ID: 1115853553

View in Genome Browser
Species Human (GRCh38)
Location 14:37606132-37606154
Sequence AGGTGCTTGAAGAAGTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 197}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115853550_1115853553 -1 Left 1115853550 14:37606110-37606132 CCATGGGTAAGGTGGGGTGAGCA 0: 1
1: 0
2: 4
3: 26
4: 180
Right 1115853553 14:37606132-37606154 AGGTGCTTGAAGAAGTCTGGAGG 0: 1
1: 0
2: 1
3: 12
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115853553 Original CRISPR AGGTGCTTGAAGAAGTCTGG AGG Intronic
900361580 1:2291628-2291650 AGGTGCTGGAAGGAGGGTGGGGG - Intronic
900794737 1:4701094-4701116 AGGTGCTTGGAGGAGACTGAAGG - Intronic
902369234 1:15994928-15994950 AGATGCTTCTAGAAGCCTGGAGG - Intergenic
905420095 1:37836191-37836213 AGGTTCTTGAAAAAGTAAGGTGG + Intronic
907432010 1:54417984-54418006 AGGTCCCTGAAGAAGTGTGATGG - Intergenic
907925215 1:58949590-58949612 TGGGCCTTGATGAAGTCTGGAGG + Intergenic
909559583 1:76994999-76995021 AGGTGATTTATGAATTCTGGAGG - Intronic
909849714 1:80445357-80445379 AGTTCCTTGAAGAAGTGAGGTGG + Intergenic
913658233 1:120982136-120982158 AGGGGCTTGCAGAAGGGTGGAGG + Intergenic
914009591 1:143765225-143765247 AGGGGCTTGTAGAAGGGTGGAGG + Intergenic
921266228 1:213423019-213423041 AGGTGCCTGAAGAAGTCACAGGG - Intergenic
924706790 1:246508827-246508849 AGATGCTTCTAGAAGCCTGGAGG + Intergenic
1065391942 10:25191773-25191795 AGGTGCTTTATGAAGGCAGGGGG + Intronic
1065710670 10:28514257-28514279 GGTTGCTTGAATAAGGCTGGTGG + Intergenic
1067427670 10:46221882-46221904 AGCTGATAGAAGAAGTGTGGGGG + Intergenic
1067795730 10:49320340-49320362 AGGTGCTGGCAGGAGCCTGGTGG - Intronic
1070712657 10:78693999-78694021 AGGTGCTTAGGGAAGACTGGTGG - Intergenic
1071148816 10:82608677-82608699 AGGTGATAAAAGAAGGCTGGAGG + Intronic
1071718156 10:88117521-88117543 AGGTTCTTTGAGATGTCTGGGGG + Intergenic
1072735434 10:97875911-97875933 AGATGCTTGAAGAGGCCTAGTGG + Intronic
1073495207 10:103884672-103884694 AGGTGCTCGAAGAGGTATTGCGG + Intronic
1073692769 10:105829359-105829381 AGGTGGGTGATGAAATCTGGAGG + Intergenic
1074105733 10:110388551-110388573 AGGGGCTGGGGGAAGTCTGGAGG - Intergenic
1074270472 10:111948707-111948729 AGGTGCATGAGGAAATTTGGGGG + Intergenic
1075000023 10:118789573-118789595 AGTTGTTTGAAGAATTATGGTGG - Intergenic
1077119243 11:899274-899296 TGGTGTTTGAAGGAGGCTGGAGG - Intronic
1077589004 11:3477313-3477335 AGGTGCTTGAGGGAGCATGGGGG + Intergenic
1078581739 11:12544203-12544225 AGGTGCTGGCAGGAGACTGGAGG - Intergenic
