ID: 1115856392

View in Genome Browser
Species Human (GRCh38)
Location 14:37633735-37633757
Sequence CATTGACACCAGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 265}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115856392_1115856400 27 Left 1115856392 14:37633735-37633757 CCCTCTTCCCTCTGGTGTCAATG 0: 1
1: 0
2: 3
3: 27
4: 265
Right 1115856400 14:37633785-37633807 CACTCCTATTCTTTCCAACTAGG 0: 1
1: 0
2: 0
3: 21
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115856392 Original CRISPR CATTGACACCAGAGGGAAGA GGG (reversed) Intronic
904026099 1:27504693-27504715 CATTCTCACCAGAGGGAAGCAGG - Intergenic
904568890 1:31445733-31445755 CATTGAGACCAGAGGGAAAGAGG - Intergenic
904895511 1:33814601-33814623 CATTGAAACAGGAGGGAAAAAGG - Intronic
905005507 1:34706475-34706497 CAGTGAATCCAGAGGCAAGAAGG + Intergenic
905304312 1:37007003-37007025 CTTGCACAGCAGAGGGAAGACGG - Intronic
909812305 1:79945272-79945294 CATGGACACTGCAGGGAAGATGG + Intergenic
912193424 1:107368171-107368193 CATTGGAACCAGAGGTAATAAGG - Intronic
915196774 1:154195399-154195421 CATTCGCCACAGAGGGAAGAGGG + Intergenic
915445468 1:155972176-155972198 CATTGATGCCAGAGAGAGGAAGG - Intronic
915755919 1:158259717-158259739 TATTGACCCCAGATGGTAGATGG + Intergenic
915822675 1:159042102-159042124 GCTGGACACCAGAGGGAAAATGG - Intronic
917651125 1:177078286-177078308 CAGTGACCCCACAGGGATGAAGG - Intronic
920602918 1:207347234-207347256 CATGGATACCAAAGGGAAAATGG + Intronic
921534210 1:216325409-216325431 CATTGACAAAAGAGAGAGGATGG + Exonic
922789255 1:228301418-228301440 CATTATAACCAGAGGGTAGAGGG - Intronic
922904898 1:229166684-229166706 CATTGACCCCACAGGCTAGAGGG - Intergenic
923658032 1:235935319-235935341 CATAGACACCATATGGAGGAGGG + Intergenic
923776098 1:236979877-236979899 CAAGGACACCAGAGGAAAGCAGG + Intergenic
923933136 1:238726510-238726532 CAGTGACACCAGAGGAAGGGAGG + Intergenic
924220788 1:241873289-241873311 CATTGAGTCTAGAGGGAAGCAGG + Intronic
1063615584 10:7597241-7597263 CATGGACACCAGTGGGGAGGGGG + Intronic
1064577958 10:16765133-16765155 CATTGCCACCAGAAGAAAGATGG + Intronic
1066336092 10:34480030-34480052 CATTGACAGAAGTGGAAAGATGG - Intronic
1067778608 10:49180427-49180449 CACTGACACCTGATGGGAGAAGG - Intronic
1067856601 10:49799057-49799079 CAGTGACAGAAGAGGGAGGAGGG - Intergenic
1068299471 10:55120108-55120130 AATTGACAACAGAGGAAACAGGG + Intronic
1068342092 10:55718374-55718396 CAATGACACCAGACAGAAAAGGG + Intergenic
1068429985 10:56919269-56919291 AATGGAAACCTGAGGGAAGAAGG - Intergenic
1068919031 10:62463950-62463972 CACTGACACCAGCGGGATGTAGG + Intronic
1069856201 10:71442589-71442611 CATTGAGGCCAGAGGGGAGAAGG - Intronic
