ID: 1115860304

View in Genome Browser
Species Human (GRCh38)
Location 14:37678625-37678647
Sequence CATGTTCTGGAAATTGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115860304 Original CRISPR CATGTTCTGGAAATTGTGTC AGG Intronic
900010326 1:101354-101376 CATATTCTGGAAATTTTATTTGG - Intergenic
900026432 1:277920-277942 CATATTCTGGAAATTTTATTTGG - Intergenic
900036219 1:411760-411782 CATATTCTGGAAATTTTATTTGG - Intergenic
900057845 1:647514-647536 CATATTCTGGAAATTTTATTTGG - Intergenic
902070364 1:13729677-13729699 TATGTTTTGGAAAATGTTTCAGG + Intronic
903759469 1:25687638-25687660 CATGTTATGGAAAGAGTGACAGG + Intronic
903788923 1:25879518-25879540 CAGGTTCTGGAAAGTGGATCTGG + Intergenic
903798558 1:25949053-25949075 CATGTTCAGGACATTGTACCTGG - Intergenic
908183233 1:61626747-61626769 CAGTTTCTGGAAATTGGGTAAGG - Intergenic
908344320 1:63216223-63216245 AATGTTCTGGAATTTGGGCCAGG + Intergenic
909347446 1:74608279-74608301 CATGATCTGAAAAATGTTTCTGG + Intronic
910732478 1:90413010-90413032 CATGTTCTTAAAATTCTGTGGGG - Intergenic
912118131 1:106432977-106432999 GATGTACTGGAAACAGTGTCAGG + Intergenic
912539521 1:110403151-110403173 TATGTTCTGAGAAATGTGTCAGG - Intronic
916601380 1:166296953-166296975 CCCGTCCTGGAAATTGTCTCAGG + Intergenic
917290471 1:173467395-173467417 CTTTTTCTGGAAATCATGTCTGG - Intergenic
917728477 1:177850317-177850339 CATGTTCTTGAAAATGTCTCAGG - Intergenic
918079761 1:181196892-181196914 CCTGTTTTGGGAAGTGTGTCAGG + Intergenic
918239456 1:182609219-182609241 CATGGGCTGGAAAGTGTGGCAGG - Intergenic
920524175 1:206654293-206654315 CATGTTCTGGCAATTCTACCTGG - Intronic
922258764 1:223917351-223917373 CATATTCTGGAAATTTTATTTGG - Intergenic
924339953 1:243020107-243020129 CATATTCTGGAAATTTTATTTGG - Intergenic
924663306 1:246042993-246043015 TGTGTTCTGGAAATTGTGTTAGG - Intronic
1066246916 10:33592616-33592638 CATTTGCTGGAAATTGACTCTGG + Intergenic
1067540821 10:47151085-47151107 CATGCTCTAGCAATTGTGTGAGG - Intergenic
1070441328 10:76446995-76447017 TAAATTCTGGAAATTGTGTTCGG + Intronic
1074217910 10:111405777-111405799 CTTGTTCTGGAAATTCTGTGAGG + Intergenic
1074228683 10:111512637-111512659 CATGTTCTGGAAAAGGGTTCTGG + Intergenic
1079102622 11:17551356-17551378 CATGCTCTGGGAGTTCTGTCTGG + Intronic
1079416526 11:20242941-20242963 CATATTCTTGATATTCTGTCAGG + Intergenic
1079946815 11:26753634-26753656 CATGTGCAAAAAATTGTGTCTGG - Intergenic
1080332097 11:31150899-31150921 AATGTAGTGTAAATTGTGTCAGG + Intronic
1082173131 11:49030369-49030391 TATGTTCTGAGAAATGTGTCAGG - Intronic
1083088183 11:60171855-60171877 CATTTTCTGGGAAATGTTTCTGG + Intergenic
