ID: 1115863884

View in Genome Browser
Species Human (GRCh38)
Location 14:37720955-37720977
Sequence ATGTTGTCTTTGGGCTAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115863884 Original CRISPR ATGTTGTCTTTGGGCTAAAC TGG Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
901823039 1:11842440-11842462 TTGCTGTCTTTGGGCTTATCTGG - Exonic
901977250 1:13004950-13004972 AACTTGTGTTTGGGCAAAACAGG + Intronic
902004836 1:13223984-13224006 AACTTGTGTTTGGGCAAAACAGG - Intergenic
902024054 1:13369719-13369741 AACTTGTGTTTGGGCAAAACAGG - Intronic
903154834 1:21436376-21436398 ATGATGTCTTTGCAATAAACGGG + Intergenic
903797247 1:25938659-25938681 ATGTTATATTTGGGGAAAACTGG - Intergenic
905012049 1:34754461-34754483 ATGTTGTCTTTGGGTTAAAAAGG - Intronic
905938922 1:41847484-41847506 ATCTTGTCTTTGGGGTAAGTAGG + Intronic
906245951 1:44274408-44274430 GTGTTGCCTTTGGGGTAATCAGG - Intronic
912377426 1:109222269-109222291 ATGTTATCATTGGGGAAAACGGG - Intronic
912393211 1:109319265-109319287 ATTGTTTCTTTGGGGTAAACAGG - Intronic
912417922 1:109522806-109522828 ATGTTATACTTGGGCTAAAGAGG + Intergenic
912608885 1:111022460-111022482 AAGTTGACTTTGGTCTAATCAGG - Intergenic
914727252 1:150338147-150338169 ATCTTGTTTTTAGGCTCAACTGG + Exonic
915994777 1:160551255-160551277 AAATTGTCTTTGGCCTAATCTGG - Intronic
916260194 1:162834201-162834223 ATGTTTTCTCTGGGCTCACCGGG + Intronic
920352319 1:205345359-205345381 ATGTTGCCATTGGGAGAAACTGG - Intronic
921120817 1:212135367-212135389 ATGTTACCTTTGGGGGAAACTGG + Intergenic
921759284 1:218894113-218894135 ATATTGTCTTTCAGCTATACAGG - Intergenic
922325126 1:224521231-224521253 ATGTTGTCCTTGGTTTAGACTGG + Intronic
922753167 1:228080449-228080471 ATGATGTCTTCAGGCCAAACAGG - Intergenic
1063716965 10:8537536-8537558 ATGATGTGTTTGGCCTAAATGGG - Intergenic
1064579336 10:16778317-16778339 ATGGTTTCTTTGGGATTAACTGG - Intronic
1065227568 10:23560371-23560393 ATGTTATCATTGGGTGAAACTGG - Intergenic
1065382444 10:25103431-25103453 AGATTGTCTTTGGGTTACACTGG - Intergenic
1067100695 10:43332336-43332358 ATGTTATCATTGGGGGAAACTGG + Intergenic
1068312858 10:55300832-55300854 ATGTTGTCTTCGGTCCAAACTGG - Intronic
1072696092 10:97603939-97603961 ATGTTGCCATTGGGGAAAACTGG - Intronic
1073283781 10:102374781-102374803 ATGTTACCATTGGGATAAACTGG + Intronic
1076004108 10:126934209-126934231 CTATTGTCTTTAGTCTAAACAGG + Intronic
1078072181 11:8122100-8122122 ATGTTGCCTTTGGGAGAAACTGG - Intronic
1081342892 11:41949521-41949543 ATGTTGTCTTATGGCTGAAAAGG + Intergenic
1081443994 11:43111896-43111918 ATGTTATCATTGGGGGAAACTGG + Intergenic
1083601244 11:63949598-63949620 ATCTTGGCTTGGGGATAAACTGG + Intronic
1087206228 11:95398356-95398378 ATGTTCTCATTGAGATAAACTGG + Intergenic
1087207793 11:95415742-95415764 GTCTGGTCTTTGGGCTAGACTGG - Intergenic
1087744481 11:101927415-101927437 ATGTTATCATTGGGGGAAACTGG - Intronic
1088655317 11:111993620-111993642 ATGATTTCTTTGGGCCAAAGAGG - Intronic
1088809688 11:113382980-113383002 ATGTTACCTTTGGGGGAAACTGG - Intronic
1089401900 11:118169140-118169162 ATGTGGTCTTTGGGGCAAAGCGG + Intronic