1069860326 10:71467146-71467168 CAGAGACCCCAGAGGGAAGAGGG + Intronic
1070787066 10:79168076-79168098 AATTGGCTCCAGAGGGTAGAGGG - Intronic
1071730169 10:88240084-88240106 CTTTGAAAACAGAGCGAAGAAGG - Intergenic
1073379165 10:103065024-103065046 GATGGAGTCCAGAGGGAAGATGG + Intronic
1074105647 10:110388028-110388050 CATTGAGAACAGAAGGTAGAAGG + Intergenic
1075552865 10:123405963-123405985 CATTGAGAGCAGAGGGGAAAAGG - Intergenic
1076340813 10:129743679-129743701 CTATGACCCCACAGGGAAGAAGG - Intronic
1076930219 10:133527439-133527461 CATGGACACCAGCAGGAGGAAGG - Exonic
1077083800 11:737411-737433 CAGTGAGACCAGAGGGAACACGG - Intergenic
1077413858 11:2415481-2415503 CATGGGCACCCGAGGGAAGGGGG + Intronic
1077782154 11:5342828-5342850 CATTGCCTCCAGAGAGGAGAGGG - Exonic
1078197279 11:9146470-9146492 TATTTACAGAAGAGGGAAGAGGG - Intronic
1078252262 11:9625947-9625969 CACTGTAACAAGAGGGAAGAAGG - Intergenic
1080698129 11:34620747-34620769 CAAAGACACCATCGGGAAGAGGG - Intergenic
1081174220 11:39906893-39906915 CATAGATACCAGAGGGAAGTTGG + Intergenic
1081730072 11:45365440-45365462 CATTCACTCCCAAGGGAAGAAGG - Intergenic
1082098484 11:48151332-48151354 CATAGACACATGAGGGGAGATGG - Intronic
1082321538 11:50818328-50818350 CTTTGACAACTGAGAGAAGAAGG - Intergenic
1082586356 11:54946384-54946406 CATTGACGCCAAAGGCAAAAAGG - Intergenic
1084424215 11:69075852-69075874 TATAGACAACAGAGGGAAGTGGG + Intronic
1085621637 11:78042125-78042147 CTGTGACACCAGAAGCAAGATGG - Intronic
1087340999 11:96907012-96907034 CAATCACACCAGAGGAAAGGTGG - Intergenic
1088006809 11:104950981-104951003 CTTTGACATCACAGGGATGAAGG - Exonic
1089202477 11:116732749-116732771 TAGTCACACCTGAGGGAAGAGGG + Intergenic
1089702884 11:120255863-120255885 CAAGGTCACCAGAGGGAGGAAGG - Intronic
1090420580 11:126572548-126572570 CAGAGACCCCAGTGGGAAGAGGG + Intronic
1090925599 11:131247363-131247385 CTTTGTCAACAGAAGGAAGAAGG - Intergenic
1091364309 11:135004983-135005005 TAGTGACAGCAGAGGGGAGAAGG - Intergenic
1091912394 12:4242958-4242980 CATTGAAACCAGAGGAAAACAGG - Intergenic
1091979902 12:4856355-4856377 GACTGACACCAGAGGAAAAAGGG - Intergenic
1094771252 12:33662762-33662784 CAGTGAATCCAGAGGGAAGCAGG + Intergenic
1095281969 12:40362600-40362622 CAGTGACACCAGTGGGGAAAAGG + Intronic
1095337683 12:41048357-41048379 CATTGACTAAAGAGAGAAGATGG - Intronic
1095734050 12:45536856-45536878 TAATGGCACCAGAGGGAAAATGG - Intergenic
1095797665 12:46237967-46237989 CATTATAACCAGAGGGAGGAGGG + Intronic
1096448157 12:51713533-51713555 CATTGCCACCGGCAGGAAGAGGG - Intronic
1096621611 12:52869102-52869124 CAGTGACAGCACAGGGAAGTAGG - Intergenic