1084083546 11:66844173-66844195 CATGGTCTGGAAATCGTGGCTGG + Intronic
1084452689 11:69249476-69249498 CATGGGGTGGAAAGTGTGTCTGG - Intergenic
1084571848 11:69964655-69964677 CGGGTTCTGGAAAGGGTGTCCGG - Intergenic
1084692005 11:70732910-70732932 CCAGCTCTGGAAATGGTGTCTGG + Intronic
1086692637 11:89805682-89805704 TATGTTCTGAGAAATGTGTCAGG + Intronic
1086950569 11:92886450-92886472 CATGTTCTGCACCCTGTGTCAGG - Intronic
1087227370 11:95616336-95616358 CATGTGCTGGAAAGTTTGTGAGG - Intergenic
1087424342 11:97969339-97969361 CAGATTCTGGAAATTGAATCAGG - Intergenic
1088440495 11:109865669-109865691 CATCTGCTGGAAAATGTGTCTGG + Intergenic
1090349029 11:126095315-126095337 CATATGCTGAAAATAGTGTCTGG - Intergenic
1090629045 11:128630193-128630215 CAGGTTCTGAAAATTATCTCCGG + Intergenic
1095454932 12:42373198-42373220 CAGGTTTTAGAAATTGTGTGAGG - Intronic
1095633566 12:44405409-44405431 CCTGTCATGGAAATTGTGTGGGG - Intergenic
1095917085 12:47490655-47490677 CAAGTTTTGGAAATCATGTCAGG + Intergenic
1097790040 12:63805800-63805822 CATGTCCTGAAGATGGTGTCAGG - Intronic
1100186851 12:92148112-92148134 CATTTTCTGGAAGTTTAGTCAGG + Intergenic
1101236924 12:102799251-102799273 CAACTTCTGGAAAATGTCTCTGG + Intergenic
1104807383 12:131598390-131598412 CAGGTGCTGGAAATGGAGTCTGG + Intergenic
1109817848 13:67610339-67610361 CATGTTCTGAAAATTTTTTAGGG + Intergenic
1109976736 13:69845611-69845633 AATGTACTTGAAATTTTGTCAGG - Intronic
1110522170 13:76492497-76492519 GACGTTCTGAAAATTGTGTTAGG - Intergenic
1111110914 13:83708138-83708160 CTTTTTCTGGATATTCTGTCTGG + Intergenic
1111510056 13:89249519-89249541 CATGATCTGAGAATTGTGTAAGG + Intergenic
1112920868 13:104611252-104611274 CATGTTTTGGATATTGTTCCTGG - Intergenic
1114904981 14:27116009-27116031 AAAGTTATGGAAATTGTATCTGG + Intergenic
1115860304 14:37678625-37678647 CATGTTCTGGAAATTGTGTCAGG + Intronic
1117514656 14:56488850-56488872 GATGTTCTTCATATTGTGTCTGG + Intronic
1121604901 14:95233509-95233531 CATATTCTGGAAATTATGATAGG + Intronic
1122299151 14:100722284-100722306 CATGTTCTGGAAAATGTATCAGG + Intergenic
1123141910 14:106088184-106088206 CGTGTTCTTGGAATTGTCTCTGG + Intergenic
1123159958 14:106268668-106268690 CGTGTTCTTGGAATTGTCTCTGG + Intergenic
1123167000 14:106335142-106335164 CGTGTTCTTGGAATTGTCTCTGG + Intergenic
1123169617 14:106359853-106359875 CGTGTTCTTGGAATTGTCTCTGG + Intergenic
1123175241 14:106410556-106410578 CGTGTTCTTGGAATTGTCTCTGG + Intergenic
1123193386 14:106592738-106592760 CGTGTTCTTGGAATTGTCTCTGG + Intergenic
1123200378 14:106657785-106657807 CGTGTTCTTGGAATTGTCTCTGG + Intergenic
