ID: 1115868482

View in Genome Browser
Species Human (GRCh38)
Location 14:37774556-37774578
Sequence GTAAACAACCTTGCATCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1347
Summary {0: 1, 1: 0, 2: 2, 3: 90, 4: 1254}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115868482 Original CRISPR GTAAACAACCTTGCATCTCA GGG Intronic
903289607 1:22300163-22300185 TGAACCAACCTTGCATCCCAGGG - Intergenic
904145071 1:28383982-28384004 TGAACCAACCTTGCATCCCAGGG + Intronic
905332062 1:37211230-37211252 TGAACCAACCTTGCATCCCAGGG - Intergenic
905878498 1:41448601-41448623 GCAAACAACCTGGCAGCTGATGG + Intergenic
906352422 1:45074052-45074074 TGAACCATCCTTGCATCTCAGGG + Intronic
906558242 1:46732339-46732361 TGAAACAGCCTTGCATCCCAGGG - Intergenic
906587126 1:46988705-46988727 TAAACCAACCTTGCATCTCAGGG - Intergenic
906851381 1:49253837-49253859 TGAACCAACCTTGCATCTTAGGG - Intronic
906900591 1:49831928-49831950 TGAACCAGCCTTGCATCTCAGGG + Intronic
906993921 1:50769615-50769637 TAAACCAACCTTGCATCCCAGGG - Intronic
907561377 1:55392215-55392237 TTAAACCACCTTGCATCTCTGGG + Intergenic
907580081 1:55564142-55564164 TGAACCAGCCTTGCATCTCAGGG + Intergenic
907634805 1:56123493-56123515 TGAACCAACCTTGCATCCCAGGG + Intergenic
908091301 1:60687973-60687995 TGAACCAACCTTGCATCTCAGGG - Intergenic
908283262 1:62565381-62565403 TGAACCAACCTTGCATCCCAGGG - Intronic
908314100 1:62915929-62915951 ATACACAGCCATGCATCTCAGGG - Intergenic
908664281 1:66472733-66472755 TGAAACAACCTTGCATCTCAGGG + Intergenic
908783364 1:67712001-67712023 GTAAACACCTCTGCCTCTCAGGG - Intronic
908898439 1:68927173-68927195 TGAACCAGCCTTGCATCTCAGGG - Intergenic
908969446 1:69809595-69809617 TGAACCAGCCTTGCATCTCAGGG - Intronic
909055429 1:70815358-70815380 TGAACCATCCTTGCATCTCAGGG + Intergenic
909060859 1:70877769-70877791 TTAACTAACCTTGCATCCCAGGG + Intronic
909065126 1:70927001-70927023 TGAACCATCCTTGCATCTCAGGG + Intronic
909181307 1:72427329-72427351 TTAACCAGCCTTGCATCCCAGGG + Intergenic
909373879 1:74918014-74918036 TGAACCAACCTTGCATCCCAGGG + Intergenic
909421060 1:75466197-75466219 TGAACCATCCTTGCATCTCAGGG - Intronic
909485384 1:76167317-76167339 TGAACCAACCTTGCATCCCAGGG + Intronic
909826603 1:80134867-80134889 TGAAACAGCCTTGCATCCCAGGG + Intergenic
910067526 1:83171241-83171263 TGAATCAGCCTTGCATCTCAGGG - Intergenic
910081999 1:83352754-83352776 TGAATCAGCCTTGCATCTCAGGG + Intergenic
910600864 1:89030855-89030877 TGAAACAGCCTTGCATCCCAGGG + Intergenic
910635088 1:89399060-89399082 GGAAACAACCTTGAATCCCTGGG + Intergenic
910639915 1:89448035-89448057 TGAAACATCCTTGCATCTCTGGG - Intergenic
911128660 1:94366590-94366612 TGAACCAGCCTTGCATCTCAGGG + Intergenic
911374888 1:97040253-97040275 TGAACCAACCTTGCATATCAAGG + Intergenic
911385025 1:97164097-97164119 TGAAACAACCTTGCACCCCAGGG - Intronic
911458288 1:98155433-98155455 TGAAGCAACCTTGCATCCCAGGG - Intergenic
911514395 1:98849055-98849077 TAAACCAACCTTGCATCCCAGGG + Intergenic
911541005 1:99158476-99158498 GGAACCAGCCTTGCATCCCAGGG + Intergenic
911667551 1:100571168-100571190 TGAACCAACCTTGCATCCCAGGG - Intergenic
911691687 1:100841943-100841965 TGAACCAACCTTGCATCCCAGGG + Intergenic
911812233 1:102297098-102297120 TGAACCAACCTTGCATCCCAGGG + Intergenic
911827550 1:102506495-102506517 TTAACCAGCCTTGCATCCCAGGG + Intergenic
911836017 1:102619920-102619942 TGAACCAACCTTGCATCTCAGGG + Intergenic
911926329 1:103836624-103836646 TAAAACAGCCTTGCATCCCAAGG - Intergenic
912031529 1:105251108-105251130 AGAACCATCCTTGCATCTCAGGG + Intergenic
912264820 1:108146735-108146757 TTGAACAGCCTTGCATCCCAGGG + Intronic
912270679 1:108205737-108205759 GGAACCAGCCTTGCATCCCAGGG + Intergenic
912447051 1:109745098-109745120 TGAACCAACCTTGCATCCCAGGG + Intronic
912636530 1:111299409-111299431 TTAACCAGCCTTGCATCCCAGGG - Intronic
912887655 1:113492189-113492211 TACACCAACCTTGCATCTCAGGG - Intronic
913408425 1:118521902-118521924 TGAACCAACCTTGCATCCCAGGG + Intergenic
913504245 1:119501472-119501494 TGAACCAGCCTTGCATCTCAGGG - Intergenic
914968663 1:152286136-152286158 TAAAACAACCTTTCATCCCAGGG - Intergenic
915037384 1:152940245-152940267 TGAAACAGCCTTGCATCCCAGGG - Intergenic
915052269 1:153088063-153088085 TGAACCAACCTTGCATCCCAAGG - Intergenic
915640732 1:157223798-157223820 TGAAACAGCCTTGTATCTCAGGG + Intergenic
915649467 1:157298051-157298073 TGAACCAGCCTTGCATCTCAGGG - Intergenic
915803802 1:158823029-158823051 TGAACCAACCTTGCATCCCAGGG + Intergenic
915876878 1:159620199-159620221 TGAACCAACCTTGCATCCCAGGG - Intergenic
916242506 1:162654140-162654162 TTAAAAAACTATGCATCTCAAGG + Intronic
916398060 1:164413182-164413204 GAAAACAACCTTAAATCTTAAGG - Intergenic
916480558 1:165210800-165210822 GTAGACACACTGGCATCTCAGGG + Intronic
916568421 1:166003791-166003813 TGAACCAACCTTGCATCCCAGGG + Intergenic
916595840 1:166242291-166242313 TGAACCAGCCTTGCATCTCAGGG + Intergenic
916985606 1:170188160-170188182 TGAACCAACCTTGCATCCCAGGG + Intergenic
917313288 1:173699493-173699515 GGAACCAGCCTTGCATCCCAGGG - Intergenic
917581874 1:176387090-176387112 TGAACCAGCCTTGCATCTCAGGG + Intergenic
917998248 1:180463877-180463899 TGAACCAACCTTGCATCCCAGGG - Intronic
918026956 1:180759935-180759957 TTGAACAGCCTTGCATCCCAGGG - Intronic
918504346 1:185235383-185235405 TGAACCAGCCTTGCATCTCAGGG - Intronic
918515936 1:185363105-185363127 TGAACCAACCTTGCATCCCAGGG - Intergenic
918612474 1:186508715-186508737 TGAACCAGCCTTGCATCTCAGGG + Intergenic
918814419 1:189164598-189164620 TGAACCAACCTTGAATCTCAGGG + Intergenic
918817759 1:189211202-189211224 TGAACCAGCCTTGCATCTCAGGG - Intergenic
918835264 1:189454452-189454474 TGAAACATCCTTGCATCTCTGGG + Intergenic
918973059 1:191445094-191445116 TGAACCAGCCTTGCATCTCAGGG + Intergenic
919003438 1:191864528-191864550 TTGAACAACCTTGCATCTCTGGG - Intergenic
919203624 1:194391923-194391945 TTAATCAACCTTGCATCACAAGG - Intergenic
919235004 1:194829523-194829545 TGAATCAACCTTGCATCCCAGGG + Intergenic
919292221 1:195647009-195647031 TGAACCAGCCTTGCATCTCAGGG + Intergenic
919461321 1:197880955-197880977 TGAACAAACCTTGCATCTCAGGG + Intergenic
919533752 1:198760292-198760314 TGAACCAACCTTGCATCCCAGGG + Intergenic
919568123 1:199214913-199214935 TGAACCAACCTTGCATCCCAGGG + Intergenic
919627316 1:199924162-199924184 TGAACCAACCTTGCATCCCAGGG - Intergenic
920955052 1:210611826-210611848 GGAACCAACTTTGCATCCCAGGG + Intronic
920981962 1:210845399-210845421 TTAACCAGCCTTGCATCCCAGGG - Intronic
920993626 1:210964922-210964944 TGAACCAGCCTTGCATCTCAGGG - Intronic
921234782 1:213114873-213114895 TGAACCAGCCTTGCATCTCAGGG + Intronic
921269969 1:213458925-213458947 TGAAACATCCTTGCATCCCAGGG + Intergenic
921275616 1:213516550-213516572 TGAACCAACCTTGCATCCCAGGG + Intergenic
921787789 1:219252604-219252626 TAAATCAACCTTCCATCTCAGGG + Intergenic
922622099 1:226996779-226996801 GGAACCAGTCTTGCATCTCAGGG + Intronic
923060897 1:230472964-230472986 TGAACCAGCCTTGCATCTCAGGG + Intergenic
923855642 1:237842676-237842698 TGAACCAACCTTGCATCCCAGGG - Intergenic
923947357 1:238902964-238902986 TGAACCAACCTTGCATCCCAGGG - Intergenic
924616642 1:245617531-245617553 GGAAAGAACCTTGCTTCTAATGG + Intronic
924822755 1:247509822-247509844 TGAACCAGCCTTGCATCTCAGGG + Intronic
924863922 1:247957263-247957285 TGAACCAACCTTGCATCCCAGGG + Intronic
924898698 1:248371848-248371870 TGAACCATCCTTGCATCTCAGGG + Intergenic
924919716 1:248615397-248615419 TGAACCAACCTTGCATCCCAGGG - Intergenic
1062776155 10:149932-149954 TGAACCAACCTTGCATCCCAGGG + Intronic
1063196130 10:3745426-3745448 GTGAAGAACTTTGCAGCTCATGG - Intergenic