1089571283 11:119412213-119412235 ATGTTGCCATTGGGGGAAACTGG - Intergenic
1091082813 11:132688232-132688254 ATGTTGTGTTTTGACTACACAGG - Intronic
1093589047 12:20877411-20877433 ATGTTGTCTTTGTAATGAACTGG - Intronic
1094469555 12:30791097-30791119 ATGTTGGCTTAGGCCTAAAAGGG + Intergenic
1096599482 12:52719130-52719152 ATGCAGGCCTTGGGCTAAACTGG - Intergenic
1102822798 12:115922778-115922800 ATTTAGCCTTTAGGCTAAACAGG + Intergenic
1104304502 12:127597185-127597207 ATGTTTTCTGTGGGCTATTCTGG + Intergenic
1104500337 12:129279132-129279154 ATGTTGTATTTGGGCTGCACAGG - Intronic
1106278276 13:28236642-28236664 ACATTGTCTTTATGCTAAACTGG - Intronic
1106726735 13:32494337-32494359 ATGGTGTATTAGGGCTAAAAGGG - Intronic
1106996716 13:35492656-35492678 ATGTTGGGTTTAGGATAAACAGG + Intronic
1110644775 13:77869601-77869623 ATGTTACCATTGGGGTAAACTGG - Intergenic
1112443519 13:99443342-99443364 ATGTTCTATTTGGGCTCGACAGG - Intergenic
1113904827 13:113814365-113814387 ATGTTGTGTTTGGGGGAAGCTGG - Exonic
1115444893 14:33478660-33478682 AAGTTGCGTTTGGGCAAAACAGG + Intronic
1115863884 14:37720955-37720977 ATGTTGTCTTTGGGCTAAACTGG + Intronic
1116895260 14:50310174-50310196 ATGTTTTCATTGGGGTAAATGGG + Intronic
1118167681 14:63354090-63354112 ATGTTGTCTGAGGGCAGAACAGG - Intergenic
1119170870 14:72535457-72535479 ATGTTGCCATTGGGGCAAACTGG - Intronic
1119372088 14:74155273-74155295 GTGGTTTCTTTGGGCTAATCAGG + Intronic
1121710594 14:96036084-96036106 ATGTTATCATTGGGAGAAACTGG + Intergenic
1124918677 15:34002066-34002088 ATGTTATCATTGGGGTAAACTGG - Intronic
1125248546 15:37672273-37672295 AAGTAGTCCTGGGGCTAAACAGG - Intergenic
1126598973 15:50409559-50409581 ATGTTGCCTTTGAGATAATCTGG - Intergenic
1128102953 15:65019924-65019946 TTGTTGACTCTGGGGTAAACTGG + Intronic
1130073639 15:80670384-80670406 ATGTTGTCTTTGGTCAAGCCTGG + Intergenic
1131632270 15:94190820-94190842 TTCTTGTCTTTGGTCTAAATTGG - Intergenic
1131821105 15:96274525-96274547 ATGCTGTCTTTGGGGAAAGCCGG + Intergenic
1133676258 16:8075749-8075771 ATGTTGTCTTAGGGGTGAAAGGG - Intergenic
1135470836 16:22729128-22729150 ATGTTGTAGTTTGGCTAACCTGG + Intergenic
1137497520 16:48982183-48982205 ATGTTTTCATTGGGAGAAACTGG - Intergenic
1143068518 17:4268966-4268988 ATTTTGTCTTTGGCCTAAACTGG - Intergenic
1143520914 17:7443784-7443806 CTGTTGGCTTTGGCCTGAACCGG + Exonic
1143716799 17:8778302-8778324 ATATTAACTTTGGGCTAAAGAGG + Intergenic
1144268428 17:13594097-13594119 ATGTTTTCTCAGGGCTATACTGG + Intronic
1149076706 17:52604128-52604150 TTGTTGTCTTTGGGCTACACAGG + Intergenic
1150137078 17:62701970-62701992 ATGCTGTCTTTGGGGGAAGCTGG - Intronic
1150628075 17:66856408-66856430 ATGTTGCCATTGGGTGAAACTGG - Intronic
1154179958 18:12127549-12127571 GTGTTATCTTTGTGCCAAACTGG - Intronic
1154969136 18:21389656-21389678 ATTTTGTTTCTGGGCTAAAGAGG - Intronic
1156809520 18:41229957-41229979 ATATTGTGTTTTGGCTATACAGG + Intergenic
1158354642 18:56604129-56604151 ATGGTGTCTTTGGACCAAAGGGG - Intronic
1161248846 19:3269957-3269979 AAGTTGTCTTAAGACTAAACGGG + Intronic
1162771558 19:12952556-12952578 ATGTTGTGTTTGGCCAGAACAGG + Intronic