1123202019 14:106675077-106675099 CGTGTTCTTGGAATTGTCTCTGG + Intergenic
1123203237 14:106687166-106687188 CATATTCTTGACATTGTCTCTGG + Intergenic
1202943447 14_KI270726v1_random:5223-5245 CGTGTTCTTGGAATTGTCTCTGG - Intergenic
1127253116 15:57263368-57263390 TATGTTCTAGATATTGTGTTAGG + Intronic
1129133970 15:73529554-73529576 CATGTTATGAAAATTGTGACTGG + Intronic
1131079211 15:89520602-89520624 TATATTATGGAAATAGTGTCTGG - Intergenic
1131588883 15:93726893-93726915 CATATTATTGCAATTGTGTCTGG + Intergenic
1132627949 16:901207-901229 TATGTTCTGGGAATTGAGCCAGG - Intronic
1133576184 16:7092971-7092993 CTTGTGCTGGAAATTGCCTCTGG + Intronic
1134284890 16:12852303-12852325 CATGTTCTGGGGATTGTGACAGG + Intergenic
1137295827 16:47092371-47092393 AATGTTTTGGAAATTGTTTCGGG - Intronic
1138619686 16:58201110-58201132 CAAATTCTGCATATTGTGTCAGG - Intergenic
1139032209 16:62898631-62898653 CATGTTCTGGTAATTGTATGTGG - Intergenic
1140630457 16:76846612-76846634 CATTTTCTGGACATTGTCTTGGG + Intergenic
1141074686 16:80993308-80993330 CATGGTTTGGAAATTGTCTGTGG - Intronic
1142454015 16:90205560-90205582 CATATTCTGGAAATTTTATTTGG + Intergenic
1146228456 17:31088193-31088215 TAGGTTCTGGAAATTGGCTCAGG + Intergenic
1151571944 17:74930870-74930892 CATGTTCTGGAAGGTGTGCTGGG - Exonic
1153759483 18:8316920-8316942 CTTGTTGTGGAATTTGTGCCTGG + Intronic
1153770379 18:8410534-8410556 CATGTTCTAGAAGTTCTCTCAGG - Intergenic
1156264410 18:35473382-35473404 CATGGTCAGGAAATTGTCACAGG - Intronic
1156280857 18:35636652-35636674 GATGTTCTTGATACTGTGTCAGG - Intronic
1156676557 18:39533463-39533485 CCTGCTTTGGAAATTATGTCTGG - Intergenic
1158415248 18:57244597-57244619 CATGTTCTGGTGATTCAGTCTGG - Intergenic
1159203667 18:65222530-65222552 CAGGTTCTGGGAAATATGTCTGG - Intergenic
926418551 2:12674947-12674969 CAAGTTCTTTAAATAGTGTCTGG + Intergenic
927017637 2:18981948-18981970 CACTTTTTGGAAATTGTCTCAGG - Intergenic
927032050 2:19131123-19131145 CATGTTGTGTAAAATGTGGCAGG + Intergenic
929803621 2:45125475-45125497 CAGGTTCTGGAAAGTGGGCCCGG - Intergenic
930168097 2:48223056-48223078 CCTATTCTCCAAATTGTGTCAGG + Intergenic
930603609 2:53469794-53469816 AATGTTCTGGAAATAGACTCAGG + Intergenic
931928782 2:67105586-67105608 CATGTTCTGGACTATGTGTTTGG - Intergenic
933581486 2:84131643-84131665 CACTTTCTGGAGATTGTGTGTGG - Intergenic
935197544 2:100827118-100827140 GATTTTCTGGAAATGGTGTTGGG + Intronic
938898443 2:135776486-135776508 GATATTGTGGAAATTCTGTCGGG + Intronic
940084840 2:149847581-149847603 AATGTTCTTTAAATTGTCTCAGG - Intergenic
942418174 2:175780594-175780616 GATGCTGTGGAAATTGTGACAGG - Intergenic