1080409661 11:32011658-32011680 AGGTGCTTGCAGAAGAAGGGAGG + Intronic
1082866024 11:57900851-57900873 TGGTGCTAGGAGAAGTGTGGGGG + Intergenic
1083516385 11:63262745-63262767 AGTTCCTTGAATAGGTCTGGAGG - Intronic
1084827983 11:71745620-71745642 AGGTGCTTGAGGGAGCATGGGGG - Intergenic
1085063576 11:73471543-73471565 AGGCTTTTGAAGAAGGCTGGTGG - Intronic
1085472231 11:76765729-76765751 TTGTGCTGGAAGAAGTCTTGGGG + Intergenic
1085803491 11:79613062-79613084 TGGTGCTTGAAGCAGAATGGAGG - Intergenic
1086074232 11:82833278-82833300 AGGTGCTAGTAGAAGTAAGGGGG + Intronic
1087054656 11:93921886-93921908 GGGTGCTAGAGGAAGGCTGGAGG + Intergenic
1087424863 11:97972928-97972950 AGGGGCTGAAAGAGGTCTGGAGG - Intergenic
1087745027 11:101934108-101934130 ATGTGCTTGAAGACAGCTGGAGG - Intronic
1088594285 11:111428350-111428372 TGGGGTTTGAAGAAATCTGGAGG - Intronic
1089158135 11:116417497-116417519 ATGAGCTTGAAGAAGCCGGGAGG - Intergenic
1090329185 11:125916952-125916974 AAGTGCTTGAAGAAGAGTGATGG + Intronic
1090363530 11:126188975-126188997 GGGTCCTTGAAGAATTCAGGTGG - Intergenic
1092415265 12:8286081-8286103 AGGTGCTTGAGGGAGCATGGGGG + Intergenic
1099097867 12:78398144-78398166 AAGTGCATGAAGAAGACTGTGGG - Intergenic
1100450594 12:94702077-94702099 AGCAGCTTGAAGAAGTGGGGAGG + Intergenic
1100527700 12:95435289-95435311 AGATGCTTGAAGAAGTCTGTTGG - Intergenic
1101147814 12:101857879-101857901 AGGGAATAGAAGAAGTCTGGAGG - Intergenic
1101675828 12:106915305-106915327 AGGTGTTTGCAGAAGTGTGGGGG - Intergenic
1102510864 12:113414549-113414571 AGGGGCTTGAAGCAGGGTGGCGG - Intronic
1104807525 12:131599030-131599052 AGGTGCCTGAGGAGGACTGGTGG - Intergenic
1106474251 13:30083770-30083792 AAGTGTCTCAAGAAGTCTGGGGG - Intergenic
1107635956 13:42392807-42392829 AGGTGCTTGATGAATTTTGGTGG + Intergenic
1110676799 13:78257570-78257592 AGGAGATTGAAGAAGTTTAGGGG - Intergenic
1111796419 13:92926367-92926389 AAGAGCTGGAAGAATTCTGGAGG - Intergenic
1114413134 14:22519023-22519045 AGGAGCTTTAAGAGGTGTGGAGG + Intergenic
1115853553 14:37606132-37606154 AGGTGCTTGAAGAAGTCTGGAGG + Intronic
1116857180 14:49963041-49963063 TGGTGCCTGAGGAAGACTGGGGG + Intergenic
1116964934 14:51004299-51004321 ACTTCCTTGAAGAGGTCTGGCGG + Intronic
1117590700 14:57265334-57265356 AGATTCTTGAAGAATTATGGGGG + Intronic
1117798751 14:59422086-59422108 ATGTGTGTGAAGATGTCTGGTGG + Intergenic
1120554818 14:85916536-85916558 TGGGTCTTGAAGAAGTCTGCTGG + Intergenic
1120943642 14:89973508-89973530 AGGTGCTTCAAGAGATCAGGAGG - Intronic
1121440982 14:93949151-93949173 AGATGCTTGAAGATGTCAGTGGG + Intronic