927734951 2:25511813-25511835 ATGTTTTCCTTGTGATAAACTGG + Intronic
930155784 2:48106552-48106574 AAGTTGGCTTGGGTCTAAACAGG - Intergenic
930601114 2:53444265-53444287 ATGTTGGCTTTGGGGAAAAGGGG - Intergenic
933884678 2:86707121-86707143 ATGTTATCATTGGGGGAAACTGG - Intronic
933982043 2:87558478-87558500 ATGTTATCTTTAGGGGAAACTGG - Intergenic
935064741 2:99637882-99637904 ATGTTGTCCTTGGTCTAGAAGGG + Intronic
935756766 2:106282499-106282521 ATGTTCTTTCTGGGCTAAGCTGG + Intergenic
936112800 2:109678526-109678548 ATGTTCTTTCTGGGCTAAGCTGG - Intergenic
936273035 2:111066520-111066542 ATGTTACCATTGGGCGAAACTGG + Intronic
936311794 2:111392334-111392356 ATGTTATCTTTAGGGGAAACTGG + Intergenic
940126009 2:150325418-150325440 AGATTGTCATTGGGCTGAACAGG - Intergenic
942773883 2:179557397-179557419 ATGTTGGCTTTTGGCCACACTGG - Intronic
944127086 2:196306315-196306337 ACGGTTTCTTTGGACTAAACCGG + Intronic
948018014 2:234706044-234706066 TTGTAGCCTTTGGTCTAAACAGG + Intergenic
1169026852 20:2379074-2379096 CTGTTATCTCTGGGCCAAACTGG - Intergenic
1169979093 20:11363667-11363689 ATGTTTGCTTTGCTCTAAACTGG + Intergenic
1170015162 20:11772337-11772359 ATGATGTCTTGGGCCTCAACTGG + Intergenic
1170435274 20:16320121-16320143 TTGTTGTCTTTGGGCTTTCCTGG - Intronic
1171162232 20:22938169-22938191 TTGTTGTTGTTGGGCTAAGCAGG + Intergenic
1173045857 20:39511100-39511122 ATGTTATCATTGGGGGAAACTGG - Intergenic
1174567412 20:51475467-51475489 ATGTTGTTTTTGGGCTCCAAGGG + Exonic
1177253238 21:18624188-18624210 TTGTTTTCTTTGGACCAAACTGG + Intergenic
1177438229 21:21083805-21083827 ATGCTGTCATTGGGAGAAACTGG - Intronic
1184827616 22:46963702-46963724 ATGGGGTCTTTGGGCTGAGCAGG + Intronic
949469975 3:4384334-4384356 ATGTTGCCATTGGGGAAAACTGG - Intronic
949974938 3:9447774-9447796 CTTTAGTCTTTGGGCTGAACTGG - Exonic
950144410 3:10638521-10638543 CTGTTGTCTTTGGGATTAATTGG - Intronic
952855943 3:37770911-37770933 ATGTCCTCTTTGGGGTAAAGGGG + Intronic
953728547 3:45424009-45424031 ATGTTATCATTGGGCAAAGCTGG - Intronic
955989013 3:64604761-64604783 ATGTTATCTTTGGGCAAACAGGG - Intronic
956039724 3:65133178-65133200 ATGTTCTATTTGGGAGAAACAGG - Intergenic
957660611 3:83147025-83147047 ATGTTGTGTTTGTCCTAAAAGGG + Intergenic
958494811 3:94830836-94830858 ATGTTGGCTTTTGACAAAACTGG - Intergenic
961920865 3:130424797-130424819 ATGTAGTCTCTGGGCCAATCTGG + Intronic
965660780 3:171039877-171039899 ATGTTGGCTTTGTGACAAACTGG + Intergenic
966128732 3:176610394-176610416 ATGGTGTCTTTTGGCACAACTGG + Intergenic
975853834 4:78601534-78601556 ATGCAGTCTTTCGGCTAAAAAGG - Exonic
976662888 4:87558675-87558697 ATGTTACCTTTGGGGGAAACTGG + Intergenic
977973472 4:103237684-103237706 ATGTTATCATTGGGAGAAACTGG + Intergenic
977986793 4:103391934-103391956 ATGTTATCATTGGGAGAAACTGG - Intergenic
986066761 5:4241529-4241551 AAGTTCTCTTTGGTCAAAACTGG - Intergenic
987001743 5:13666844-13666866 ATCTAGTCTTTTGGTTAAACGGG + Intergenic
989003781 5:36787759-36787781 ATGTTGTCTGTCTGCTAATCTGG + Intergenic
989344050 5:40409273-40409295 ATGTTGTTTTTGCACTACACTGG - Intergenic