946801114 2:223417019-223417041 CATGTTTTGAAAATTGTGTTGGG - Intergenic
949085468 2:242150224-242150246 CATATTCTGGAAATTTTATTTGG + Intergenic
1169490387 20:6066463-6066485 CATGTTCTGGAATTGCTTTCAGG + Intergenic
1169530482 20:6480148-6480170 CATGTACTGGAAATTCAGTATGG + Intergenic
1171126348 20:22605318-22605340 CATGTTCTGGAAATAGTGACTGG + Intergenic
1174024025 20:47557322-47557344 CATGTGTTAGGAATTGTGTCAGG + Intronic
1174602995 20:51739730-51739752 GATGTTCTGGACATGGTGACAGG + Intronic
1178462728 21:32817770-32817792 GATCTTCTGGAAATAATGTCTGG + Intergenic
1180063336 21:45398810-45398832 TGTCTTCTGGAAATTCTGTCTGG - Intergenic
1182026963 22:27127691-27127713 TATGTGCTGGAAATTGTGGTAGG + Intergenic
949780769 3:7685252-7685274 GATGTTCTGTAAATTGTCTTTGG + Intronic
954884414 3:53859287-53859309 CATGTTCTGGAAAATGTCTCTGG + Intronic
955452394 3:59083532-59083554 CAAGTTCTGGAAACTGTGATTGG - Intergenic
955474726 3:59324860-59324882 CATGTTCTGTATCTTGTTTCGGG + Intergenic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
955914157 3:63889774-63889796 CATGTTCCTGAGGTTGTGTCAGG + Intronic
956366780 3:68512556-68512578 CATGCTCTTTATATTGTGTCAGG - Intronic
956646659 3:71463762-71463784 CATGTCCTGGAGGTTTTGTCTGG + Intronic
958962649 3:100524655-100524677 CATGCCCTGGAAATGGTGTGGGG - Intronic
963372974 3:144425373-144425395 CATTTTCAGAAAATTTTGTCTGG + Intergenic
963992592 3:151670448-151670470 CATGGTCTTCAAAATGTGTCCGG + Intergenic
964077473 3:152708896-152708918 CATTATTTGGAAATTGTTTCTGG + Intergenic
964202147 3:154129761-154129783 CAAGTTTTGGAAATTATGTGTGG + Intronic
965171927 3:165276690-165276712 CTTTTTCTGGAAATTGTGAATGG + Intergenic
966233349 3:177673113-177673135 CATCCTCTAGAAATTGTCTCTGG + Intergenic
967580182 3:191143861-191143883 CATGATCTGTAACCTGTGTCTGG - Intergenic
970076555 4:12228421-12228443 CATTTCTTGGCAATTGTGTCAGG + Intergenic
970305701 4:14729765-14729787 CATGTTCTAGAAAATGTGGATGG - Intergenic
970760042 4:19474061-19474083 TATGTTCCAGAAATTGTGTTTGG - Intergenic
971573974 4:28250864-28250886 CCAGCTCTGGAAATTGAGTCAGG + Intergenic
973122050 4:46533435-46533457 CAGGTTCTGGAAAGTGTCCCAGG - Intergenic
973122626 4:46541614-46541636 CATGTTCTGGAAAGCGTCCCAGG + Intergenic
973980008 4:56300204-56300226 TATTTTGTGGAAATTGTGTCTGG + Intronic
974355184 4:60803678-60803700 CATTTTCTTGAAGTGGTGTCTGG + Intergenic
976154426 4:82127147-82127169 TATGTACTGGAAGTTGTGTGTGG + Intergenic
978688025 4:111471783-111471805 TAAGTTCTAGAAATTGTGTTAGG + Intergenic
979262899 4:118668473-118668495 CATATTCTGGAAATTTTATTTGG + Intergenic