1063305595 10:4896779-4896801 TGAACCAACCTTGCATCCCAGGG + Intergenic
1063324633 10:5085396-5085418 TGAACCAACCTTGCATCCCAGGG + Intronic
1064515286 10:16141048-16141070 TGAACCAACCTTGCATCCCAGGG + Intergenic
1066077427 10:31893918-31893940 TGAACCAACCTTGCATCCCAGGG - Intronic
1066257289 10:33692635-33692657 TTGAACCACCTTGCATCCCAGGG + Intergenic
1067161834 10:43832899-43832921 GGAACCAGCCTTGCATCCCAGGG + Intergenic
1067212540 10:44272126-44272148 TGAACCAACCTTGCATCCCAGGG - Intergenic
1067390675 10:45860213-45860235 ATTAGCAACCTTGCATCCCATGG - Intergenic
1067500795 10:46803621-46803643 ATTAGCAACCTTGCATCCCATGG + Intergenic
1067593785 10:47536298-47536320 ATTAGCAACCTTGCATCCCATGG - Intronic
1067640895 10:48044407-48044429 ATTAGCAACCTTGCATCCCATGG - Intergenic
1067673737 10:48350439-48350461 TGAAACAGCCTTGCATCCCAGGG - Intronic
1067872605 10:49975859-49975881 ATTAGCAACCTTGCATCCCATGG + Intergenic
1067900907 10:50240563-50240585 AAAAACAAGCTGGCATCTCAAGG + Intronic
1067924278 10:50491988-50492010 TGAACCAACCTTGCATCCCAGGG - Intronic
1068269564 10:54703048-54703070 TGAACCAACCTTGCATCACAGGG - Intronic
1068299582 10:55121208-55121230 GTAAACAACATTAAATCTTAAGG - Intronic
1068442728 10:57079560-57079582 TTAACCAACCTTGCATCCCGGGG + Intergenic
1068646536 10:59474187-59474209 TGAACCAGCCTTGCATCTCAGGG - Intergenic
1068848936 10:61713830-61713852 GGAACCAGCCTTGCATCCCAGGG + Intronic
1068906002 10:62323380-62323402 TGAACCAACCTTGCATCCCAGGG - Intergenic
1068914328 10:62412107-62412129 TGAACCAACCTTGCATCCCAGGG - Intronic
1069142397 10:64842243-64842265 GTATACAAACTTGCCTCTCTAGG - Intergenic
1069233991 10:66047300-66047322 TGAACCAACCTTGCATCCCAGGG - Intronic
1069296945 10:66858222-66858244 TGAACCAACCTTGCATCCCAGGG + Intronic
1069360450 10:67635490-67635512 TGAACCAACCTTGCATCCCAGGG - Intronic
1069805564 10:71121557-71121579 TGAACCAATCTTGCATCTCAGGG + Intergenic
1069811573 10:71163902-71163924 TGAACCAACCTTGCATCCCAGGG - Intergenic
1070137860 10:73710452-73710474 ATTAGCAACCTTGCATCCCATGG - Intergenic
1070448384 10:76531605-76531627 TGAACCAACCTTGCATCTCTAGG + Intronic
1070516273 10:77210236-77210258 TGAACCAACCTTGCATCCCAGGG - Intronic
1070561277 10:77568405-77568427 GGAACCAGCCTTGCATCCCAGGG - Intronic
1070619443 10:77996983-77997005 GGAACCAGCCTTGCATCCCAGGG - Intronic
1070886943 10:79908888-79908910 TGAACCAACCTTGCATCCCAGGG + Intergenic
1071020308 10:81046348-81046370 TGAACCAACCTTGCATCCCAGGG + Intergenic
1071028251 10:81140887-81140909 TGAACCAACCTTGCATCCCAGGG - Intergenic
1071297142 10:84229793-84229815 GTAAACAAACTACAATCTCAGGG + Intergenic
1071441835 10:85705782-85705804 TTAACCAGCCTTGCATCCCAGGG - Intronic
1071611408 10:87034714-87034736 TGAACCAACCTTGCATCCCAGGG + Intergenic
1071748326 10:88446834-88446856 TGAACCAGCCTTGCATCTCAGGG - Intronic
1071891537 10:90013253-90013275 TGAAACAGCCTTGCATCCCAGGG - Intergenic
1072054119 10:91736948-91736970 TGAAACAACCTTGCATCCCAGGG + Intergenic
1072387817 10:94950011-94950033 TGAAACAGCCTTGCATCTCAGGG - Intronic
1072863112 10:99027828-99027850 TGAAACATCCTTGCATCCCAGGG - Intronic
1072867068 10:99074375-99074397 TGAATCATCCTTGCATCTCAGGG + Intronic
1073358704 10:102878909-102878931 GTAAATAACTTGGCATCTCTTGG - Exonic
1073629581 10:105135082-105135104 GTAAACAACCTTAAATCTTGAGG + Intronic
1073869807 10:107850172-107850194 TTAAACCACCATGCATCCCAGGG - Intergenic
1073962717 10:108952334-108952356 TGAACCAGCCTTGCATCTCAGGG - Intergenic
1074000272 10:109365190-109365212 TGAACCAACCTTGCATCCCAGGG + Intergenic
1074016399 10:109538915-109538937 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1074236283 10:111587603-111587625 GGAACCAGCCTTGCATCCCAGGG - Intergenic
1074627119 10:115202552-115202574 TGAACCAACCTTGCATCCCAGGG + Intronic
1074642204 10:115399025-115399047 TGAACCAACCTTGCATCCCAGGG + Intronic
1075937797 10:126358316-126358338 TGAAACATCCTTCCATCTCAGGG - Intronic
1076212852 10:128663789-128663811 TGAACCATCCTTGCATCTCAGGG + Intergenic
1076862764 10:133148450-133148472 TGAACCAACCTTGCATCCCAGGG - Intergenic
1077687974 11:4315741-4315763 ATAAACAGCCTTGCTGCTCACGG - Intergenic
1077696794 11:4400674-4400696 TGAACCAACCTTGCATCCCAGGG - Intergenic
1077969935 11:7178856-7178878 TGAACCAACCTTGCATCCCAGGG - Intergenic
1077984502 11:7337684-7337706 TGAACCAACCTTGCATCCCAGGG + Intronic
1078296106 11:10071816-10071838 TGAACCAGCCTTGCATCTCAGGG + Intronic
1078674436 11:13396861-13396883 GGAACCAGCCTTGCATCCCAGGG + Intronic
1079337506 11:19583698-19583720 GGAACCAGCCTTGCATCCCAGGG + Intronic
1079549739 11:21680038-21680060 TGAAACATCCTTGCATCCCAGGG + Intergenic
1079618532 11:22525515-22525537 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1079690426 11:23410154-23410176 TGAATCAACCTTGCATCCCAGGG + Intergenic
1079715277 11:23735728-23735750 GAAACCAGCCTTGCATCCCAGGG - Intergenic
1079824182 11:25169753-25169775 AGAAACAACCTTGCATTCCAGGG - Intergenic
1079833717 11:25304811-25304833 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1080152323 11:29067465-29067487 TGAACCAACCTTGCATCCCAGGG - Intergenic
1080246253 11:30182263-30182285 TGAACCAACCTTGCATCCCAGGG - Intergenic
1080292944 11:30691290-30691312 TGAACCAACCTTGCATCCCATGG - Intergenic
1080482266 11:32664000-32664022 TGAACCAACCTTGCATCCCAGGG + Intronic
1080712332 11:34761154-34761176 TGAACCAACCTTGCATCCCAGGG + Intergenic
1080815921 11:35756826-35756848 GGAACCAGCCTTGCATCCCAGGG + Intronic
1081035438 11:38138405-38138427 TAAACCATCCTTGCATCTCAGGG - Intergenic
1081043349 11:38239321-38239343 TGAACCAACCTTGCATCCCAGGG + Intergenic
1081124831 11:39310005-39310027 TGAATCAGCCTTGCATCTCAGGG + Intergenic
1081213923 11:40370786-40370808 GGAAACAATTTTTCATCTCATGG - Intronic
1081241089 11:40707530-40707552 TGAACCAGCCTTGCATCTCAGGG + Intronic
1081339818 11:41914386-41914408 TGAACCATCCTTGCATCTCAAGG + Intergenic
1082141440 11:48614077-48614099 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1082269332 11:50152661-50152683 TGAAACAGCCTTGCATCCCAGGG - Intergenic
1082279418 11:50255485-50255507 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1082286797 11:50326423-50326445 TGAAACAGCCTTGCATCCCAGGG + Intergenic
1082303858 11:50546725-50546747 TTAACCAGCCTTGCATCACAGGG - Intergenic
1082321306 11:50815671-50815693 TGAACCAACCTTGCATCCCAGGG + Intergenic
1083377827 11:62240515-62240537 TGAACCAACCTTGCATCCCAGGG - Intergenic
1083510582 11:63205969-63205991 GGAACCAGCCTTGCATCCCAGGG - Intronic
1083519348 11:63293598-63293620 TGAACCAACCTTGCATCCCAGGG + Intronic
1083524213 11:63346729-63346751 GGAACCAGCCTTGCATCCCAGGG + Intronic
1085768089 11:79301387-79301409 GCAAACAACCTTTCAGCCCAAGG - Intronic
1085850439 11:80113178-80113200 TGAACCAACCTTGCATCCCAGGG - Intergenic
1085966698 11:81536606-81536628 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1086142504 11:83514850-83514872 TGAACCAACCTTGCATCCCAGGG + Intronic
1086383220 11:86280986-86281008 TCAAACATCCTTGCATCCCAGGG + Intergenic
1086475194 11:87165360-87165382 TGAACCAGCCTTGCATCTCAGGG + Intronic
1086612533 11:88774765-88774787 TGAAGCAGCCTTGCATCTCAGGG + Intronic
1086824490 11:91478862-91478884 TGAACCAACCTTGCATCCCAGGG - Intergenic
1086839795 11:91670905-91670927 TGAACCAACCTTGCATCCCATGG - Intergenic
1087083201 11:94191836-94191858 TGAAACAGCCTTGCATCCCAGGG - Intergenic
1087228256 11:95628646-95628668 TGAACCAACCTTGCATCCCAGGG + Intergenic
1087298687 11:96407945-96407967 GGAACCAGCCTTGCATCCCAGGG + Intronic
