTCTCCCCCACCACTGTGACAGG - Exonic
1172118993 20:32586589-32586611 CTCTCTCCGAGCGCGGTGAAAGG - Intronic
1173488334 20:43457959-43457981 CGCACCCGCACCGCGGTTACTGG + Exonic
1178890068 21:36513722-36513744 CTCTCACCCACTGAGGTGCCAGG - Intronic
1179803302 21:43822186-43822208 CTCTGCCCCACCGCCCTGTCTGG + Intergenic
1180073327 21:45449538-45449560 CTCTCCCCCACGGTGGGGGCAGG - Intronic
1183871766 22:40745753-40745775 CTCTGCCCCACCGCCCTGTCTGG - Intergenic
1184163921 22:42716267-42716289 CTCTCCACCACTGGGGTGAGTGG + Intronic
1184202579 22:42981124-42981146 CTCTGCCCCACCGCCCTGTCTGG + Intronic
1184682731 22:46080565-46080587 TCCTCCCCCACCCGGGTGACCGG + Intronic
960780673 3:121313952-121313974 CTCTGCCCCACCGCCCTGTCTGG - Intronic
960831822 3:121857820-121857842 CTCTCCCCCAACCCCATGACAGG + Intronic
961018557 3:123485494-123485516 GTCTCCCCCACCTCGCTGAATGG - Intergenic
962240691 3:133748401-133748423 CTCTCCCCCAGGGCTGTGTCTGG + Exonic
963498341 3:146096524-146096546 CTCTGCCCCACCGCCCTGTCTGG + Intronic
967176052 3:186864178-186864200 CTCTGCCCCACCGCCCTGTCTGG + Intergenic
984804278 4:183737144-183737166 CTCTGCCCCACCGCCCTGTCTGG - Intergenic
996355568 5:122592689-122592711 CTCTCCCCCCACCCCGTGACAGG + Intergenic
997305237 5:132831206-132831228 CTCTCCCCCACCCCGGTAGCAGG - Intergenic
1002069150 5:176668543-176668565 CTCGCCCCCACCCCCGAGACAGG - Intergenic
1002163757 5:177332369-177332391 CTCTGCCCCTCCCCGGTGAGGGG - Intronic
1005425833 6:25701616-25701638 GTCCCCCCCACCCTGGTGACTGG - Exonic
1005837161 6:29718535-29718557 CTCTGCCCCACCGCCCTGTCTGG + Intergenic
1006770304 6:36547424-36547446 CGGTCCCCCGCCGCGGAGACGGG + Exonic
1008926659 6:56895375-56895397 CTCTGCCCCACCGCCCTGTCTGG - Intronic
1010182473 6:73103478-73103500 CTCTCCCCCCCCCCCATGACAGG - Intronic
1014764283 6:125389485-125389507 CTCTGCCCCACCGCCCTGTCTGG - Intergenic
1018747826 6:166776045-166776067 CTCTCCAGCACCGCTGTGGCTGG - Intronic
1021272601 7:18609778-18609800 CCCTCCCCCAACTCCGTGACAGG + Intronic
1025852807 7:65258070-65258092 CTCTGCCCCACCGCCCTGTCTGG + Intergenic
1025979573 7:66394470-66394492 CTCTGCCCCACCGCCCTGTCTGG - Intronic
1029027929 7:97437432-97437454 CTCTTCCTCAGCACGGTGACTGG + Intergenic
1035327947 7:158076824-158076846 CTCCCCCCAACCCCGGTGCCAGG - Intronic
1035352851 7:158258611-158258633 ATCTCCCCCAAAGCTGTGACTGG - Intronic
1037691381 8:21184096-21184118 CTCTCCCACACAGAGGTAACAGG + Intergenic
1038595072 8:28880896-28880918 CTCTGCCCCACCGCCCTGTCTGG + Intronic
1043443376 8:80296720-80296742 CTTTCCCCCAACCCTGTGACAGG - Intergenic
1044252785 8:90023865-90023887 CTCTCCCCCAACCCCATGACAGG + Intronic
1045103693 8:98869992-98870014 CTCTCCCCCAACCCCATGACAGG + Intronic
1045142979 8:99308327-99308349 CTCTCCCCCAACCCCATGACAGG + Intronic
1047663104 8:127059995-127060017 CTCTCCCTCACCACTGTTACGGG - Intergenic
1049796089 8:144497866-144497888 CTCTCACCCACAGAGGTGGCTGG - Intronic
1053372718 9:37576220-37576242 CGCTCGCCCACCGCGGAGTCCGG + Exonic
1055895369 9:81168425-81168447 CACTCCCCCCCGCCGGTGACAGG - Intergenic
1061791882 9:133063414-133063436 CTCTCCCACACCAGTGTGACAGG + Intronic
1190063225 X:47223961-47223983 CTGTCCCCCACCACGGGGCCTGG - Intronic
1192106952 X:68326503-68326525 CTCTGCCCCACCGCCCTGTCTGG + Intronic
1198236605 X:134741498-134741520 CTCTCTCCCTCCTCGGTGATTGG - Intronic
1198709030 X:139481369-139481391 CTTTCCCCCAACCCCGTGACAGG + Intergenic