990632851 5:57689851-57689873 ATCATGTGTTTGGGCTAAAGAGG + Intergenic
991943319 5:71876097-71876119 ATGTATTCCTTGGGCTAAAAAGG - Intergenic
996325021 5:122262929-122262951 ATGATGTGTTTGGGCTACAAAGG - Intergenic
996869493 5:128172279-128172301 ATGTTATCATTGGGGGAAACTGG - Intronic
997275861 5:132588551-132588573 ATGTTATCATTGGGAGAAACTGG + Intronic
997702913 5:135917288-135917310 ATGCTGTCTTTAGTCTAAAATGG + Intergenic
1001100578 5:168810655-168810677 AAGCTGTCTTTGTGCCAAACGGG + Intronic
1005646096 6:27839619-27839641 ATATTTTCTTTGGGGTCAACAGG - Intronic
1005827492 6:29643226-29643248 ATCTTGTCATTGGGCTGAGCAGG - Intergenic
1006252686 6:32802394-32802416 ATGTTATCCTTGGGGGAAACTGG - Intergenic
1009589373 6:65646260-65646282 ATTTTGTCCTTGTGCTCAACAGG - Intronic
1010922548 6:81702227-81702249 TTGTGGTCTTTAGACTAAACTGG + Intronic
1011310692 6:85976440-85976462 ATGTTGTCTTTTATCTACACTGG - Intergenic
1012554514 6:100495297-100495319 ATGTTTTCAATGGGATAAACTGG + Intergenic
1013092988 6:106917937-106917959 AGGTTCTCTTTGGGCTGAAGAGG - Intergenic
1014735139 6:125085154-125085176 CTGTTGTCTTTGGCCTACTCAGG + Exonic
1020687614 7:11315121-11315143 ATCTTGGTTTTGGACTAAACTGG + Intergenic
1020886446 7:13824063-13824085 AGGTTGTCTTTGGGCTGATGGGG - Intergenic
1025748128 7:64264183-64264205 ATTTTTTCTTTGTGCTACACTGG + Intronic
1028669959 7:93390487-93390509 ATGTTGCCATTGGGGAAAACTGG + Intergenic
1031717615 7:125127913-125127935 ATGTTACCTTTGGGGGAAACTGG - Intergenic
1033824317 7:145170897-145170919 GTTCTGTCATTGGGCTAAACTGG + Intergenic
1038332134 8:26617187-26617209 ATGTTTCCTTTGGGGGAAACGGG + Intronic
1040934673 8:52770133-52770155 ATGTTTTCTTTTGGTTAGACTGG + Intergenic
1041763048 8:61387428-61387450 ATTTTGTCTTTGGGCTATAAAGG - Intronic
1044445110 8:92266183-92266205 ATGTTGAGTTTGGGGTACACAGG + Intergenic
1044753866 8:95441648-95441670 ATATTGTCTATGGGTGAAACAGG - Intergenic
1045649525 8:104329015-104329037 ATGCTGTCTTGGGGCAGAACTGG - Intergenic
1047335280 8:123930079-123930101 ATGTTACCTTTGGGCAAAACTGG - Intronic
1051845684 9:21448948-21448970 ATGTTGTCCTGACGCTAAACTGG - Intergenic
1052704365 9:31976990-31977012 ATTTGGTCTTTGGGCAAAGCAGG - Intergenic
1055259269 9:74413772-74413794 ATGTTGTATTTCTGCAAAACTGG - Intergenic
1055273114 9:74583957-74583979 ATGTTGTCTTTGTGTAGAACGGG + Intronic
1056729915 9:89156620-89156642 ATGTTGTCTTTGGTTTTTACAGG - Intronic
1058571339 9:106348621-106348643 ATGTTGACATTGGGGAAAACTGG + Intergenic
1062282224 9:135757141-135757163 ATGTTGCCCTGGGGCCAAACGGG - Exonic
1187101242 X:16194922-16194944 CTGTTGTCTTAGGTCTAAATAGG + Intergenic
1188666636 X:32830561-32830583 ATGTTTTCATTGTGCAAAACAGG - Intronic
1188707647 X:33355753-33355775 ATGTTATCATTGGGAGAAACTGG - Intergenic
1193204681 X:78734844-78734866 AGGTGGTCTTTGGGTTAAATTGG + Intergenic
1193571049 X:83143965-83143987 ATGTTATCTTTGGGTTTAAAGGG - Intergenic
1195066316 X:101241369-101241391 ATGTTGTCATTTGGGGAAACTGG + Intronic
1196996490 X:121389384-121389406 ATGTTGTATTTAGGTTATACAGG + Intergenic
1197265199 X:124362060-124362082 CTGTTCTCTTTGGTCCAAACTGG - Intronic