1096666520 12:53169969-53169991 CATGGAGACGAGAGGGATGAAGG + Intronic
1096802392 12:54119798-54119820 AATTGACCCCAGATGGAATAGGG + Intergenic
1096871402 12:54594755-54594777 CAGACACACAAGAGGGAAGAAGG - Intergenic
1097228181 12:57491520-57491542 CAGTGACAACAGAGAGGAGAAGG - Intronic
1097593799 12:61603169-61603191 TTTTGACTCCAGAGGGAAAATGG + Intergenic
1098981383 12:76960514-76960536 CATTTGCACCAGGAGGAAGATGG + Intergenic
1100875159 12:98954038-98954060 CATTGTCACCACCTGGAAGATGG + Intronic
1101418760 12:104531808-104531830 CATTGACAGTAATGGGAAGAAGG - Intronic
1101865824 12:108518689-108518711 CATCGACAGCAAAGTGAAGAAGG + Exonic
1104144196 12:126017230-126017252 CATTGACACCAGAGAGTAAGTGG - Intergenic
1104176128 12:126334491-126334513 CAGTTACACCAGAGAGAAAATGG - Intergenic
1104619725 12:130302003-130302025 CATTTTTCCCAGAGGGAAGAGGG - Intergenic
1106214266 13:27680443-27680465 AAATGAGACCAGAGGGATGAAGG + Intergenic
1106925250 13:34606733-34606755 AATTGACCCAAGAGGGAAGGAGG + Intergenic
1107600091 13:42004364-42004386 CATGGAGACAGGAGGGAAGAAGG - Intergenic
1108117714 13:47147717-47147739 TATTGGCAGCAGTGGGAAGAGGG + Intergenic
1109135499 13:58644835-58644857 GAGTGACACCAGAAGCAAGAAGG + Intergenic
1109219398 13:59626019-59626041 CCCTGACAGCAGAGGGTAGAAGG + Intergenic
1109720148 13:66265553-66265575 CAGTGACTCCTGATGGAAGAAGG + Intergenic
1111447114 13:88361103-88361125 CATTCACAGCCCAGGGAAGAAGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1113793114 13:113041195-113041217 CAGAGTCACCAGAGGGATGAAGG - Intronic
1114148472 14:20007340-20007362 TAATGACACCAATGGGAAGAAGG - Intergenic
1115856392 14:37633735-37633757 CATTGACACCAGAGGGAAGAGGG - Intronic
1116936681 14:50747706-50747728 CCTAGGCAACAGAGGGAAGAAGG + Intronic
1118932025 14:70251898-70251920 CATTGGAATAAGAGGGAAGATGG - Intergenic
1118953153 14:70453300-70453322 CATTGGAATAAGAGGGAAGATGG + Intronic
1119286536 14:73459114-73459136 CATTGAGACCAAAGAAAAGAAGG - Intronic
1119705656 14:76781234-76781256 CATTGACCCCAGGGGGAACTTGG - Exonic
1119914787 14:78387778-78387800 CATTATCACCATAGGAAAGAAGG - Intronic
1121930224 14:97965450-97965472 CATTGACAACAGGAGGGAGAGGG + Intronic
1122468329 14:101949162-101949184 CCTTTACACCAGGGGCAAGAGGG + Intergenic
1124849364 15:33321429-33321451 CATGGAAAGCAGAGGGAAAAAGG - Intronic
1125530774 15:40412058-40412080 CCTTGACAACAGAAGCAAGAAGG + Intronic
1128034073 15:64507775-64507797 AATAGAGAGCAGAGGGAAGATGG + Intronic
1128234807 15:66060073-66060095 GATGGACAGCAGAGGGATGAAGG + Intronic
1129022146 15:72530063-72530085 AATTGATAGCAGAGGGTAGATGG + Intronic
1132756696 16:1488708-1488730 AATTGGCAGCAGATGGAAGACGG - Intronic