1087312356 11:96559397-96559419 GGAACCAGCCTTGCATCCCAGGG - Intergenic
1087331765 11:96789821-96789843 TGAAACAGCCTTGCATCCCAGGG + Intergenic
1087353970 11:97070979-97071001 TGAACCAACCTTGCATCCCAGGG + Intergenic
1087387084 11:97485228-97485250 TGAACCAACCTTGCATCCCAGGG - Intergenic
1087406305 11:97735105-97735127 TGAACCAACCTTGCATCCCAGGG - Intergenic
1088038067 11:105342402-105342424 TGAAACAGCCTTGCATCCCACGG + Intergenic
1088419775 11:109632650-109632672 ATAAACAACATTACATCTCAAGG - Intergenic
1089741124 11:120584874-120584896 TGAACCAACCTTGCATCCCAGGG + Intronic
1090116776 11:123981443-123981465 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1090162251 11:124508043-124508065 TGAACCAACCTTGCATCTCAAGG + Intergenic
1090217226 11:124980095-124980117 TGAACCAACCTTGCATCCCAGGG + Intronic
1090559535 11:127916530-127916552 TGAAACAGCCTTGCATCCCAGGG - Intergenic
1090574169 11:128082652-128082674 TTGACCAATCTTGCATCTCAGGG + Intergenic
1090747250 11:129716336-129716358 TGAACCAGCCTTGCATCTCAGGG - Intergenic
1090864331 11:130684213-130684235 TGAATCAACCTTGCATCCCAGGG + Intronic
1091811358 12:3400829-3400851 TGAACCAACCTTGCATCCCAGGG - Intronic
1091850110 12:3689512-3689534 TGAACCAACCTTGCATCCCAGGG + Intronic
1092274816 12:7051853-7051875 TGAACCAACCTTGCATCCCAGGG + Intronic
1092442828 12:8524019-8524041 TGAACCAACCTTGCATCCCAGGG + Intergenic
1092513966 12:9188195-9188217 TGAACCAACCTTGCATCCCAGGG - Intronic
1092519303 12:9251028-9251050 TGAACCAACCTTGCATCTCAGGG - Intergenic
1092581305 12:9845831-9845853 TGAACCAACCTTGCATCCCAGGG + Intergenic
1092685722 12:11043111-11043133 TGAACCACCCTTGCATCTCAGGG - Intronic
1093008904 12:14083227-14083249 TGAACCAACCTTGCATCCCAGGG - Intergenic
1093188923 12:16052648-16052670 TGAACCAACCTTGCATCCCAGGG - Intergenic
1093329429 12:17816849-17816871 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1093391163 12:18624351-18624373 AGAATCATCCTTGCATCTCAGGG + Intronic
1093617532 12:21245287-21245309 TTAAACATCCTTACATCCCAGGG - Intergenic
1093618602 12:21259331-21259353 TGAACCAACCTTGCATCCCATGG + Intergenic
1093806379 12:23438089-23438111 TGAACCAGCCTTGCATCTCAGGG - Intergenic
1094225899 12:28045747-28045769 TGAATCAACCTTGCATCCCAGGG + Intergenic
1094244744 12:28275792-28275814 TGAAACAGCCTTGCATCCCAGGG - Intronic
1094245586 12:28288519-28288541 TGAACCAACCTTGCATCCCAGGG + Intronic
1094387768 12:29913708-29913730 TGAACCAGCCTTGCATCTCAGGG - Intergenic
1094804423 12:34074825-34074847 GGAACCAGCCTTGCATCCCAGGG - Intergenic
1094814556 12:34170377-34170399 GTAAACCAGCTTGCATCCCCTGG + Intergenic
1095230003 12:39728466-39728488 TAAACCAGCCTTGCATCTCAGGG + Intronic
1095306057 12:40640367-40640389 TGAACCAACCTTGCATCCCAAGG + Intergenic
1095346886 12:41160525-41160547 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1095518021 12:43028703-43028725 GTATACAAACTTTCATCACAAGG - Intergenic
1095571543 12:43688319-43688341 TGAACCAACCTTGCATCCCAGGG - Intergenic
1095657144 12:44683740-44683762 TGAAACAGCCTTGCATCCCAGGG + Intronic
1095836222 12:46641841-46641863 CAAACCAACCTTGCATCCCAGGG - Intergenic
1095866297 12:46976119-46976141 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1095920275 12:47522866-47522888 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1095931278 12:47627955-47627977 GGAACCAGCCTTGCATCCCAGGG - Intergenic
1096027686 12:48381430-48381452 TGGACCAACCTTGCATCTCAGGG + Intergenic
1096035339 12:48463751-48463773 TGAACCAACCTTGTATCTCAGGG - Intergenic
1096925499 12:55140037-55140059 TGAACCAACCTTGCATCCCAGGG - Intergenic
1096938136 12:55306908-55306930 TGAACCAACCTTGCATCCCAGGG - Intergenic
1096957589 12:55542448-55542470 TGAAACAGCCTTGCATCCCAGGG + Intergenic
1097303114 12:58039602-58039624 TGAACCAACCTTGCATCCCAGGG + Intergenic
1097486105 12:60203411-60203433 GTTAACAACCATGTATCTCATGG + Intergenic
1097512482 12:60561325-60561347 TGAATCAACCTTGCATCCCATGG + Intergenic
1097741161 12:63244194-63244216 TGAACCAACCTTGCATCCCAGGG - Intergenic
1097762644 12:63485654-63485676 GAACACAAACTTGAATCTCAAGG - Intergenic
1097944536 12:65352134-65352156 TGAACCAGCCTTGCATCTCAGGG - Intronic
1097963076 12:65551735-65551757 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1098047327 12:66413769-66413791 TGAACCAACCTTGCATCCCAGGG - Intronic
1098054418 12:66489296-66489318 TAAACCAACCTTGCATCTCAGGG - Intronic
1098061364 12:66566439-66566461 TGAACCAGCCTTGCATCTCAAGG + Intronic
1098145495 12:67493481-67493503 TGAACCAACCTTGCATCCCAGGG - Intergenic
1098667664 12:73184003-73184025 TGAACCAACCTTGCATCTCAGGG + Intergenic
1098678925 12:73325427-73325449 TGAACCAAACTTGCATCTCAAGG - Intergenic
1099224520 12:79953705-79953727 TGAACCATCCTTGCATCTCAGGG + Intergenic
1099301393 12:80899301-80899323 TGAACCAACCTTGCATCCCAAGG + Intronic
1099497864 12:83375034-83375056 TGAACCAACCTTGCATCCCAGGG + Intergenic
1099771556 12:87065201-87065223 TAAGACAACCTTGCATCGCAGGG - Intergenic
1099811635 12:87590607-87590629 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1099845401 12:88022165-88022187 TGAACCAACCTTGCATCCCAAGG - Intronic
1099862910 12:88241942-88241964 GGAATCAGCCTTGCATCCCAGGG - Intergenic
1099880674 12:88463510-88463532 TGAAACATCCTTGCATCCCAGGG + Intergenic
1099912530 12:88850670-88850692 TGAACCAACCTTGCATCCCAGGG - Intergenic
1100821385 12:98434118-98434140 TTAATCATCCTTGCATCTCAGGG - Intergenic
1100896623 12:99189514-99189536 TGAACCAACCTTGCATCCCAGGG - Intronic
1101227042 12:102698914-102698936 GGAACCATCCTTGCATCCCAGGG - Intergenic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1101459915 12:104880636-104880658 TGAACCAGCCTTGCATCTCAGGG + Intronic
1101628273 12:106467773-106467795 TGAACCAGCCTTGCATCTCAGGG + Intronic
1102718399 12:114994962-114994984 GAAAACAGCCTTTCATCCCAGGG - Intergenic
1105317559 13:19280557-19280579 TGAAACAGCCTTGCATCCCAGGG - Intergenic
1105592451 13:21806368-21806390 TGAACCAACCTTGCATCCCAGGG + Intergenic
1105663704 13:22528551-22528573 TGAACCAGCCTTGCATCTCAGGG - Intergenic
1105776208 13:23663335-23663357 TGAACCAACCTTGCATCCCAGGG + Intronic
1106089496 13:26577045-26577067 GGAAACAAAATTGCATCTGATGG + Intronic
1107157197 13:37182615-37182637 TAAACCAACCTTGCATCCCAGGG - Intergenic
1107176000 13:37398840-37398862 TGAACCAACCTTGCATCCCAGGG - Intergenic
1107648518 13:42520098-42520120 CGAACCAGCCTTGCATCTCAGGG - Intergenic
1107661278 13:42642431-42642453 TGAACCAACCTTGCATCCCAGGG + Intergenic
1108145001 13:47467355-47467377 TGAACCAACCTTGCATCTCAGGG - Intergenic
1108849964 13:54716378-54716400 TGAACCAGCCTTGCATCTCAAGG + Intergenic
1108958005 13:56185334-56185356 TGAACCAGCCTTGCATCTCAGGG - Intergenic
1108988681 13:56628428-56628450 TGAACCAACCTTGCATTTCAGGG - Intergenic
1109105455 13:58244220-58244242 GGAAACAACCTTGCATTCCAGGG - Intergenic
1109112421 13:58338496-58338518 GTGAACCACCTTGCATCCTATGG + Intergenic
1109247102 13:59968116-59968138 TTATTCAACCTTGAATCTCAAGG + Intronic
1109411754 13:61979399-61979421 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1109457099 13:62607800-62607822 TCAAACAGCCTTGCATCCCAGGG + Intergenic
1109528155 13:63603721-63603743 TGAACCAACCTTGCATCCCAGGG - Intergenic
1109625901 13:64974038-64974060 TGAATCAACCTTGCATCCCAGGG + Intergenic
1109700949 13:66024049-66024071 TGAACCAACCTTGCATCCCAGGG - Intergenic
1109731921 13:66423499-66423521 TTAACCAGCCTTGCATCCCAGGG - Intronic
1109826192 13:67725478-67725500 TGAACCATCCTTGCATCTCAGGG + Intergenic
1109884708 13:68526959-68526981 TTAAACAGCCTTGCATCCCAGGG - Intergenic
1110402661 13:75111997-75112019 GGAAACAGCCTTGCATCCTAGGG - Intergenic