1130366767 15:83247890-83247912 AAGTGCTGGAAGAATTCTAGAGG + Intergenic
1131050088 15:89341962-89341984 AGGTGCTTAAAAAACTTTGGAGG - Intergenic
1131753556 15:95536509-95536531 AAGTGCTTGAAGCAGCCTGATGG + Intergenic
1136342575 16:29654668-29654690 AGGGGCTGGCAGAAGCCTGGAGG - Intergenic
1137559436 16:49493302-49493324 AGGTGCCTGGAGAGGTCTGCAGG - Intronic
1137597352 16:49733750-49733772 AGGGGCCTGAAGAAGTTTTGGGG + Intronic
1142475117 17:184108-184130 AGGGCTTTGAAGAAGTCAGGTGG + Intergenic
1143206072 17:5139850-5139872 AGATGCTTCTAGAAGCCTGGAGG - Intronic
1143928100 17:10391193-10391215 TGGTGAGTGAAGAAGTCAGGTGG + Intronic
1144500809 17:15785963-15785985 AGATGCTTGAGGTAGTTTGGGGG - Intergenic
1146228388 17:31087714-31087736 AGCTGCTTGAAGAAGTATCAGGG + Intergenic
1146504514 17:33393450-33393472 AGGTGGTTAGAGAAGGCTGGTGG - Intronic
1146667598 17:34715410-34715432 GGGTGCTAGTGGAAGTCTGGGGG - Intergenic
1146842539 17:36165987-36166009 AGATGCTTCTAGAAGCCTGGAGG + Exonic
1146854851 17:36253946-36253968 AGATGCTTCTAGAAGCCTGGAGG + Exonic
1146865769 17:36334430-36334452 AGATGCTTCTAGAAGCCTGGAGG - Exonic
1146870751 17:36377838-36377860 AGATGCTTCTAGAAGCCTGGAGG + Exonic
1146878109 17:36428919-36428941 AGATGCTTCTAGAAGCCTGGAGG + Exonic
1146882050 17:36450023-36450045 AGATGCTTCTAGAAGCCTGGAGG + Intergenic
1147068639 17:37935042-37935064 AGATGCTTCTAGAAGCCTGGAGG - Exonic
1147073634 17:37978462-37978484 AGATGCTTCTAGAAGCCTGGAGG + Intronic
1147080161 17:38014579-38014601 AGATGCTTCTAGAAGCCTGGAGG - Intronic
1147085156 17:38058000-38058022 AGATGCTTCTAGAAGCCTGGAGG + Exonic
1147096110 17:38138539-38138561 AGATGCTTCTAGAAGCCTGGAGG - Intergenic
1147101102 17:38181966-38181988 AGATGCTTCTAGAAGCCTGGAGG + Intergenic
1148921459 17:51038678-51038700 AGGTGCATGGAAAGGTCTGGAGG - Intronic
1149845693 17:60008429-60008451 AGATGCTTCTAGAAGCCTGGAGG + Intergenic
1150084041 17:62265009-62265031 AGATGCTTCTAGAAGCCTGGAGG + Intergenic
1151455909 17:74225741-74225763 AGGTGCTGGTAGGAGACTGGAGG - Intronic
1151661911 17:75523661-75523683 AGGCTGTTGGAGAAGTCTGGGGG + Exonic
1151738194 17:75959585-75959607 AGGTGCATGAAGAAAGCAGGTGG + Intronic
1153537197 18:6115198-6115220 AGGTGCTTAAAGCAGAGTGGTGG + Intronic
1156630353 18:38961013-38961035 AGGGGTATGATGAAGTCTGGGGG + Intergenic
1156841248 18:41612317-41612339 TGGTGCTTGAAGAGATCTGATGG + Intergenic
1157040119 18:44028649-44028671 AGATGCTTTAAGATATCTGGTGG - Intergenic
1159480542 18:68985754-68985776 AGATGCTGGCAGAAGACTGGTGG - Intronic
1160477869 18:79208979-79209001 AGCAGCATGAAGAAGGCTGGAGG - Intronic