1133342933 16:5049039-5049061 AATGGAAACCAGAAGGAAGAAGG + Intronic
1134125805 16:11615200-11615222 CATTTACACCCCAGGGTAGATGG - Intronic
1135122165 16:19775661-19775683 CAGTGACCTCAGAGGTAAGAGGG - Intronic
1135985518 16:27181013-27181035 GATTGAGACCAGAGGGCAGTGGG + Intergenic
1136568220 16:31082339-31082361 CGTTGGCAGCAGAGGGAAAAGGG - Intronic
1138756565 16:59493597-59493619 AATTGAAACCAGAGGGAAGAGGG - Intergenic
1139257637 16:65558152-65558174 CATTCACACCTGAGGGATGTAGG - Intergenic
1140445573 16:75024890-75024912 CATATACACCAGAGGGATCATGG - Intronic
1141368705 16:83467670-83467692 CACAGACAGCAGAGGGCAGAAGG - Intronic
1141494137 16:84395274-84395296 CAGTGACACTGGAGGGGAGAGGG - Intronic
1142527091 17:550908-550930 CATTGGCACCAGAGCTCAGAAGG + Intronic
1144076281 17:11722434-11722456 CATTCAAACCAGAGGGAATGAGG + Intronic
1144182028 17:12761491-12761513 CATTGTAGCAAGAGGGAAGAAGG + Intronic
1144765111 17:17728341-17728363 CTTGGAGACCAGAGGGAAGACGG - Intronic
1146397482 17:32480316-32480338 CATTCTCATCACAGGGAAGAGGG - Intronic
1147895080 17:43745287-43745309 CATTGAAACCTGGGGGAACAAGG - Intergenic
1147905148 17:43817904-43817926 CATGGACTCCAGAGGAAGGAGGG - Intronic
1147948059 17:44091657-44091679 CCTCAACACCAGAGGGAAGATGG + Intronic
1148738426 17:49878208-49878230 AGTTGACAGGAGAGGGAAGAGGG + Intergenic
1150180130 17:63110607-63110629 CGTCCACACCTGAGGGAAGATGG + Intronic
1150506650 17:65705606-65705628 CAATGACACCACAAGGAAGCAGG + Intronic
1151225087 17:72641799-72641821 TATGGACTCAAGAGGGAAGAGGG - Intergenic
1151378594 17:73708977-73708999 CATTTTCTCCAGAGGGAAGTTGG - Intergenic
1151485007 17:74393553-74393575 CTTTGACAGCAGATGGATGATGG - Intergenic
1154065092 18:11100402-11100424 CATTGACACTAAAGTGATGATGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156902430 18:42316056-42316078 CACTAAAACCAGAGGGCAGAAGG - Intergenic
1157729810 18:49993764-49993786 AATTGACAGCAGGTGGAAGATGG - Intronic
1158743515 18:60169848-60169870 CATTTAAACCATAGTGAAGAGGG + Intergenic
1161064103 19:2229123-2229145 CTTTGAGACCAGAAGGAAGTTGG + Intronic
1162748032 19:12810265-12810287 CATGGCCACCAAAGGGAAGGAGG + Intronic
1163977862 19:20869484-20869506 CATTCACCCCAGTGGGAACATGG + Intergenic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165429450 19:35764185-35764207 CAGTGACTCCAGTGGGAAGTGGG + Intronic
1165687200 19:37831979-37832001 TAGTCACACCAGAGGGAACAGGG - Intergenic
1166122667 19:40694770-40694792 CATTGAGACCTGAGGGATGAGGG - Intronic
1166172804 19:41043614-41043636 TATTGACACCAGAGGGAACGAGG + Intergenic
1168020733 19:53606933-53606955 CATTGCCACCACAGGTAACACGG - Intergenic
