ID: 1115862216

View in Genome Browser
Species Human (GRCh38)
Location 14:37700151-37700173
Sequence TTGTATAAGCTTTAGTAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115862216 Original CRISPR TTGTATAAGCTTTAGTAGGA AGG Intronic
904242873 1:29161220-29161242 TTTAATAGGCATTAGTAGGATGG - Intronic
905100392 1:35516139-35516161 TTGGAATAGTTTTAGTAGGAAGG - Intronic
907074229 1:51564290-51564312 TTCTTTAAGCTTAAGTAAGATGG + Intergenic
907847941 1:58226705-58226727 TTGTATAATCCTTAGGAGGTAGG + Intronic
907923539 1:58934896-58934918 TTGAATAGGCTTTTGTTGGAAGG + Intergenic
908825081 1:68125355-68125377 GTGTATGAGTTTTAGCAGGAGGG + Intronic
909227231 1:73041472-73041494 TTGGAAAAGCCTCAGTAGGAAGG + Intergenic
909743930 1:79068594-79068616 GTCTATAAGGTATAGTAGGAAGG + Intergenic
910556030 1:88533979-88534001 TTGTATAAGAATTAGCAGGAAGG - Intergenic
911799810 1:102121618-102121640 TTGAATTTGCTTTTGTAGGAGGG - Intergenic
917693439 1:177492485-177492507 TTGTATAAGGTATAAAAGGAAGG + Intergenic
918688806 1:187454041-187454063 TTCTCTAAGCTCTAGTAGGATGG + Intergenic
918902819 1:190446403-190446425 TTGAAGAAGCTATAGTAAGAAGG - Intronic
924077862 1:240359866-240359888 TAGTATAAGCTTCATTAAGAAGG + Intronic
1064246944 10:13675957-13675979 ATGTATAACTTTTATTAGGAGGG - Intronic
1064743672 10:18458400-18458422 TTGTATAAACTGTATGAGGATGG + Intronic
1067961425 10:50855985-50856007 TTGTATAATCCAGAGTAGGAAGG + Intronic
1069971610 10:72175509-72175531 CTGTATAAGCTTTAGAAAAAAGG + Intronic
1073840567 10:107494621-107494643 ATGTATAAGCTTTAGAATGCAGG - Intergenic
1076658984 10:132042803-132042825 TTGTATCAGCTTTACTTGGCTGG + Intergenic
1078157334 11:8810353-8810375 TTCTATTAGCTTAAGGAGGAGGG - Intronic
1080290013 11:30660329-30660351 TTGTATCCACTTTAGAAGGAAGG - Intergenic
1081063860 11:38514648-38514670 TTGAAAAAGCTTTAGTAAAATGG - Intergenic
1087165029 11:94994598-94994620 TTGTAGGAGTTTTAGGAGGAAGG + Intronic
1090983389 11:131744420-131744442 TTTTATTAACTTGAGTAGGAAGG - Intronic
1093361036 12:18228014-18228036 TTGGATAATTTTTATTAGGATGG + Intronic
1096447923 12:51711218-51711240 TTCTATAGGCTTTAGTACAAAGG + Intronic
1098215880 12:68218033-68218055 TTGTTTAAGCTTTGTTAGGCAGG - Intronic
1099242838 12:80158583-80158605 ATGTATAAGCTTTTGTAAAATGG + Intergenic
1099311571 12:81032634-81032656 TTGTATAAATTTTAATAGCAGGG - Intronic
1106528358 13:30563879-30563901 TTGTTTAAGCTTTATTAGCTGGG + Intronic
1106801109 13:33256691-33256713 TCGTTTAAGCTTGACTAGGAAGG - Intronic
1108063950 13:46558350-46558372 TTGGATCAGGTTTTGTAGGATGG + Intronic
1109467409 13:62754931-62754953 TTGAATAAGCTTTACTATGAAGG - Intergenic
1110252851 13:73400205-73400227 TTGTGCAATCTGTAGTAGGAAGG + Intergenic
1112823907 13:103369593-103369615 ATGTATAAGTGTTATTAGGAGGG + Intergenic
1115179661 14:30608758-30608780 TAGAATATGCTTAAGTAGGAGGG - Intronic
1115862216 14:37700151-37700173 TTGTATAAGCTTTAGTAGGAAGG + Intronic
1118962140 14:70543658-70543680 TTGAAAAAGGTTTAGTAGGCAGG - Intergenic
1120085074 14:80262968-80262990 TTATATAAGCTGTAAGAGGAAGG - Intronic
1121959844 14:98249131-98249153 TTGGGGAAGCTTTATTAGGAAGG + Intergenic
1125210331 15:37207359-37207381 TTGTATAAGGTTTAGCAGAAAGG - Intergenic
1125427168 15:39560763-39560785 TTGTATAAGCTCTGGTGGAATGG - Intergenic
1126811123 15:52405257-52405279 CAGAATAAGCTTTAGTGGGATGG - Intronic
1129613087 15:77075789-77075811 CTGTGGAAGGTTTAGTAGGAGGG - Intronic