1110942407 13:81366653-81366675 TGAAACAGCCTTGCATCCCAGGG - Intergenic
1111313458 13:86519649-86519671 TAAACCAACCTTGCATCCCAGGG + Intergenic
1111478397 13:88785479-88785501 TGAACCAACCTTGTATCTCAGGG + Intergenic
1111722991 13:91970786-91970808 TGAACCAACCTTGCATCCCAGGG + Intronic
1111786533 13:92794204-92794226 CGAACCAACCTTGCATCCCAGGG - Intronic
1112087710 13:96049152-96049174 TGAAACAGCCTTGCATCCCAGGG - Intronic
1112958657 13:105093351-105093373 TGAACCAACCTTGCATCCCAGGG + Intergenic
1113528061 13:110997369-110997391 TGAACCAGCCTTGCATCTCAAGG - Intergenic
1114003461 14:18286156-18286178 TGAACCAACCTTGCATCCCAGGG + Intergenic
1114030104 14:18571063-18571085 TGAACCAACCTTGCATCCCAGGG - Intergenic
1114158106 14:20130204-20130226 TGAACCAACGTTGCATCTCAGGG + Intergenic
1114361990 14:21983973-21983995 TAAAACATCCTTGCATCCCAGGG + Intergenic
1114425429 14:22617951-22617973 TGAACCAACCTTGCATCCCAGGG + Intergenic
1114686780 14:24540060-24540082 TGAACCAACCTTGCATCCCAGGG - Intergenic
1114760165 14:25305308-25305330 TGAACCAACCTTGCATCTCAGGG - Intergenic
1114765582 14:25367091-25367113 TGAAACAGCCTTGCATCCCAGGG + Intergenic
1114933319 14:27503234-27503256 TGAACCAACCTTGCATCCCAGGG + Intergenic
1114951841 14:27764249-27764271 TGAACCAACCTTGCATCTCTGGG - Intergenic
1114964613 14:27941700-27941722 GGAACCAGCCTTGCATCCCAGGG - Intergenic
1114991132 14:28291580-28291602 TGAACCAACCTTGCATCTAAGGG + Intergenic
1115276705 14:31617596-31617618 TGAACCAGCCTTGCATCTCAGGG + Intronic
1115401423 14:32965379-32965401 GGAACCATTCTTGCATCTCAAGG - Intronic
1115868482 14:37774556-37774578 GTAAACAACCTTGCATCTCAGGG + Intronic
1115885399 14:37966223-37966245 TGAACCAACCTTGCATCCCACGG + Intronic
1115938900 14:38586946-38586968 ACCAACAACCTTGCATCCCAAGG + Intergenic
1116060990 14:39923830-39923852 TGAACCAACCTTGCATCCCAGGG + Intergenic
1116123690 14:40754632-40754654 TGAACCAACCTTGCATCCCAGGG + Intergenic
1116140338 14:40985556-40985578 TGAAACATCCTTGCATCCCAGGG + Intergenic
1116362939 14:44024897-44024919 GGAACCAGCCTTGCATCCCAGGG - Intergenic
1116492690 14:45525051-45525073 TAAACCAACCTTGCATCCCATGG + Intergenic
1116506595 14:45690148-45690170 TGAACCAACCTTGCATCCCAGGG - Intergenic
1116511475 14:45752344-45752366 TGAAACAGCCTTGCATCCCAGGG + Intergenic
1116708743 14:48337631-48337653 TGAACCAACCTTGCATCACAGGG + Intergenic
1116765508 14:49065619-49065641 GGAATCAGCCTTGCATCCCAGGG - Intergenic
1116776004 14:49181492-49181514 TGAACCAGCCTTGCATCTCAGGG - Intergenic
1116792172 14:49350895-49350917 TTAACCAGCCTTGCATCTGAGGG + Intergenic
1117452006 14:55860828-55860850 TGAAGCAACCTTGCATCCCAGGG + Intergenic
1117477590 14:56112068-56112090 TGAACCATCCTTGCATCTCAGGG - Intergenic
1117639237 14:57779753-57779775 TGAACCAACCTTGCATCCCAGGG - Intronic
1117781268 14:59234963-59234985 TGAACCAACCTTGCATCCCAGGG + Intronic
1117820966 14:59648608-59648630 TGAACCAACCTTGCATCCCAGGG - Intronic
1117857289 14:60048954-60048976 TGAACCAACCTTGCATCACAGGG - Intronic
1117930160 14:60833498-60833520 TGAACCAACCTTGCATCCCAGGG + Intronic
1118009847 14:61599456-61599478 GCAAACAACCTTCCATCTAAGGG + Intronic
1118044880 14:61957624-61957646 GGAACCATCCTTGCATCACAGGG + Intergenic
1118146321 14:63141305-63141327 TGAACCAACCTTGCATCCCAGGG + Intergenic
1118415685 14:65533946-65533968 TGAACCAACCTTGCATCCCAGGG + Intronic
1118478730 14:66142702-66142724 TGAACCAACCTTGCATCCCAGGG - Intergenic
1118958462 14:70505103-70505125 TGAACCAGCCTTGCATCTCAGGG - Intergenic
1120008384 14:79385776-79385798 TTAACCAGCCTTGCATCCCAGGG - Intronic
1120390143 14:83896440-83896462 GTAAAAAATCTTGAAGCTCAGGG + Intergenic
1120571235 14:86119086-86119108 TGAACCAACCTTGCATCTCAGGG + Intergenic
1120586319 14:86316035-86316057 TTAACCAGCCTTGCATCCCAGGG - Intergenic
1120709416 14:87777779-87777801 TGAAACAGCCTTGCATCCCAGGG + Intergenic
1121362500 14:93274439-93274461 GTTCACTCCCTTGCATCTCATGG - Intronic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1123952210 15:25291250-25291272 ATAAACAACATTACACCTCAAGG + Intergenic
1124450219 15:29781636-29781658 TGAACCAACCTTGCATCCCAGGG - Intronic
1124669900 15:31629413-31629435 TTAACCAGCCTTGCATCCCAGGG + Intronic
1124717520 15:32078972-32078994 TGAACCAACCTTGCATCCCAGGG - Intronic
1124923885 15:34052168-34052190 TGAACCAACCTTGCATCCCAGGG - Intronic
1125054025 15:35336766-35336788 TGAAACAGCCTTGCATCCCAGGG + Intronic
1125393127 15:39216985-39217007 TGAATCAACCTTGCATCCCAGGG - Intergenic
1126224181 15:46250997-46251019 TAAAACAATCTTGCATTTCAGGG - Intergenic
1126233799 15:46358168-46358190 TGAACCAACCTTGCATCCCAGGG - Intergenic
1126272161 15:46832599-46832621 TGAACCAGCCTTGCATCTCAGGG - Intergenic
1126505801 15:49403099-49403121 TGAACCAACCTTGCATCCCAGGG + Intronic
1126956603 15:53939658-53939680 TGAACCAACCTTGCATCCCAGGG - Intergenic
1126988890 15:54347313-54347335 GTAAACAAGTTTTGATCTCAGGG - Intronic
1127013117 15:54651610-54651632 TGAACCATCCTTGCATCTCAAGG - Intergenic
1127097082 15:55523253-55523275 TGAACCAACCTTGCATCCCAGGG + Intergenic
1127189817 15:56517470-56517492 TGAACCAACCTTGCATCCCAGGG - Intergenic
1127491424 15:59468029-59468051 TGAACCAACCTTGCATCCCAGGG + Intronic
1127645268 15:60952111-60952133 TGAACCAACCTTGCATCCCAGGG - Intronic
1127740547 15:61899933-61899955 TTAACCAGCCTTGCATCCCAGGG - Intronic
1128857652 15:71032682-71032704 TGAACCAACCTTGCATCCCAGGG - Intronic
1129049584 15:72769189-72769211 TAAACCAACCTTGCATCTCTAGG - Intronic
1129967231 15:79747411-79747433 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1131319489 15:91372963-91372985 TGAACCAACCTTGCATCCCAAGG - Intergenic
1131343403 15:91624249-91624271 GCAAACAACCGGGTATCTCATGG - Intergenic
1133692078 16:8225551-8225573 TGAACCAACCTTGCATCCCAGGG - Intergenic
1136674379 16:31888636-31888658 TAAAACATTCTTGCATCTCAGGG + Intronic
1136677865 16:31929805-31929827 TGAACCAACCTTGCATCCCAAGG - Intergenic
1136681440 16:31966818-31966840 TGAAACAGCCTTGCATCCCAGGG - Intergenic
1136781750 16:32908329-32908351 TGAAACAGCCTTGCATCCCAGGG - Intergenic
1136888043 16:33945524-33945546 TGAAACAGCCTTGCATCCCAGGG + Intergenic
1137226993 16:46522987-46523009 TGAACCATCCTTGCATCTCAGGG + Intergenic
1138259881 16:55610085-55610107 TGAACCAACCTTGCATCCCAGGG + Intergenic
1138603299 16:58070759-58070781 GTGACCAGCCTTGCATCTGAGGG - Intergenic
1138837470 16:60456309-60456331 TGAAACAGCCTTGCATCCCAGGG + Intergenic
1138976158 16:62210774-62210796 TGAACCAACCTTGCATCCCAGGG + Intergenic
1139186872 16:64816727-64816749 TGAACCAACCTTGCATCCCAGGG + Intergenic
1139376305 16:66499772-66499794 TGAACCAACCTTGCATCCCAGGG - Intronic
1140669743 16:77266063-77266085 TGAACCAACCTTGCATCCCAGGG + Intronic
1140983831 16:80138641-80138663 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1203084406 16_KI270728v1_random:1172314-1172336 TGAAACAGCCTTGCATCCCAGGG - Intergenic
1142894672 17:2966084-2966106 GTGAACATCAGTGCATCTCAGGG - Intronic
1143246642 17:5491987-5492009 TAAAACAACCTTGCATTCCAGGG - Intergenic
1143428334 17:6859141-6859163 TGAACCAACCTTGCATCCCATGG + Intergenic
1143445414 17:7006331-7006353 CTAAACACACTAGCATCTCATGG - Intronic
1143821094 17:9563912-9563934 TGAACCAACCTTGCATCCCAGGG - Intronic
1143839928 17:9723971-9723993 ATCAACAAACTTGCATCTCAAGG - Intronic
1144231640 17:13211213-13211235 TGAACCAACCTTGCATCCCAGGG + Intergenic
1146093335 17:29904322-29904344 TGAACCAACCTTGCATCCCAGGG - Intronic
1146145157 17:30409177-30409199 TGAAACAGCCTTGCATCCCAGGG + Intronic
1146237438 17:31180415-31180437 GAAACCAGCCTTGCATCCCAGGG - Intronic