925009540 2:471671-471693 CGCTGACACCAAAGAGAAGAGGG - Intergenic
925161053 2:1684702-1684724 CAACGACACCCGAGGAAAGATGG - Intronic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
927919530 2:26961328-26961350 CATTCAATCCAGAGGGAAAAGGG + Intergenic
928954809 2:36853624-36853646 CATTGACATCAATGAGAAGAAGG + Intronic
930000740 2:46859983-46860005 CAGTGACCCCAGAAGGAGGAAGG + Intergenic
930911845 2:56638316-56638338 CATTGAGACCAGGAGGAAGAAGG + Intergenic
931418972 2:62108281-62108303 CACTGAAACTAGAGGGCAGAGGG - Intronic
932072069 2:68630515-68630537 CATTGACACCAAATGGTAAAAGG - Intronic
932593207 2:73079509-73079531 CTTTTACCCCAGAGGCAAGACGG - Intronic
936267167 2:111019457-111019479 ATTTGACACAAAAGGGAAGAAGG + Intronic
936960566 2:118069511-118069533 CATAGACACTACATGGAAGAGGG - Intergenic
938572373 2:132572236-132572258 CAAGAACACCAGACGGAAGAAGG - Intronic
941918606 2:170828317-170828339 AGATGACAGCAGAGGGAAGAGGG - Intronic
942176086 2:173335937-173335959 CATTGAGACCTGAGGGGAGCAGG + Intergenic
942320687 2:174733063-174733085 CATGGAACCCAGAGGGAAGACGG - Intergenic
945146886 2:206747792-206747814 CACTGAAACAATAGGGAAGATGG + Intronic
946058789 2:216923691-216923713 CATTGCCAGTAGGGGGAAGAAGG - Intergenic
948277265 2:236718753-236718775 CATCCACACCACAGGTAAGATGG - Intergenic
1169358027 20:4924288-4924310 CTCTGACTCCAGAGGGAGGACGG - Intronic
1169865056 20:10191065-10191087 CATAGACACCAAAGTGAAGATGG + Intergenic
1170792179 20:19517369-19517391 CAGTGAGTCCAGAGGGGAGATGG - Intronic
1170816693 20:19720311-19720333 CAATGCCTCCAGAGGGGAGAGGG - Intronic
1171289010 20:23969493-23969515 CATTGAGGCCAGAGGGAAGATGG + Intergenic
1175621993 20:60455103-60455125 CAGTGAAACCAGAGGACAGATGG + Intergenic
1175628746 20:60513187-60513209 CATTGACTGCAAAGGGAACAGGG - Intergenic
1175628763 20:60513269-60513291 CATTGACTGGAAAGGGAAGAGGG - Intergenic
1179229543 21:39489037-39489059 CAAGAAGACCAGAGGGAAGAAGG + Intronic
1179410943 21:41162774-41162796 CTTTGGGACCAGAGGGAAGTAGG - Intergenic
1179603785 21:42499052-42499074 AATTGACACCAAAGGCAAGAAGG + Intronic
1180166083 21:46030226-46030248 CACTGTCACCTGAGGGAACATGG + Intergenic
1180853343 22:19032313-19032335 CATCGACGCCAGCGGGAAGGTGG + Intergenic
1180874835 22:19170309-19170331 CAGGGACCCCAAAGGGAAGATGG - Intergenic
1181005947 22:20013586-20013608 CATGGCCACCAGAGGGCAGCTGG - Intronic
1182939660 22:34263421-34263443 CATTCAAACCAGAGGGACAAAGG + Intergenic
950770601 3:15307816-15307838 CATTCACACCAGTGAGAAAACGG + Intronic
953259632 3:41325013-41325035 CATCTACACCAGCAGGAAGATGG + Intronic
953788525 3:45929228-45929250 CAGTGACACCAGGGGGCAGAAGG - Intronic
954692515 3:52403188-52403210 CACGGACAGCAGAGAGAAGACGG - Exonic