981626538 4:146762788-146762810 CATGTTCTGGAAAATATACCAGG - Intronic
984277364 4:177626836-177626858 CATGTACTGCAATTTGTCTCAGG + Intergenic
984651292 4:182273352-182273374 TATCTTCTGGAAATTATCTCAGG - Intronic
986492095 5:8303651-8303673 CATGCTCTGAAAATTCTCTCAGG + Intergenic
987464713 5:18258270-18258292 AATGTGCTGGCAATTGTGTGTGG - Intergenic
988280861 5:29145469-29145491 TATATTCTGGTAAATGTGTCAGG - Intergenic
990792002 5:59492389-59492411 AATGTTGTAGAAATTGGGTCAGG - Intronic
991257990 5:64636550-64636572 GATGTCCAGGGAATTGTGTCTGG - Intergenic
993828138 5:92719375-92719397 CATGTTCTGGTAAATGTGAAGGG - Intergenic
994680443 5:102879950-102879972 TATGTTCTGAGAAATGTGTCAGG - Intronic
997134025 5:131306060-131306082 CATGATCTGAAAATAGTGTATGG + Intronic
997154708 5:131541831-131541853 CATGTCCTGGAGATTGTTTTGGG + Intronic
998057754 5:139093491-139093513 CAGGGTATGGAGATTGTGTCAGG - Intronic
1002737602 5:181407104-181407126 CATATTCTGGAAATTTTATTTGG + Intergenic
1004696259 6:18035986-18036008 CATGTTTTGGAAATAGTGACAGG + Intergenic
1005036224 6:21557394-21557416 CATGTCCTTGAAATTTTGTTAGG + Intergenic
1005582820 6:27250504-27250526 CATGTTCTGGGAAGTGTATGTGG + Intronic
1006068188 6:31477648-31477670 CATGTGCTGGGATTTGTGCCTGG - Intergenic
1006415214 6:33899689-33899711 CATGTCCGGGAATGTGTGTCAGG - Intergenic
1008842113 6:55915401-55915423 CATGCTCTGGAAATTTTCCCTGG + Intergenic
1008930064 6:56930090-56930112 CAGGATCTGGTAATTGTGTATGG + Intronic
1013249805 6:108322783-108322805 CTTGTTCTGAAAAATGTGCCAGG + Intronic
1013772017 6:113638376-113638398 TATGTTCTGGAAATTAGGACTGG - Intergenic
1015071058 6:129093328-129093350 CATGTTCTAGAAACTGATTCTGG + Intronic
1015265285 6:131285726-131285748 CATGTTCTGGACATTATTTCAGG + Intergenic
1015299419 6:131635529-131635551 CTTGTTCTGGACTTTGTGTAAGG - Intronic
1016549713 6:145265405-145265427 CATATTCTGGAAAATGTAACTGG + Intergenic
1018045256 6:159960200-159960222 CAGATTCTGGGAAATGTGTCTGG - Intergenic
1019088710 6:169505598-169505620 CATGTGATGGCAATTGTTTCTGG - Intronic
1019242700 6:170682660-170682682 CATATTCTGGAAATTTTATTTGG + Intergenic
1019507978 7:1402829-1402851 TGTGTGCTGGAAATTGTGTGAGG + Intergenic
1019778086 7:2924237-2924259 CATGTTCAGGAAGTTCTCTCTGG - Exonic
1023170847 7:37388986-37389008 CATGTTCAGGGAATTGTCTGAGG - Intronic
1023656822 7:42431592-42431614 TATGTGCTGGATATTGTGCCAGG - Intergenic
1030622207 7:111802228-111802250 GATGTCCTGGAAATTGAGTGGGG + Intronic
1031224123 7:119012508-119012530 GCTGTTTTAGAAATTGTGTCTGG - Intergenic
1035505421 8:125494-125516 CATATTCTGGAAATTTTATTTGG - Intergenic