1162143427 19:8598304-8598326 AGATGCTTGAGGCAGTCAGGGGG - Intronic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1165421120 19:35722488-35722510 AGGGCCCTGAAGAAGACTGGCGG + Intronic
1168714484 19:58518998-58519020 AGGTGCTCGAAGTGGTCTGAGGG - Intronic
925179471 2:1807548-1807570 TGGTGCTTGAAGAGGTTTGCAGG + Intronic
925373279 2:3362781-3362803 AGGTGCTGGAGGCAGGCTGGGGG + Intronic
928735188 2:34280122-34280144 GGGTGCTGGAAGATGGCTGGGGG + Intergenic
929346488 2:40890443-40890465 AGGTGCTTGTAGGTGTGTGGTGG - Intergenic
929571053 2:43023294-43023316 TGATCCTTGAAGAAGTCTTGAGG + Intergenic
931869328 2:66441936-66441958 AGGAGCGGGAAGGAGTCTGGAGG + Intronic
935054195 2:99551580-99551602 AGGTCGTTGAAGAATTCTAGGGG + Exonic
937646815 2:124274852-124274874 AGCTGCTTAAAGAAGTCAGATGG - Intronic
938338522 2:130520186-130520208 AGATGCTTGATGAAGTCCTGGGG + Intergenic
938351317 2:130600564-130600586 AGATGCTTGATGAAGTCCTGGGG - Intergenic
941702867 2:168623561-168623583 ACGTGCTTGAATATGTCTGATGG + Intronic
944299040 2:198101584-198101606 TGGTGTCTGAAGAAGTCTAGAGG + Intronic
947296136 2:228632457-228632479 AGCTGCTTTAGAAAGTCTGGGGG - Intergenic
947666703 2:231910565-231910587 AGGTGCTGGCAGAAGTTTGCTGG - Intergenic
1168761732 20:354220-354242 AGGTGGGTGAAGAAGGCTGGAGG + Exonic
1170002286 20:11628041-11628063 AGGTGCTAGGTGAAGCCTGGGGG - Intergenic
1172162134 20:32876070-32876092 AGGTGCTGGAGGGAGGCTGGAGG + Intronic
1172274826 20:33673828-33673850 TGGGGCCTGAAGAACTCTGGGGG + Intronic
1172777231 20:37414795-37414817 AGGGGCTTGAAGGGGGCTGGGGG - Intergenic
1172926296 20:38539271-38539293 AGGTGCATGAAGAGATTTGGAGG + Intronic
1172971807 20:38879090-38879112 AGGTGCTGGGAGAATTCTGGAGG + Intronic
1173303216 20:41822780-41822802 AGCTGCTTGAAGAAGTTTCCAGG + Intergenic
1173608498 20:44349422-44349444 AGGTGCTCTCAGAAGTTTGGGGG - Intronic
1174114073 20:48214838-48214860 GGCTGCGTGAGGAAGTCTGGGGG + Intergenic
1174918067 20:54674033-54674055 AATTGCTTTAAGAAATCTGGTGG + Intergenic
1177585497 21:23088930-23088952 AGTTCCTTAAAGAAGTTTGGTGG + Intergenic
1179080362 21:38165217-38165239 AGGTACTTGATGAAGTCTTCTGG - Intronic
1183492407 22:38123593-38123615 AGGTGCCTGATAAAGTCTGTTGG + Intronic
1184022738 22:41832332-41832354 AGGTGCTTGAAGGAGTGGGTGGG + Intergenic
949908333 3:8878124-8878146 AGATGCTGGTAGAAGTCTGTCGG + Exonic
950183424 3:10930709-10930731 AGCTGCTTGGAGAAGGCAGGTGG + Intronic
951647164 3:24905650-24905672 ACCTGCTTAAAGAAGCCTGGAGG + Intergenic
953698854 3:45180693-45180715 AGATGCTTGAAGAAGCCGAGAGG - Intergenic