954792569 3:53144076-53144098 CACTGAAGCCAGAGAGAAGAGGG - Intergenic
955096117 3:55800025-55800047 TATTGAAACAAGATGGAAGATGG + Intronic
956615940 3:71172726-71172748 CAGTGAATCCAGAAGGAAGAGGG - Intronic
957136246 3:76293378-76293400 CAATGACACCAGAGGCCAAAGGG + Intronic
957477310 3:80741146-80741168 CTTTGACATCAAAAGGAAGAGGG + Intergenic
959495456 3:107045832-107045854 CATTTACACTACAGGGGAGAAGG - Intergenic
960297473 3:115961535-115961557 CATTGGCAGCACTGGGAAGAAGG - Intronic
962282339 3:134061353-134061375 CATTGGCAGAAGAGAGAAGAAGG - Intergenic
963433379 3:145237505-145237527 TATTAACACCAAAGGGAAGATGG - Intergenic
964270291 3:154948137-154948159 CATTGAAACCAGTGTGTAGAGGG + Intergenic
965657720 3:171006666-171006688 CTTTGACACCATAGGGTAGAAGG + Intronic
966217131 3:177515412-177515434 CATGGACTCCAGAGAAAAGATGG + Intergenic
966332034 3:178825335-178825357 CATTGGCCCCAGAGTAAAGAAGG + Intronic
967301275 3:188016646-188016668 CATTGACACCAAAAAGAAGGTGG + Intergenic
967745996 3:193055723-193055745 CTTTCACACCAGAGTGAGGAGGG - Intergenic
969060281 4:4428610-4428632 CTTTGAGACTAGAGGGTAGAAGG - Intronic
970041241 4:11799326-11799348 CATTGAAACAACAGGCAAGAAGG + Intergenic
970136685 4:12932870-12932892 CATTTAGCCCAGAGAGAAGAGGG - Intergenic
970454181 4:16205620-16205642 CATGCACACCACAGGGAAGGAGG + Intronic
970889869 4:21031072-21031094 CTTGGAGACCAGATGGAAGATGG - Intronic
976144891 4:82032753-82032775 TCCTGACACCAGAGGGAGGAAGG - Intronic
977087891 4:92628207-92628229 CATGGACACCAGAAGGAAACAGG - Intronic
977591044 4:98827588-98827610 CAAGGACAACAGAGGGCAGAGGG - Intergenic
978873107 4:113604639-113604661 CTTTGAAACCAAAGTGAAGAAGG - Intronic
980305922 4:131061402-131061424 CACAGACACCAGAGGCCAGAGGG + Intergenic
980623007 4:135333795-135333817 CATTGGCATCCGAGGGAAAAAGG + Intergenic
982471884 4:155802357-155802379 CATTGGCAACAGACGGAGGAAGG - Exonic
982501047 4:156155166-156155188 CAGAAACACCAGAGGGCAGAAGG + Intergenic
983473733 4:168188898-168188920 GACTGAAACCAGAGGCAAGATGG + Intergenic
983569361 4:169187961-169187983 CAGAGACATCAGAGTGAAGAAGG + Intronic
984928703 4:184827690-184827712 CACACACACCACAGGGAAGATGG - Intergenic
986402321 5:7394375-7394397 CATAGACACCAGAGGCAGGGAGG - Intergenic
986418009 5:7547609-7547631 CATTGATAACACAGGGAACAAGG - Intronic
986989516 5:13535310-13535332 CTCTGACACCACAGGGAACATGG - Intergenic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
990323313 5:54649903-54649925 CATTGATTCTAGGGGGAAGATGG + Intergenic
990663639 5:58047408-58047430 CAGTAACACCAGGGGGTAGAAGG - Intergenic
991534239 5:67648991-67649013 CAATGACAACAGAGTGAAGAGGG - Intergenic