1038531802 8:28324282-28324304 CATGTTCAGGAAATGTTGGCTGG - Intronic
1039213687 8:35243733-35243755 CATGGTGTGGAGGTTGTGTCAGG + Intronic
1039503763 8:38036623-38036645 CATGTTCTGGAAGATGAGTTAGG + Intronic
1040723014 8:50349240-50349262 CATGTTTTGGGAATTGTGCTAGG + Intronic
1042013516 8:64279393-64279415 CATCTTCTGAAACTTGTGACTGG - Intergenic
1042294514 8:67204805-67204827 TTTGTTCTGGAAATTCTGTGAGG + Exonic
1043869049 8:85410072-85410094 CATGTTCTGAAATTAGAGTCTGG + Intronic
1045350409 8:101333095-101333117 CAGGTGCCGGAAGTTGTGTCTGG + Intergenic
1050311779 9:4360710-4360732 TATGTTCTTAAAATTGTGTTAGG + Intergenic
1053444924 9:38145650-38145672 AATGTTCAGGAATTTGTGTTGGG - Intergenic
1056517574 9:87369997-87370019 CTTGTTCTTGAAAGTGTGTAGGG - Intergenic
1056779111 9:89536037-89536059 AATGTCCTGGAAATTGTATATGG - Intergenic
1057496754 9:95567348-95567370 CATATTCTGGAAAGTGTGATTGG - Intergenic
1059458429 9:114414330-114414352 CATATTCTGAAAATTATATCAGG + Intronic
1060217224 9:121745673-121745695 CATCTTCAGCAAATTGTGCCAGG + Intronic
1060579272 9:124729647-124729669 CATATTCTGGGAATTCTGACTGG - Intronic
1061771531 9:132927374-132927396 CATTTTCTGGATTTTGTGACAGG - Intronic
1203602891 Un_KI270748v1:31884-31906 CATATTCTGGAAATTTTATTTGG + Intergenic
1186373800 X:8975812-8975834 TATGTTCTGAGAAATGTGTCAGG - Intergenic
1186849273 X:13564450-13564472 CATGTGCTGGACACTGTGTTTGG - Intergenic
1187480709 X:19652538-19652560 AGTGTTTTGGAGATTGTGTCAGG - Intronic
1188305010 X:28550945-28550967 CATGTGCTGGATATAGTGTTAGG - Intergenic
1188407072 X:29824882-29824904 CATGTTCTGGTGATTGTGTTTGG - Intronic
1188460054 X:30415071-30415093 CTTGTTCTGCAATTTGTTTCAGG - Intergenic
1189387381 X:40548531-40548553 CCTGCTCTGGACATTGTCTCAGG - Intergenic
1189713357 X:43838795-43838817 AATGATCTGGAATTTGTGTAAGG + Intronic
1190575838 X:51837063-51837085 CATGATCTGAAAATTCTCTCAGG + Intronic
1192206413 X:69099668-69099690 TGTGTTCTGGAAATAGTGCCGGG + Intergenic
1192209247 X:69117158-69117180 CATGTGCTGGGAATTGTGACAGG - Intergenic
1192321293 X:70092612-70092634 TACATTCTGGAAATTGAGTCAGG - Intergenic
1193672678 X:84408813-84408835 CATTTTCTGGATATTGTGAATGG + Intronic
1193799329 X:85915688-85915710 CATTTTGTGGCAATTGTGTATGG - Intronic
1193823961 X:86199652-86199674 CATTTTCTGGCAATTGTGAAGGG - Intronic
1196523403 X:116701387-116701409 CATGTTCTGAGATTTTTGTCGGG + Intergenic
1198879940 X:141269497-141269519 TATGTTCTTGAAATAGTGCCTGG - Intergenic
1199165172 X:144664106-144664128 CTTGTTGTGGCAATTGTGACTGG + Intergenic
1199839778 X:151633051-151633073 CATGATCTGAAGTTTGTGTCTGG + Intronic