953722878 3:45371557-45371579 AGGAGCTTGAATAACTCTGTAGG + Intergenic
953781030 3:45870804-45870826 AGCTCCTGGAAGAAGTCAGGGGG - Intronic
954249074 3:49354439-49354461 AGGTGCCTGAAGAAGTCAGAAGG - Intergenic
954364495 3:50138893-50138915 GGGTGGTTGAGGAAGTCTCGGGG + Intergenic
954373794 3:50183850-50183872 AGGTGCTGGAGGCAGGCTGGAGG + Intronic
954553754 3:51502805-51502827 AGGTGTTTGAAGGTGTCTGCAGG - Intergenic
956235761 3:67069136-67069158 GGTTGTTTAAAGAAGTCTGGGGG - Intergenic
958070761 3:88608364-88608386 AGGTCCTTGAGGGGGTCTGGGGG - Intergenic
959156579 3:102673847-102673869 AGCTGGTTGAAGAAGTCGTGCGG + Intergenic
959472123 3:106764727-106764749 AGGTGCTTGAAGAAATGTTAAGG - Intergenic
961892816 3:130144695-130144717 AGGTGCTTGAGGGAGCATGGGGG + Intergenic
963040874 3:141068950-141068972 AGGTGGTTGAACAAGTTTGGTGG + Intronic
966970600 3:185041980-185042002 AGGTGCTTGGTGCAGTCTGCTGG + Intronic
967130882 3:186469712-186469734 AGGTGCTCGGAGAAGGCAGGAGG - Intergenic
971263400 4:25076975-25076997 AGGTGCTGGAAGGAGGTTGGGGG - Intergenic
973220166 4:47717189-47717211 GGTTGCTTGAAAAAGCCTGGAGG - Intronic
976615478 4:87071623-87071645 AGGTGGATGAAGTAGTCAGGAGG + Intronic
978413345 4:108449221-108449243 TGTTGCCTGAAGAAGTCTGCAGG + Intergenic
978570187 4:110128463-110128485 TGGAGCTTGAGTAAGTCTGGTGG + Intronic
980676951 4:136097362-136097384 AGGTGATTTAAGAAGTATGGTGG - Intergenic
981548645 4:145919982-145920004 AGGTGCTTGTAGACTTCAGGTGG - Intronic
981934523 4:150224833-150224855 AGGTGCGTCAAGAACTCTGAGGG + Intronic
983437159 4:167730646-167730668 AGATGATTGAAGATATCTGGCGG + Intergenic
984423155 4:179550797-179550819 AGGTTATTGAAGAACTCTAGAGG - Intergenic
984860652 4:184235252-184235274 AGGCTCTGGAAGAAGTATGGAGG + Intergenic
986320777 5:6631224-6631246 AGATGCTTGGAGAACTCCGGAGG - Intronic
988716071 5:33829607-33829629 AGGGGGTTGAAGAAGGCAGGGGG - Intronic
990872095 5:60443271-60443293 AGGTCATTCAAGAAGTTTGGAGG + Intronic
991270142 5:64769366-64769388 ATGTACTTGAAGAAGTCAAGTGG + Intronic
997170266 5:131712230-131712252 AGGTTTTTGAAGAAGAATGGGGG - Intronic
999728096 5:154453601-154453623 AGTTGCTTCCAGAACTCTGGAGG - Intronic
1002994248 6:2268140-2268162 AGGTGCTTGAGGGAGTGAGGAGG + Intergenic
1004668459 6:17771975-17771997 AGGGGCTTGAAAAACTTTGGTGG + Exonic
1005808738 6:29500427-29500449 AGGCACGTGAAGGAGTCTGGTGG - Intergenic
1007042596 6:38737807-38737829 AGGTGCTAGAATAAGTATTGAGG + Exonic
1007818945 6:44545741-44545763 AAGTGTTGGGAGAAGTCTGGGGG - Intergenic