992800653 5:80292769-80292791 CACTGACACCAGAGTGAGGCTGG - Intergenic
995165751 5:109039623-109039645 CATGGACATCTGAGGGAAGAGGG + Intronic
995243177 5:109908355-109908377 GATAGGCAGCAGAGGGAAGATGG - Intergenic
995420764 5:111964084-111964106 GATTTACCCTAGAGGGAAGAAGG - Intronic
995735075 5:115291820-115291842 CATGGACACCAAAAGGCAGAGGG - Intronic
998953895 5:147418567-147418589 CATTGAAGCCAATGGGAAGATGG - Exonic
1000257992 5:159559145-159559167 CATTGAAGCCACTGGGAAGAAGG + Intergenic
1003429399 6:6025197-6025219 CATTGAAACCTGAAGGAAAAAGG + Intergenic
1004012234 6:11701073-11701095 CCTATACACCAGTGGGAAGAAGG + Intergenic
1007723236 6:43898500-43898522 CATTCCAGCCAGAGGGAAGAGGG - Intergenic
1007936882 6:45740530-45740552 GATTGACACTCGAAGGAAGAAGG + Intergenic
1009634414 6:66246414-66246436 CATTGACACCAAAGGAAGAAAGG + Intergenic
1010523216 6:76867283-76867305 CACTGACACCAAAGTGAGGAGGG - Intergenic
1011477699 6:87764024-87764046 CATGGAAACCAGAGGGAAATGGG + Intergenic
1011492178 6:87903476-87903498 CATGGAAACCAAAGGGAAGGTGG - Intergenic
1011757098 6:90510845-90510867 CATTGCCGCCAAAGGGAAGAGGG - Intergenic
1011823217 6:91276516-91276538 CTTTGCCACTAGAGGGAAGAAGG + Intergenic
1012359678 6:98361724-98361746 CAGTGAGGTCAGAGGGAAGAAGG + Intergenic
1012553080 6:100482016-100482038 CAGGGACTCCAGAGGGAAGCGGG + Intergenic
1013046438 6:106490203-106490225 CATTCACACCAGGGTGAAGGAGG - Intergenic
1014105214 6:117553339-117553361 CATTGACACAGGAAGGAAGGAGG - Intronic
1015284679 6:131472070-131472092 CATTGATACTAGAAGTAAGATGG + Intergenic
1015811205 6:137163742-137163764 AATTGACACCAGACGTAAGTGGG + Intronic
1015831024 6:137369150-137369172 CACTCACAGCAGAGGGCAGAGGG + Intergenic
1017115039 6:150968136-150968158 CAATGACAGCAGAGGGACGGGGG - Intronic
1018394686 6:163369226-163369248 AAATGACCCCAGAGTGAAGAAGG - Intergenic
1018484844 6:164230671-164230693 TATTGACCCCAGTGGAAAGAAGG + Intergenic
1018674360 6:166206185-166206207 CAATGCCAGAAGAGGGAAGAGGG - Intergenic
1019184042 6:170210550-170210572 CATTGCCAGCAGAGGGGAGACGG + Intergenic
1020077320 7:5266867-5266889 CATTGAAACCAAAGGGAGAAGGG + Intergenic
1022674649 7:32487733-32487755 AAATCACACCAGAAGGAAGAAGG - Exonic
1024203685 7:47133175-47133197 CATTGACACCTGAGCCAAGCAGG + Intergenic
1026811588 7:73471459-73471481 CCTTGACACCATAGGGTACATGG + Intronic
1027150458 7:75730007-75730029 AACTGACACCAGAGAGAAGGTGG + Intronic
1028825305 7:95265636-95265658 CATTTACACCAGAAGGAAGCTGG - Intronic
1029058066 7:97767461-97767483 CAATAACAGCAGAAGGAAGATGG - Intergenic
1029887577 7:103889345-103889367 CACTGACAACAGAGGACAGAAGG + Intronic