1146613974 17:34336744-34336766 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1147461386 17:40572404-40572426 TGAACCAACCTTGCATCCCAGGG - Intergenic
1147967969 17:44204130-44204152 GTAGACACCCTTGCATCCCCTGG - Intergenic
1149114501 17:53076086-53076108 TGAACCAACCTTGCATCCCAGGG + Intergenic
1149131726 17:53310277-53310299 TGAACCAACCTTGCATCCCAGGG - Intergenic
1149969365 17:61201239-61201261 GTAATCATACTTCCATCTCATGG + Intronic
1153057514 18:961559-961581 TGAAACAACCTTGAATATCATGG - Intergenic
1153064587 18:1031629-1031651 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1153421551 18:4912257-4912279 TGAACCATCCTTGCATCTCAGGG - Intergenic
1153454528 18:5265495-5265517 TGAACCAACCTTGCATCCCAGGG - Intergenic
1153958371 18:10118442-10118464 TGAAACATCCTTGCATCCCAAGG + Intergenic
1154019832 18:10653778-10653800 TGAACCAGCCTTGCATCTCAGGG - Intergenic
1154178754 18:12110932-12110954 TGAAACAACCTTGCATCACAGGG - Intronic
1155463501 18:26109998-26110020 TGAACCAACCTTGCATCCCAGGG + Intergenic
1155723639 18:29051215-29051237 TGAATCAACCTTGCATCCCAGGG + Intergenic
1155779683 18:29815241-29815263 TGAACCAACCTTGCATCACAGGG - Intergenic
1155810318 18:30225080-30225102 TGAAACATCCTTGCATCCCAGGG + Intergenic
1156113917 18:33762966-33762988 TTAAACAGACTTGAATCTCAGGG + Intergenic
1156151077 18:34243623-34243645 TGAACCAACCTTGCATTTCAGGG + Intergenic
1156562043 18:38136270-38136292 TGAACCAACCTTGCATCCCAGGG - Intergenic
1156695198 18:39757483-39757505 TGAAGCAACCTTGCATCCCAGGG - Intergenic
1156790151 18:40962776-40962798 TGAAACAACCTTGCATCCCAGGG - Intergenic
1156978995 18:43262881-43262903 TGAACCAACCTTGCATCCCAGGG + Intergenic
1157025632 18:43839294-43839316 TGAACCAACCTTGCATCCCAGGG - Intergenic
1157038232 18:44003607-44003629 TGAAACATCCTTGTATCTCAGGG - Intergenic
1157205855 18:45698269-45698291 TGAACCAACCTTGCATCCCAGGG - Intergenic
1157206146 18:45701583-45701605 TGAACCAAACTTGCATCTCAGGG - Intergenic
1157694755 18:49712801-49712823 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1159231762 18:65617180-65617202 TGAAACAACATTGCATCCCAGGG + Intergenic
1159290408 18:66411473-66411495 TAAACCAACCTTGCATCCCAGGG + Intergenic
1159359057 18:67377824-67377846 TGAACCAACCTTGCATCCCAGGG + Intergenic
1159632623 18:70766480-70766502 TGAAACAGCCTTGCATCCCAGGG - Intergenic
1159806975 18:72968849-72968871 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1162610891 19:11750877-11750899 CAAACCAACCTTGCATCCCAAGG + Intergenic
1163264630 19:16211919-16211941 TGAACCAACCTTGCATCCCAGGG + Intronic
1163990222 19:20992018-20992040 TGAACCAGCCTTGCATCTCAGGG - Intergenic
1164077221 19:21830923-21830945 TGAAATAACCTTGCATCCCAGGG - Intronic
1164124218 19:22295946-22295968 TGAACCAACCTTGCATCTCAGGG + Intronic
1164232084 19:23298613-23298635 TGAACCAACCTTGCATCCCATGG + Intergenic
1164866140 19:31605937-31605959 GTGAAGAACCTTGAATGTCAGGG + Intergenic
1165932473 19:39368841-39368863 GTAAGCTACCTTGAACCTCATGG - Intronic
1166154342 19:40899697-40899719 GAACACAACCTTGAAACTCATGG + Intergenic
1166173770 19:41050884-41050906 GAACACAACCTTGAAACTCATGG - Intergenic
1166263548 19:41660917-41660939 TGAAACAGCCTTGCATCCCAGGG - Intronic
1166899475 19:46048089-46048111 TGAACCAACCTTGCATCCCAGGG - Intronic
1167954483 19:53053375-53053397 TGAACCAACCTTGCATGTCAGGG + Intergenic
925071342 2:970181-970203 TGAACCAACCTTGCATCCCAGGG + Intronic
925078907 2:1044710-1044732 TGAACCAACCTTGCATCCCAGGG + Intronic
925441400 2:3889630-3889652 TGAACCAACCTTGCATCCCAGGG + Intergenic
925630925 2:5892440-5892462 TGAACCAGCCTTGCATCTCAGGG + Intergenic
925649231 2:6071469-6071491 ATATACAACAATGCATCTCACGG - Intergenic
926557088 2:14371132-14371154 TCAACCAACCTTGCATCCCAGGG - Intergenic
926618743 2:15026580-15026602 TGAACCAACCTTGCATCCCAGGG + Intergenic
926854439 2:17238582-17238604 GAAACTAACCTTGCACCTCAGGG + Intergenic
926943626 2:18164533-18164555 TTAACCAGCCTTGCATCCCAGGG + Intronic
927028269 2:19093069-19093091 TGAACCAGCCTTGCATCTCAGGG - Intergenic
928041266 2:27880094-27880116 CAAACCAACCTTGCATCCCAGGG - Intronic
928728962 2:34208685-34208707 TGAACCAACCTTGCATCCCAGGG - Intergenic
928763138 2:34608303-34608325 TGAACCATCCTTGCATCTCAGGG + Intergenic
928900396 2:36311655-36311677 TGAAGCAGCCTTGCATCTCAGGG - Intergenic
929382673 2:41370693-41370715 GGAACCAACCTTGTATCCCAGGG - Intergenic
930423999 2:51190536-51190558 TCAACCAACCTTGCATCCCAGGG + Intergenic
930592328 2:53342830-53342852 TGAACCAACCTTGCATCCCAGGG + Intergenic
930916254 2:56692413-56692435 TAAACCAACCTTGCATCCCAGGG + Intergenic
930918853 2:56726362-56726384 TGAACCAACCTTGCATCCCAGGG - Intergenic
931306937 2:61038426-61038448 TGAACCAGCCTTGCATCTCAAGG - Intronic
931538873 2:63306562-63306584 GGAACCAGCCTTGCATCCCAGGG - Intronic
931546248 2:63391212-63391234 TTAATCAGCCTTGCATCCCAGGG - Intronic
931549641 2:63428406-63428428 TGAACCAACCTTGCATCCCAGGG - Intronic
931887119 2:66629405-66629427 TGAAACAGCCTTGCATCCCACGG + Intergenic
932051220 2:68400053-68400075 TGAACCAGCCTTGCATCTCAGGG + Intergenic
932975269 2:76592351-76592373 TGAACCAACCTTGCATCCCAGGG - Intergenic
933052387 2:77615765-77615787 CGAAACAACCTTGTATCCCAGGG - Intergenic
933118524 2:78504561-78504583 TGAACCAACCTTGCATCCCAGGG - Intergenic
933129844 2:78658634-78658656 TGAACCAACCTTGCATCCCAGGG - Intergenic
933305815 2:80597027-80597049 TGAACCAACCTTGCATCCCAGGG + Intronic
933365585 2:81349427-81349449 TGAAATAACCTTGCATCCCAGGG - Intergenic
933568556 2:83980203-83980225 TGAAACAGCCTTGCATCCCAGGG - Intergenic
933604352 2:84366157-84366179 TGAACCAACCTTGCATCTCAGGG - Intergenic
933619601 2:84522785-84522807 TGAAACAAACTTGCATCTCAGGG + Intronic
934250753 2:90352664-90352686 GGAACCAGCCTTGCATCCCAGGG + Intergenic
934258812 2:91450746-91450768 GGAACCAGCCTTGCATCCCAGGG - Intergenic
934485470 2:94705042-94705064 TGAACCAACCTTGCATCTCTGGG + Intergenic
934620531 2:95800869-95800891 TGAACCAACCTTGCATCCCAGGG + Intergenic
934812909 2:97298861-97298883 TGAACCAACCTTGCATCCCAGGG - Intergenic
934824786 2:97409619-97409641 TGAACCAACCTTGCATCCCAGGG + Intergenic
934996288 2:98963995-98964017 ATAACCAACCTTGCATCCCAGGG + Intergenic
935004095 2:99053432-99053454 TGAACCATCCTTGCATCTCAGGG - Intronic
935378843 2:102429020-102429042 TGAAACATCCTTGCATCCCAGGG + Intronic
935532947 2:104257486-104257508 GAAACCATCCTTGCATCCCAGGG - Intergenic
935711101 2:105899419-105899441 TGAACCAACCTTGCATCCCAGGG + Intergenic
935834993 2:107040841-107040863 TGAACCAACCTTGCATCCCAGGG - Intergenic
936405056 2:112195514-112195536 GTAAATTACCTTGCCACTCAGGG - Intergenic
936691463 2:114894315-114894337 GTAAGCAACCTTGTCTCTGAAGG - Intronic
936825134 2:116572801-116572823 TAAAACAGCCTTGCATTTCAGGG - Intergenic
936862630 2:117035738-117035760 TGAACCAACCTTGCATCCCAGGG - Intergenic
936879961 2:117238078-117238100 TGTAACAACCTTGCATCCCAGGG - Intergenic
937196146 2:120158409-120158431 TGAACCAACCTTGCATCCCAGGG - Intronic
937248381 2:120508763-120508785 GAAAACAGCCTTGCAGCTCGGGG - Intergenic
937397559 2:121551040-121551062 TGAACCAACCTTGCATCCCAGGG - Intronic
937728126 2:125191441-125191463 TGAAACAACCTTGCATCCCGGGG + Intergenic
937807641 2:126164592-126164614 TGAAACAGCCTTGCATCCCAGGG - Intergenic
937931915 2:127212487-127212509 TAAAACAGCCTTGCATCCCAGGG - Intronic
938507270 2:131899489-131899511 TGAACCAACTTTGCATCTCAGGG - Intergenic
938567512 2:132532666-132532688 TGAAACAGCCTTGCATCCCAGGG - Intronic
938567763 2:132535385-132535407 TGAACCAGCCTTGCATCTCAGGG + Intronic