1132041622 15:98529413-98529435 TTGTCTAACCTTTACCAGGAAGG + Intergenic
1132292096 15:100710952-100710974 CTCTTTAAGCTCTAGTAGGAAGG + Intergenic
1138565991 16:57833275-57833297 TTGTATAAGATGTAGTTGCAGGG + Intronic
1139935598 16:70568610-70568632 TAGAGTTAGCTTTAGTAGGATGG - Intronic
1150016799 17:61565284-61565306 TTGAATTAGCATTAGTAGTAGGG + Intergenic
1150200579 17:63352879-63352901 AAATATAAGCTTTAGGAGGATGG - Intronic
1155900158 18:31379455-31379477 TTGTATAAATTTTATAAGGAAGG + Intronic
1156972339 18:43171232-43171254 TTGTAAGAGCTGTATTAGGAGGG + Intergenic
1160315881 18:77846741-77846763 TTGGAAAAGCTTGAGAAGGATGG + Intergenic
1166566474 19:43768641-43768663 TTGTATGAGCTGTAGTTGGAAGG + Intronic
925310439 2:2877902-2877924 TTGTAAAATGTTAAGTAGGAAGG - Intergenic
926237943 2:11062510-11062532 TTGTATAAGGTATATAAGGAAGG - Intergenic
930272057 2:49268827-49268849 TGGTAAAACATTTAGTAGGAAGG - Intergenic
933606156 2:84386227-84386249 ATGGATAAGCTGTAGAAGGAAGG + Intergenic
935509611 2:103955413-103955435 TTGAAAAATCTTTAATAGGATGG + Intergenic
936750149 2:115632503-115632525 TTGTAAGAGCTATTGTAGGAAGG - Intronic
939905813 2:147912960-147912982 TTGAATAAATTATAGTAGGAGGG + Intronic
940732914 2:157415108-157415130 AAGTATAAGATTTAATAGGAGGG - Exonic
942007461 2:171719347-171719369 GTGTATAAGTTTTAGAAAGAAGG + Intronic
943226527 2:185185523-185185545 TTTTATGAGCTTTAGAAGGGAGG - Intergenic
943279555 2:185914687-185914709 TTTTATAAGCTTTAGAAAGCAGG - Intergenic
944097046 2:195980041-195980063 TTGTATTAGTTTGAGTAGGAAGG - Intronic
946272249 2:218604049-218604071 TTTTTTAATTTTTAGTAGGATGG + Intergenic
946687642 2:222287238-222287260 TTCAATAACCTTTATTAGGAAGG + Intronic
1169367828 20:5005367-5005389 TTGTATGAGCTGTAATAGAAAGG - Intronic
1169705824 20:8503556-8503578 CTGTATAGGGTTTAATAGGAAGG - Intronic
1170347833 20:15406648-15406670 TTATATAAACTTTACTAGGCTGG + Intronic
1170663676 20:18366419-18366441 TTGTATTAGATTTAGTGGGTGGG - Intergenic
1178080982 21:29064723-29064745 ATGTATAAGCTCTACTAGAAGGG + Intronic
1181168745 22:20996712-20996734 TTGTAGAAGCCGTAGTAGTAGGG - Exonic
949991638 3:9584067-9584089 TTTTATAAGGTTTATAAGGATGG + Intergenic
955256081 3:57332938-57332960 TTGTTTAAGATTTGTTAGGATGG - Intronic
955531525 3:59877934-59877956 TGTTAAAAGATTTAGTAGGATGG + Intronic
956530817 3:70216664-70216686 TTCAATAAGCTTTAGGATGAAGG - Intergenic
957275869 3:78090876-78090898 TTGTATCAGAATTACTAGGAGGG - Intergenic
958049195 3:88322632-88322654 ATGTATAATATTTAGGAGGAAGG - Intergenic
958598141 3:96256934-96256956 ATTTATAAGCTTTATTATGATGG + Intergenic
970504482 4:16713591-16713613 TTTTAAAAGCTTTATTAGGTTGG + Intronic
972043501 4:34635156-34635178 TTTTATAAGCTTTAGTAAAGAGG - Intergenic
974966290 4:68764522-68764544 TTGAAATAGCTTCAGTAGGATGG - Intergenic
974984699 4:69008057-69008079 TTGTATAATATTTTGTAGTATGG - Intronic
975420599 4:74159301-74159323 TTGTGTAAGCTGTAGTAGGTTGG + Intronic
978346428 4:107774961-107774983 ATGTCTAAGCATTAGTAGAATGG - Intergenic
978636711 4:110817796-110817818 GTTTATAAGCTTAAGTTGGATGG + Intergenic
978879822 4:113688301-113688323 TCTTAGAAGCTTTAGTGGGAGGG + Intronic
979216592 4:118171703-118171725 TTGTATGACCTTCAGAAGGACGG - Intronic
979590084 4:122468611-122468633 TTGTAAAAGTTTTATTAGGTTGG - Intergenic
982364730 4:154564575-154564597 TTATTTAACATTTAGTAGGATGG - Intronic