1030625639 7:111842830-111842852 CTTTGACAGCTGAGGCAAGAGGG - Intronic
1032450741 7:132028812-132028834 CACTGACCCCTGAGGGATGAGGG + Intergenic
1032638901 7:133742919-133742941 CTTTGCCACCAGAGGGCAGTTGG - Intronic
1033643829 7:143286299-143286321 CATTGGCATCAGCGGGAGGAGGG + Intronic
1033950535 7:146779758-146779780 CTATCACACCAGAGGGCAGAAGG + Intronic
1034211145 7:149364404-149364426 AATTGATACCAGAGGCAAGGTGG - Intergenic
1036617235 8:10397927-10397949 CATTAACAAGAGAGGGAAGAGGG - Intronic
1037454627 8:19051189-19051211 GATTGGGACCAGAGGGAGGAGGG - Intronic
1038061378 8:23917598-23917620 CAGTGACAACAGAGGAAACAAGG - Intergenic
1038328575 8:26590456-26590478 CAGTGACACCTGAGGGTGGATGG - Intronic
1038328585 8:26590516-26590538 CAGTGACACCTGAGGGTGGATGG - Intronic
1038328595 8:26590576-26590598 CAGTGACACCTGAGGGTGGATGG - Intronic
1038328605 8:26590636-26590658 CAGTGACACCTGAGGGTGGATGG - Intronic
1041469546 8:58193403-58193425 CTTTGACACCAGTGGGCCGAGGG - Intronic
1042051614 8:64715646-64715668 CACTGGCAACAGAGGGAAAATGG + Intronic
1045860575 8:106811446-106811468 CATGGTTACCAAAGGGAAGAAGG + Intergenic
1046748273 8:117899120-117899142 CATTTACGCTAGAGAGAAGATGG + Intronic
1047004775 8:120609286-120609308 CATTAACACAGGAGGGAAGGGGG - Intronic
1048451913 8:134540978-134541000 CACTGGCACCAGAGGGGAGAGGG + Intronic
1049205689 8:141362468-141362490 CATTCAGACAAGGGGGAAGACGG - Intronic
1049398732 8:142415326-142415348 CATACACACTAGGGGGAAGAAGG - Intergenic
1052199313 9:25758230-25758252 TGTTGACACCAGAGGAAGGAAGG - Intergenic
1052635189 9:31093932-31093954 CTTTGATACCAGAGGGAGAAAGG - Intergenic
1053249025 9:36559085-36559107 CATGGAGCCCAGAGGGAAAAAGG - Intergenic
1056729738 9:89155357-89155379 CATTCACACCAGACTGGAGATGG - Intronic
1061240086 9:129365013-129365035 TTTTCACAGCAGAGGGAAGAAGG + Intergenic
1061616879 9:131786174-131786196 AATTGACACCAGTGTGAGGAAGG + Intergenic
1187052719 X:15710387-15710409 CATTAATAAGAGAGGGAAGAAGG + Intronic
1188392679 X:29640564-29640586 CATTTACTCCTGTGGGAAGATGG - Intronic
1188825105 X:34821914-34821936 CATTGACAGCAGAAGTTAGAAGG + Intergenic
1193543460 X:82799049-82799071 CATTGGCAGCTGAGGGCAGATGG - Intergenic
1195284849 X:103374705-103374727 CATTCGCACCAAAGGGTAGATGG + Intergenic
1196998011 X:121405538-121405560 CATTCAAACAAGAGGAAAGATGG + Intergenic
1197203944 X:123773709-123773731 CATAGATCCCAGAGAGAAGAAGG + Intergenic
1198223383 X:134623310-134623332 CTTGGACACAAGAGGGAGGATGG + Intronic
1201622378 Y:15974253-15974275 CATTTAAATCAGAGGAAAGAGGG - Intergenic
1201772790 Y:17632925-17632947 CAATGACACCTGAGGGCAGGTGG - Intergenic
1201828765 Y:18273062-18273084 CAATGACACCTGAGGGCAGGTGG + Intergenic