938864750 2:135406642-135406664 TGAACCAACCTTGCATCCCAGGG - Intronic
938865524 2:135415778-135415800 TGAACCAACCTTGCATCCCAGGG - Intronic
939020102 2:136948373-136948395 GTAGACAAACTTGACTCTCATGG + Intronic
939089392 2:137760962-137760984 GGAACCAACCTTGCATTCCAAGG - Intergenic
939193055 2:138939222-138939244 GGAACCAGCCTTGCATCCCAGGG + Intergenic
939731168 2:145786187-145786209 TTAAGCAGCCTTGCATCCCAAGG - Intergenic
939759181 2:146153144-146153166 TTAACCAGCCTTGCATCCCAGGG - Intergenic
939947997 2:148433670-148433692 GGAACCAACCTTGCATCCCAGGG + Intronic
940447244 2:153790253-153790275 TGAACCAACCTTGCATCCCAGGG - Intergenic
940573348 2:155468941-155468963 TGAAGCAGCCTTGCATCTCAGGG + Intergenic
940695710 2:156975282-156975304 TGAACCATCCTTGCATCTCAGGG + Intergenic
940996157 2:160152269-160152291 TGAACCAGCCTTGCATCTCAGGG - Intronic
941119373 2:161511375-161511397 TGAACCAACCTTGCATCCCAGGG - Intronic
941162789 2:162054123-162054145 GTAAACAACATTACATCTTGAGG - Intronic
941236883 2:162986090-162986112 TGAACCAGCCTTGCATCTCAGGG - Intergenic
941392415 2:164930576-164930598 TGAACCAACCTTGCATCCCAGGG - Intronic
941782141 2:169456584-169456606 TGAACCAACCTTGCATCCCAGGG - Intergenic
942402728 2:175620857-175620879 GTATGTCACCTTGCATCTCATGG - Intergenic
942876519 2:180806266-180806288 TAAACCAACCTTGCATCCCAGGG + Intergenic
942952377 2:181735487-181735509 TGAAACAGCCTTGCATCCCAGGG - Intergenic
943152762 2:184135113-184135135 TTAACCAACCTCGCATCCCACGG + Intergenic
943162003 2:184266359-184266381 TAAACCAACCTTGCATCCCAGGG - Intergenic
943205006 2:184883621-184883643 TGAACCAACCTTGCATCCCAGGG - Intronic
943375132 2:187067206-187067228 TGAATCAACCTTGCATCCCAGGG + Intergenic
943461583 2:188175430-188175452 GTAAAGAACTTTGCATTTCCAGG + Intergenic
943519070 2:188925018-188925040 TAAACCATCCTTGCATCTCAGGG + Intergenic
943679140 2:190749437-190749459 TGAACCAACCTTGCATCCCAGGG - Intergenic
943987597 2:194642598-194642620 TGAACCAACCTTGCATCCCAGGG - Intergenic
944077412 2:195747656-195747678 GGAACCAGCCTTGCATCCCAGGG - Intronic
944163406 2:196691024-196691046 TTGAACTACCTTGCATCCCAGGG + Intronic
944471637 2:200059473-200059495 TGAACCAACCTTGCATCTCAGGG - Intergenic
944627622 2:201588314-201588336 CAAACCAACCTTGCATCCCAAGG - Intronic
945015997 2:205517085-205517107 CGAATCAACCTTGCATCTCAAGG + Intronic
945463689 2:210141869-210141891 GGAACCATCCTTGCATCCCAGGG + Intronic
945823038 2:214687460-214687482 TGAACCAGCCTTGCATCTCAGGG - Intergenic
946205557 2:218104873-218104895 TGAACCAGCCTTGCATCTCAGGG + Intergenic
946478725 2:220033545-220033567 GAAGACAACTTTCCATCTCAGGG + Intergenic
946887242 2:224233914-224233936 CGAACCAACCTTGCATCCCAGGG + Intergenic
947301570 2:228693586-228693608 TGAACCAACCTTGCATCCCAGGG + Intergenic
947673502 2:231958025-231958047 GCAAACAACCAAGCAACTCAGGG - Intergenic
947975073 2:234358256-234358278 GTAAGTAAACTTGCATCACAGGG + Intergenic
948023484 2:234757026-234757048 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1169862021 20:10162881-10162903 TGAACCAGCCTTGCATCTCAGGG - Intergenic
1170011804 20:11731858-11731880 TGAACCAACCTTGCATCCCAAGG - Intergenic
1170498465 20:16950017-16950039 GTAAACAAGTGTCCATCTCAAGG + Intergenic
1171082184 20:22197935-22197957 TCAAACAGCCTTGCATCCCAGGG - Intergenic
1171362195 20:24595331-24595353 TGAACCAACCTTGCATCCCAGGG + Intronic
1171466674 20:25333628-25333650 TGAACCAACCTTGCATCCCAGGG - Intronic
1171514259 20:25715974-25715996 TGAACCAACCTTGCATCCCAGGG + Intergenic
1171515335 20:25727696-25727718 TGAACCAACCTTGCATCCCAGGG + Intergenic
1171577197 20:26342643-26342665 TGAACCAGCCTTGCATCTCAGGG - Intergenic
1171722173 20:28574145-28574167 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1171733499 20:28740150-28740172 TGAAACAGCCTTGCATCCCAGGG - Intergenic
1171755913 20:29109364-29109386 TGAACCAGCCTTGCATCTCAGGG - Intergenic
1171776387 20:29372238-29372260 GTAAACCAGCTTGCATCCCCTGG + Intergenic
1171825809 20:29903096-29903118 GGAACCAGCCTTGCATCCCATGG + Intergenic
1171835745 20:30143156-30143178 GGAACCAGCCTTGCATCCCATGG + Intergenic
1171861894 20:30408445-30408467 TGAACCAGCCTTGCATCTCAGGG - Intergenic
1171898392 20:30832654-30832676 TTAACCAGCCTTGCATCCCAGGG + Intergenic
1171900579 20:30852545-30852567 GTAAACCAGCTTGCATCCCCTGG - Intergenic
1173412122 20:42821232-42821254 TGAACCAGCCTTGCATCTCAGGG - Intronic
1173700406 20:45065269-45065291 TGAACCAATCTTGCATCTCAGGG + Intronic
1175434614 20:58935203-58935225 GGAATCATCCTTGCATCCCAAGG - Intergenic
1176237114 20:64058492-64058514 GAAGACCACCTGGCATCTCATGG + Intronic
1176319355 21:5294712-5294734 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1176345582 21:5742797-5742819 TGAACCAACCTTGCATCCCAGGG + Intergenic
1176352396 21:5863381-5863403 TGAACCAACCTTGCATCCCAGGG + Intergenic
1176499245 21:7581658-7581680 TGAACCAACCTTGCATCCCAGGG - Intergenic
1176539903 21:8140867-8140889 TGAACCAACCTTGCATCCCAGGG + Intergenic
1176558854 21:8323912-8323934 TGAACCAACCTTGCATCCCAGGG + Intergenic
1176699525 21:10027087-10027109 GAGAACAATCTTGCATCTCAGGG + Intergenic
1176786359 21:13260838-13260860 TGAACCAACTTTGCATCTCAGGG + Intergenic
1176865148 21:14046247-14046269 TAAAACAATCTTGCATTTCAGGG - Intergenic
1176881480 21:14199923-14199945 TGAACCAACCTTCCATCTCAGGG - Intronic
1176892138 21:14330987-14331009 TGAACCAGCCTTGCATCTCAGGG - Intergenic
1176930473 21:14803898-14803920 TGAACCAGCCTTGCATCTCAGGG - Intergenic
1176987274 21:15452152-15452174 TTAACCAGCCTTGCATCCCAGGG + Intergenic
1176995098 21:15545534-15545556 TGAACCATCCTTGCATCTCAGGG - Intergenic
1177088334 21:16734796-16734818 TTAAACAGCCTTGCATTCCAGGG - Intergenic
1177092249 21:16783602-16783624 TTAAAGAGCCTTGCATCCCAGGG - Intergenic
1177117948 21:17108306-17108328 TGAACCAACCTTGCATCCCAGGG - Intergenic
1177414581 21:20777346-20777368 GGAAAAAAACTTGCATCTGAGGG - Intergenic
1177573530 21:22921520-22921542 TGAAACAGCCTTGCATCCCAGGG - Intergenic
1177575919 21:22956171-22956193 TGAACCAACCTTGCATCCCAGGG - Intergenic
1177706335 21:24710483-24710505 GAAACCAACCTTGCATCCCAGGG - Intergenic
1177876777 21:26643294-26643316 GGAATCAACCTTGCATCCCAGGG + Intergenic
1177878579 21:26665863-26665885 TGAAACAGCTTTGCATCTCAGGG + Intergenic
1178046556 21:28700969-28700991 TGAACCAACCTTGCATCCCAGGG - Intergenic
1179378469 21:40875425-40875447 CTAAACAACCTTGCATTCCTAGG - Intergenic
1179818580 21:43923423-43923445 GGAAACATCCACGCATCTCACGG - Intronic
1180019984 21:45117127-45117149 GTAGACAGCCTTGCATTTCCTGG + Intronic
1180321103 22:11322216-11322238 GTAAACCAGCTTGCATCCCCTGG + Intergenic
1180333940 22:11558529-11558551 GTAAACCAGCTTGCATCCCCTGG - Intergenic
1180370731 22:12033681-12033703 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1180397978 22:12375755-12375777 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1180412958 22:12633230-12633252 TGAACCAGCCTTGCATCTCAGGG - Intergenic
1180454218 22:15498113-15498135 TGAACCAACCTTGCATCCCAGGG - Intergenic
1182195362 22:28510339-28510361 TGAACCAACCTTGCATCCCAGGG - Intronic
1182938589 22:34251789-34251811 TGAACCAACCTTGCATCCCAGGG + Intergenic
1182986085 22:34718319-34718341 TGAACCAACCTTGCATCCCAGGG - Intergenic
1183190053 22:36316431-36316453 GTTAAGAACCCTGCTTCTCATGG - Intronic
1184234464 22:43175514-43175536 GTTACCAACCTTGCATGTCATGG - Intronic
1184881972 22:47312214-47312236 TAAAACAACCTTGCATTTCTGGG + Intergenic
1185077775 22:48692385-48692407 GTAAACAAAATTGCCTCTAATGG - Intronic
1203244854 22_KI270733v1_random:57222-57244 TGAACCAACCTTGCATCCCAGGG + Intergenic