1010547192 6:77173053-77173075 AGTTGCTTAAAGAAGTGGGGTGG - Intergenic
1010678914 6:78776446-78776468 AGGTGCTTGAAAAGGTTTGTGGG + Intergenic
1013930150 6:115520933-115520955 AGGTGGTTGTAGATGTGTGGTGG - Intergenic
1015023541 6:128505912-128505934 AGCAGCTTGAAAAAGTCTTGGGG + Intronic
1015185182 6:130408057-130408079 AGGAGTTTGGAGCAGTCTGGAGG + Intronic
1019514298 7:1432986-1433008 GGGAGCTTGAAGATGTGTGGTGG - Intronic
1022376283 7:29814518-29814540 ATGTGCTTGTCGAAGGCTGGGGG + Intronic
1023834611 7:44060828-44060850 AGGTGATCGACGAAGGCTGGTGG + Exonic
1026539776 7:71269554-71269576 AGGGGCTGGAGGAAGTATGGAGG + Intronic
1028232835 7:88326049-88326071 AAGTGCTTTAAGAATTCTAGGGG - Intergenic
1028346997 7:89795396-89795418 AGCTGCTTGCAGTAGTCTGAGGG + Intergenic
1028882426 7:95894815-95894837 AGATGCTTGAAGAAGTCAGTTGG + Intronic
1029504863 7:100957062-100957084 AGGTGATTGAAGAAGTGATGGGG - Exonic
1030374294 7:108737372-108737394 AGGAGAATGAAGAAGTCTGATGG - Intergenic
1030510652 7:110478995-110479017 AGGCTCTGGAAGGAGTCTGGAGG - Intergenic
1033138143 7:138801667-138801689 AAATGCTTGAAGAAGTTTGGAGG + Intronic
1037462933 8:19131433-19131455 AGGTGCTGGAACAAGTCGGTTGG + Intergenic
1039503246 8:38032963-38032985 AGGTGCTTGAGGATAACTGGGGG + Intronic
1042022919 8:64389353-64389375 TGGTGTTTGAAGAAGTCCAGCGG + Intergenic
1042700083 8:71602666-71602688 AGGTGCTGAAAGAAGGCTAGTGG + Intergenic
1043536905 8:81215097-81215119 AGGGGCTTGAGGAACTTTGGAGG + Intergenic
1044132514 8:88542738-88542760 TGCTGCTTGAAGAAGGCTGGAGG + Intergenic
1046910320 8:119619030-119619052 AGGTGATTGGAGAAAACTGGGGG + Intronic
1047448230 8:124938642-124938664 CGGTGCTTGAGGAAGGCTTGAGG - Intergenic
1048452943 8:134549934-134549956 AGGTCCTTGAAGAGGTCCGAGGG - Intronic
1048559004 8:135512413-135512435 AGGTGTTTGGAAAAGTCGGGGGG + Intronic
1050699409 9:8321090-8321112 AAGTGATTGAAGATGTCTAGCGG + Intronic
1052402193 9:28014372-28014394 AGGTGCTTGCATATGTATGGAGG - Intronic
1052946404 9:34171888-34171910 AGGCACTGGAAGAAGACTGGAGG + Intergenic
1052971368 9:34379149-34379171 AGTCACTTCAAGAAGTCTGGTGG - Exonic
1057544265 9:96005597-96005619 AGGAGCTGGGAGAAGACTGGTGG + Intronic
1203769983 EBV:44955-44977 AGGTGCTTGTGGAAGTCTTGCGG + Intergenic
1187547822 X:20268897-20268919 ACGTGCTTGCAGAAGTTTGGAGG + Intergenic
1189155841 X:38756101-38756123 TGGTGCTTGAAGAAGCTTTGGGG - Intergenic
1189470861 X:41313022-41313044 AGCTACTTGTAGCAGTCTGGTGG + Intergenic
1196667821 X:118334620-118334642 AGTTGCTTGAATAAGCCTCGTGG + Intergenic
1198148559 X:133884325-133884347 AGGGGCTTGTTGCAGTCTGGAGG - Intronic