983990923 4:174118660-174118682 TTGTATAAGCTATGTCAGGATGG + Intergenic
984760506 4:183358964-183358986 TTGTACAAGCTTTAGAGGTATGG - Intergenic
986827515 5:11537745-11537767 TAGTACCAGCTTTAGTAGAAAGG + Intronic
987522613 5:19006128-19006150 TTAAATAAGCTTAACTAGGAAGG - Intergenic
991541780 5:67738074-67738096 TTGTATAAGGTGTAAAAGGAAGG + Intergenic
991974173 5:72170151-72170173 TCATGTAAGCTTTAGTAGTATGG + Intronic
993243407 5:85420387-85420409 TTGAAGAAGCTTAATTAGGATGG - Intergenic
993376882 5:87158878-87158900 CTGAATAAACTTTAGTAGGTAGG - Intergenic
994451093 5:99945243-99945265 TTCTTTCATCTTTAGTAGGAAGG + Intergenic
994957141 5:106546365-106546387 TTGTAGAAGCTTTAGTATTTAGG - Intergenic
995028315 5:107449760-107449782 TTCTATCATTTTTAGTAGGAAGG - Intronic
1005258645 6:24032707-24032729 TTTAAAAAGCTTTATTAGGATGG - Intergenic
1006240012 6:32669446-32669468 TGGGAAAAGCTTTAGCAGGAAGG + Intergenic
1007497883 6:42273787-42273809 TTGTATAAGCCTTTTAAGGAAGG - Intronic
1010377689 6:75191571-75191593 TTATATAAGCTTTATCTGGAAGG - Intronic
1010557270 6:77298849-77298871 TTGTATAAGATTTGCTAGGTGGG + Intergenic
1010950257 6:82028274-82028296 TTTTAGAAGGTTGAGTAGGATGG - Intergenic
1012642780 6:101641075-101641097 TTGAATTAGCTTTAATATGAAGG + Intronic
1014883686 6:126753607-126753629 TAGTAGAAGCTTTAGAAAGATGG + Intergenic
1014898231 6:126930058-126930080 TTGTATGAGGTTTAGTAGGGAGG + Intergenic
1015900138 6:138056548-138056570 TTGGAATAGTTTTAGTAGGATGG - Intergenic
1016623384 6:146138431-146138453 TTGTAATAGTTTGAGTAGGATGG + Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022862741 7:34384715-34384737 TTGTCTAAACTTAAGAAGGAGGG + Intergenic
1026418273 7:70205850-70205872 TAGCATAAGCTTTAAGAGGAGGG + Intronic
1030332478 7:108285869-108285891 TGGTAGAAGCTGTAGTAGCAGGG - Intronic
1030568257 7:111188023-111188045 AAGGAGAAGCTTTAGTAGGAAGG + Intronic
1031159941 7:118154436-118154458 ATGTATTTGCTTTAGCAGGAAGG + Intergenic
1032827039 7:135581006-135581028 TTTTATAAGCTTTAATAGTTAGG + Intronic
1035620165 8:1030585-1030607 ATGTTTAAGCTTTAGTAAGCTGG + Intergenic
1037614311 8:20503755-20503777 TTACATAAGTTTAAGTAGGATGG + Intergenic
1039463717 8:37767170-37767192 TTGTAACAGCTTTATTAGGGAGG + Intronic
1040348006 8:46529131-46529153 TTGTATTAGCTTCAGCAGGTTGG + Intergenic
1041048320 8:53908330-53908352 CTGTATAAGTTTTAGTAGCTCGG - Intronic
1041305541 8:56454243-56454265 TTGTGTTAGCTTGAGAAGGATGG - Intergenic
1046238985 8:111465514-111465536 ATTTATTAGATTTAGTAGGATGG - Intergenic
1048696681 8:137036132-137036154 TTGTATAAGGTGTATAAGGAAGG + Intergenic
1050538264 9:6648619-6648641 TTATAGAGGCTTTATTAGGAAGG - Intergenic
1052487717 9:29124230-29124252 TTGTATAAGGTGTAATAGAAGGG - Intergenic
1052778020 9:32753044-32753066 TGGTATAACCTTGAGTAGGAGGG - Intergenic
1055257707 9:74391878-74391900 TTGAATAGGCTTTAGAGGGATGG + Intergenic
1057216290 9:93230629-93230651 TAGTATGAGCTTTAGTAGCCAGG + Intronic
1061686502 9:132284809-132284831 CTGTATGAGCTTTAGGATGAGGG - Intronic
1187715836 X:22101670-22101692 TTGTATAGGTTTTGGTGGGAAGG + Intronic
1193211435 X:78811131-78811153 TTGTATGGGCTTTAGAAGGGAGG + Intergenic
1193820617 X:86160086-86160108 TTGTAAAATCTTTAGAAGGAAGG - Intronic
1194564361 X:95465607-95465629 TTGAAAAAGTTTTAGAAGGATGG - Intergenic
1195353795 X:104019242-104019264 TTTCTTAAGCTTTAGAAGGATGG + Intergenic
1199229491 X:145419641-145419663 TTTTATATGGTTTAGGAGGAGGG + Intergenic