949298029 3:2549519-2549541 TGAACCAACCTTGCATCCCAAGG + Intronic
949376546 3:3396789-3396811 TGAACCAACCTTGCATCCCAGGG + Intergenic
949633766 3:5959653-5959675 TAAACCATCCTTGCATCTCAGGG + Intergenic
950947874 3:16969062-16969084 TGAACCAACCTTGCATCTCAGGG + Intronic
951296935 3:20948948-20948970 TCAACCAACCTTGCATCACACGG + Intergenic
951311257 3:21128699-21128721 GCAACCAGCCTTGCATCCCAGGG - Intergenic
951676096 3:25243629-25243651 TGAAACAGCCTTGCATCCCATGG + Intronic
951798095 3:26564568-26564590 TTAAATAAACTTCCATCTCAAGG + Intergenic
951828677 3:26899252-26899274 GGAACCAGCCTTGCATCCCAGGG + Intergenic
952605555 3:35143220-35143242 TGAACCAACCTTGCATCTCAGGG - Intergenic
952937260 3:38409207-38409229 TGAACCAGCCTTGCATCTCAGGG - Intronic
953079729 3:39604968-39604990 TGAACCAACCTTGCATCCCAGGG + Intergenic
953224593 3:41005951-41005973 GGAGACATCCTTGCATCTCAGGG + Intergenic
953266074 3:41389692-41389714 TGAACCAGCCTTGCATCTCAGGG + Intronic
953269595 3:41427591-41427613 GGAACCAGCCTTGCATCCCAGGG - Intronic
953433758 3:42861685-42861707 TGAACCAACCTTGCATCCCAGGG - Intronic
953543919 3:43847360-43847382 TGAACCAGCCTTGCATCTCAGGG - Intergenic
953816216 3:46159627-46159649 TGAACCAACCTTGCATCTCAGGG + Intergenic
954490854 3:50903486-50903508 TTAACCAGCCTTGCATCCCAAGG + Intronic
954563201 3:51576167-51576189 TTGAACAGCCTTGCATCCCAGGG + Intronic
954724099 3:52592483-52592505 TGAACCAACCTTGCATCCCAGGG + Intronic
955140478 3:56263973-56263995 TAAATCAACCTTGCATCCCAGGG - Intronic
955622309 3:60877658-60877680 TTAAACAACTGTGCATCCCAGGG + Intronic
956126827 3:66018581-66018603 GTAAACTATCTTGCCTCACATGG + Intronic
956156985 3:66308855-66308877 TGAACCAACCTTGCATCCCAGGG + Intronic
956386140 3:68721716-68721738 TGAACCAACCTTGCATCCCAGGG + Intergenic
956644291 3:71441164-71441186 GTAAATAACTTTGCAAATCATGG + Intronic
956881313 3:73513525-73513547 GTTAACAAGTTTGCTTCTCAGGG - Intronic
956959374 3:74380472-74380494 ATAAAGAAGCTTACATCTCATGG + Intronic
957088704 3:75707425-75707447 GTAAACTAGCTTGCATCCCCTGG - Intergenic
957107780 3:75912638-75912660 GTAAGCAACCGTGTATCTGATGG - Intronic
957429226 3:80080037-80080059 GTAAACAAGCTTGGACCACATGG + Intergenic
957871639 3:86096763-86096785 TGAACCAGCCTTGCATCTCAGGG - Intergenic
957967664 3:87342846-87342868 TGAACCAACCTTGCATCGCAGGG + Intergenic
958081434 3:88750758-88750780 TGAACCAGCCTTGCATCTCAGGG - Intergenic
958173079 3:89961509-89961531 TGAACCAACCTTGCATCCCAGGG - Intergenic
958179169 3:90035562-90035584 GAAAACAATCTCGCTTCTCATGG + Intergenic
958253279 3:91294937-91294959 TGAACCAGCCTTGCATCTCAGGG - Intergenic
958455773 3:94328864-94328886 CTGAATAACCTTGTATCTCAAGG + Intergenic
958577012 3:95963822-95963844 TAATACAACATTGCATCTCAGGG - Intergenic
958726009 3:97907066-97907088 TGAAACAGCCTTGCATCCCAGGG + Intronic
958886721 3:99735471-99735493 TGAACCAGCCTTGCATCTCAGGG + Intronic
959044005 3:101451535-101451557 TGAATCAGCCTTGCATCTCAGGG - Intronic
959221027 3:103520079-103520101 TGAAGCAAACTTGCATCTCAGGG - Intergenic
959295999 3:104534789-104534811 TGAACCAACCTTGCATCCCATGG - Intergenic
959870156 3:111317818-111317840 TGAACCAACCTTGCATCCCAAGG - Intronic
960018304 3:112918183-112918205 TGAACCAACCTTGCATCCCAGGG - Intergenic
960212766 3:114990423-114990445 TGAACCAGCCTTGCATCTCAGGG + Intronic
960276879 3:115738698-115738720 TGAACCAGCCTTGCATCTCAGGG + Intergenic
960466954 3:118007980-118008002 TGAACCAGCCTTGCATCTCAGGG + Intergenic
960679752 3:120235322-120235344 TGAACCAACCTTGAATCTCAGGG + Intronic
961063349 3:123852065-123852087 TGAACCAGCCTTGCATCTCAGGG + Intronic
961417462 3:126770646-126770668 TGAACCAACCTTGCATCCCAGGG + Intronic
961546166 3:127635076-127635098 GTAGACAACCATGCCACTCAGGG - Intronic
962183585 3:133234421-133234443 TGAAACAGCCTTGCATCCCAGGG - Intronic
962592100 3:136901220-136901242 GTAACCATCCTTGCCTCTCTGGG + Intronic
962638499 3:137357473-137357495 TGAAACATCCTTGCACCTCAGGG + Intergenic
962639798 3:137373622-137373644 TGAACCAGCCTTGCATCTCAGGG + Intergenic
962907716 3:139820238-139820260 TGAAACAGCCTTGCATCCCAGGG - Intergenic
963592024 3:147272097-147272119 TGAACCATCCTTGCATCTCAGGG - Intergenic
963614951 3:147524998-147525020 TAAACCAACCTTGCATCCCAGGG + Intergenic
963616053 3:147539529-147539551 TGAACCAACCTTGCATCCCAGGG + Intergenic
963632345 3:147749018-147749040 TGAACCAACCTTGCATCCCAGGG + Intergenic
963695440 3:148561234-148561256 TGAACCAACCTTGCATCCCAGGG + Intergenic
963913553 3:150836743-150836765 TGAACCAACCTTGCATCCCAGGG + Intergenic
963979607 3:151522511-151522533 TGAACCAACCTTGCATCCCAGGG - Intergenic
964061773 3:152533419-152533441 CAAACCAACCTTGCATCTCAGGG + Intergenic
964202602 3:154134899-154134921 TGAACCAACCTTGCATCCCATGG + Intronic
964296198 3:155236364-155236386 TGAACCAACCTTGCATCCCAGGG + Intergenic
964375785 3:156047708-156047730 TGAACTAACCTTGCATCTCAGGG + Intronic
964462879 3:156955665-156955687 TTAACCAAGCTTGCATCCCAGGG + Intronic
964511516 3:157457687-157457709 TCAACCAACCTTGCATCCCAGGG + Intronic
964593451 3:158393976-158393998 TGAATCAACCTTGCATCCCAGGG - Intronic
964943371 3:162188866-162188888 TGAACCAACCTTGCATCCCAGGG + Intergenic
964961345 3:162431425-162431447 TGAACCATCCTTGCATCTCAGGG - Intergenic
965016503 3:163165298-163165320 GGAACCATCCTTGCATCCCAGGG + Intergenic
965161288 3:165136702-165136724 TGAACCAGCCTTGCATCTCAGGG + Intergenic
965318105 3:167215800-167215822 TGAAACAACATTGCATCCCAGGG - Intergenic
965380827 3:167985705-167985727 TGAAACATCCTTGCATCCCAGGG - Intergenic
965985289 3:174745762-174745784 TTAACCAGCCTTGCATCCCAGGG - Intronic
965997008 3:174895865-174895887 TGAACCATCCTTGCATCTCAGGG - Intronic
966073447 3:175906834-175906856 TGAACCAACCTTGCATCCCAGGG - Intergenic
966309770 3:178580193-178580215 TGAACCAACCTTGCATCCCAGGG - Intronic
966477900 3:180371182-180371204 TGAAACAGCCTTGCATCCCAGGG - Intergenic
966482572 3:180427489-180427511 TGAACCAGCCTTGCATCTCAGGG - Intergenic
966484492 3:180452282-180452304 TGAACCAGCCTTGCATCTCAGGG - Intergenic
966486042 3:180470959-180470981 TGAAACATCCTTGCATCCCAGGG - Intergenic
966713794 3:182995771-182995793 TGAACCAACCTTGCATCCCAGGG + Intergenic
967181132 3:186905832-186905854 TTAAACAGCCTCGCATCCCAGGG + Intergenic
967202994 3:187090765-187090787 TTTAACCACCTTGCATCTCAGGG + Intergenic
967255201 3:187584335-187584357 TGAACCAACCTTGCATCCCAGGG + Intergenic
968156355 3:196384621-196384643 TGAACCAACCTTGCATCCCAGGG - Intronic
968388511 4:168170-168192 TGAAACAGCCTTGCATCCCAGGG + Intergenic
968390054 4:184328-184350 TCAACCAACCTTGCATCCCAGGG + Intergenic
970248290 4:14087299-14087321 TGAACCAACCTTGCATCCCAGGG + Intergenic
970494661 4:16613023-16613045 TGAATCAGCCTTGCATCTCAGGG - Intronic
971080526 4:23205241-23205263 TGAACCAACCTTGCATCCCAGGG + Intergenic
971106341 4:23528215-23528237 TGAAACAACTTTGCATTTCAGGG - Intergenic
971107656 4:23544191-23544213 TGAACCAACCTTGCATCCCAGGG - Intergenic
971438298 4:26652033-26652055 TTAACCAGCCTTGCATCCCAGGG + Intronic
971575883 4:28274069-28274091 TTAACCAGCCTTGCATCCCAGGG + Intergenic
971708219 4:30076351-30076373 TGAACCAACCCTGCATCTCAGGG + Intergenic
971898767 4:32631537-32631559 GGAAGCAATCTTGTATCTCAGGG - Intergenic
971919049 4:32912724-32912746 TGAACCAACCTTGCATCCCAGGG - Intergenic
972146594 4:36034909-36034931 TGAACCAACCTTGCATCCCAAGG + Intronic
972269699 4:37499144-37499166 TGAACCAACCTTGCATCCCAGGG + Intronic
972417041 4:38851051-38851073 TGAAACAGCCTTGCATCCCAGGG - Intronic
972820702 4:42698610-42698632 TTGAACAGCCTTGCATCCCAGGG + Intergenic
972933159 4:44100289-44100311 TGAACAAACCTTGCATCTCAGGG + Intergenic
972970105 4:44564252-44564274 TGAACCAACCTTGCATCCCAGGG - Intergenic
973027374 4:45289742-45289764 TGAACCAACCTTGCATCCCAGGG + Intergenic
973078860 4:45964516-45964538 TGAAGCAACCTTGCATCCCAGGG + Intergenic
973094694 4:46181799-46181821 TGAATCAACCTTGCATCCCAGGG - Intergenic
973679491 4:53301772-53301794 TGAACCAACCTTGCATCCCAGGG - Intronic
973708906 4:53606777-53606799 TGAAGCAACCTTGCATCCCAGGG - Intronic
973873751 4:55193295-55193317 TGAACCAACCTTGCATCCCAGGG - Intergenic
973875090 4:55209603-55209625 TGAACCAACCTTGCATCCCAGGG - Intergenic
974119486 4:57621654-57621676 TGAACCAACCTTGCATCCCAGGG + Intergenic
974155476 4:58066534-58066556 TGAAACAACCTTGCATCCCAGGG - Intergenic
974497043 4:62644770-62644792 CGAACCAACCTTGCATATCAGGG + Intergenic
974562161 4:63536209-63536231 TGAACCAACCTTGCATCCCAGGG - Intergenic
974603502 4:64120300-64120322 TGAATCAACCTTGCATCCCAGGG + Intergenic
974727906 4:65819595-65819617 TTAACCAACCTCGCATCCCAGGG - Intergenic
974730462 4:65858059-65858081 TGAACCAACCTTGCATCTCAGGG + Intergenic
974769011 4:66386386-66386408 TGAACCAGCCTTGCATCTCAGGG - Intergenic
974983686 4:68992879-68992901 TGAACCAACCTTGCATCCCAGGG + Intergenic
975035398 4:69674153-69674175 CGAACCATCCTTGCATCTCAGGG - Intergenic
975212601 4:71718750-71718772 GGAACCAGCCTTGCATCCCAGGG + Intergenic
975403072 4:73959768-73959790 TGAACCAACCTTGCATCCCAGGG + Intergenic
975501811 4:75094916-75094938 CTAACCATCCTTGCATCTCAGGG + Intergenic
975630115 4:76392293-76392315 TTAACCATCCTTGCATCCCAGGG - Intronic
975821299 4:78273634-78273656 TGAACCAACCTTGCATCCCAGGG + Intronic
975843684 4:78503035-78503057 TGAACCAACCTTGCATCCCAGGG + Intronic
975896756 4:79102187-79102209 TTAACCAACCTTGCATCCCAGGG + Intergenic
975977841 4:80119386-80119408 TGAACCAACCTTGCATCCCAGGG - Intronic
975998635 4:80344812-80344834 TGAACCAACCTTGCATCCCAAGG - Intronic
976481452 4:85551348-85551370 TGAACCAACCTTGCATCCCAGGG + Intronic
976533971 4:86190067-86190089 TGAAACACCCTTGCATCCCAGGG + Intronic
976793127 4:88902428-88902450 TGAACCAACCTTGCATCCCAGGG - Intronic
976833533 4:89343615-89343637 TGAAACATCCTTGCATCTCTGGG + Intergenic
976941016 4:90702292-90702314 TTAACCAGCCTTGCATCCCAGGG + Intronic
976948152 4:90795815-90795837 TGAACCAACCTTACATCTCATGG + Intronic
976975537 4:91162251-91162273 TGAAACAGCCTTGCATCCCAGGG + Intronic
977015552 4:91688690-91688712 TGAACCAACCTTGCATCCCAGGG + Intergenic
977127452 4:93187848-93187870 GCAAACAACATTAAATCTCAAGG + Intronic
977236514 4:94514042-94514064 TTAACCATCCTTGCATCCCAGGG + Intronic
977304644 4:95307791-95307813 TGAAACATCCTTGCATCCCAGGG - Intronic
977482623 4:97597554-97597576 TGAAACAACCTTGCATCCCAGGG - Intronic
977496914 4:97787447-97787469 TTAAACAACCTCACATTTCAGGG + Intronic
977511532 4:97968607-97968629 TGAACCAGCCTTGCATCTCAGGG - Intronic
977696857 4:99975349-99975371 CAAACCAACCTTGCATCCCAGGG - Intergenic
977713665 4:100156403-100156425 GAAACCAGCCTTGCATCCCAGGG + Intergenic
977735126 4:100405539-100405561 TGAATCAACCTTGCATCTCAGGG + Intronic
977752377 4:100624752-100624774 TGAACCAACCTTGCATCCCAGGG - Intronic
977920279 4:102635553-102635575 ATAAATAACCTTGCATTTAAGGG + Intronic
978139438 4:105300884-105300906 TTGAACAGCCTTGCATCCCAGGG - Intergenic
978590920 4:110324141-110324163 TGAACCAGCCTTGCATCTCAGGG + Intergenic
978709907 4:111767336-111767358 TAAACCAACCTTGCATCCCAGGG + Intergenic
978940100 4:114426061-114426083 TGAAACAGCCTTGCATCCCAGGG + Intergenic
978948370 4:114526282-114526304 TTAACCAGCCTTGCATCCCAGGG + Intergenic
979048597 4:115901319-115901341 TGAAACAGCCTTGCATCCCAGGG - Intergenic
979097306 4:116566868-116566890 TGAAACAGCCTTGCTTCTCAGGG - Intergenic
979148094 4:117272633-117272655 TGAACCAACCTTGCATCCCAGGG + Intergenic
979190912 4:117857443-117857465 TGAACCAACCTTGCATCCCAAGG + Intergenic
979529395 4:121752861-121752883 GGAACCAGCCTTGCATCCCAGGG - Intergenic
979628182 4:122870153-122870175 TGAAACAGCCTTGCATCCCAGGG + Intronic
979659900 4:123241453-123241475 TGAAACAGCCTTGCATCCCAGGG - Intronic
979953079 4:126919667-126919689 TGAAACAGCCTTGCATCCCAGGG - Intergenic
980039518 4:127923447-127923469 TGAACCAGCCTTGCATCTCAGGG + Intronic
980147806 4:129011238-129011260 TGAACCAACCTTGCATCCCAGGG + Intronic
980330057 4:131399932-131399954 TGAAACAACCTTGCATCCCAGGG + Intergenic
980413307 4:132451391-132451413 GGAACCATCCTTGCATCCCAGGG - Intergenic
980542387 4:134211586-134211608 TGAACCAACCTTGCATCCCAGGG - Intergenic
980747006 4:137031108-137031130 TGAACCAACCTTGCATTTCAGGG - Intergenic
981181217 4:141747738-141747760 TGAACCAACCTTGCATCCCAGGG - Intergenic
981453754 4:144929912-144929934 TGAAACAACCTTGCAACCCAGGG + Intergenic
981512219 4:145570196-145570218 TGAACCAACCTTGCATCTTAGGG - Intergenic
981669396 4:147270000-147270022 TGAAACATCCTTGCATCCCAGGG + Intergenic
981790632 4:148532765-148532787 TGAACCAACCTTGCATCTCAGGG + Intergenic
981861120 4:149357565-149357587 TGAACCAGCCTTGCATCTCAGGG + Intergenic
981885757 4:149670797-149670819 TGAACCAGCCTTGCATCTCAGGG + Intergenic
981958394 4:150506398-150506420 TGAACCAGCCTTGCATCTCAGGG - Intronic
982218219 4:153101007-153101029 TGAACCAACCTTGCATCCCAGGG - Intergenic
982393969 4:154895796-154895818 TGAACCAACCTTGCATCCCAGGG - Intergenic
982555325 4:156854521-156854543 GCAAACCTCCTTGCATTTCAAGG - Intronic
982632918 4:157855069-157855091 TGAACCAACCTTGCATCCCAGGG + Intergenic
982789058 4:159569640-159569662 TGAACCAACCTTGCATCCCATGG + Intergenic
982839380 4:160163661-160163683 TAAAACAACCTTGCACCCCAGGG + Intergenic
982888893 4:160821888-160821910 TGAAACAGCCTTGCATCCCAGGG - Intergenic
982928538 4:161370848-161370870 ATAACCAGCCTTGCATCTCGGGG - Intergenic
983010975 4:162546738-162546760 TGAACCAACCTTGCATCTTAGGG + Intergenic
983079576 4:163368646-163368668 TGAACCAGCCTTGCATCTCAGGG - Intergenic
983101933 4:163635915-163635937 TGAACCAACCTTGCATCCCAGGG - Intronic
983134587 4:164064970-164064992 TGAATCAACCTTGCATCCCAGGG + Intronic
983487439 4:168348801-168348823 TGAACCAACCTTGCATCCCAGGG + Intergenic
983673518 4:170265601-170265623 TGAACCAGCCTTGCATCTCAGGG + Intergenic
983740611 4:171127088-171127110 TGAATCATCCTTGCATCTCAGGG + Intergenic
983819991 4:172181289-172181311 TGAACCAACCTTGCATCCCAGGG - Intronic
984287568 4:177752033-177752055 TGAATCAACCTTGCATCCCACGG + Intronic
984335412 4:178383123-178383145 TGAACCAACCTTGCATCCCAGGG - Intergenic
984338842 4:178427551-178427573 TTAACCATCCTTGCATCCCAGGG - Intergenic
985363143 4:189197125-189197147 TGAACCAGCCTTGCATCTCAGGG + Intergenic
985441941 4:189988289-189988311 GTAAACCAGCTTGCATCCCCTGG + Intergenic
986097071 5:4568854-4568876 GGCAACAAACTTGCATCTGATGG - Intergenic
986356320 5:6930877-6930899 TGAACCAACCTTGCATCCCAGGG + Intergenic
986647962 5:9936901-9936923 GGAACCAGCCTTGCATCCCAGGG + Intergenic
986979503 5:13430803-13430825 TGAACCAAACTTGCATCTCAGGG + Intergenic
987055015 5:14183035-14183057 GTAGACAACAGTGCATCTCTAGG + Intronic
987351739 5:17028047-17028069 TGAACCAACCTTGCATCCCAGGG - Intergenic
987530919 5:19118311-19118333 TGAATCAACCTTGCATCTCAGGG - Intergenic
987553212 5:19410711-19410733 TGAACCAACCTTGCATCCCAGGG + Intergenic
987838331 5:23189834-23189856 TGAACCAGCCTTGCATCTCAGGG - Intergenic
987915154 5:24203224-24203246 TGAACCAACCTTGCATCCCAGGG - Intergenic
987997847 5:25309103-25309125 GGAACCAGCCTTGCATCTCAGGG + Intergenic
988195785 5:28003825-28003847 TGAAACACCCTTGCATCCCAGGG + Intergenic
988290157 5:29274102-29274124 CGAAACAGCCTTGCATCCCAGGG - Intergenic
988294331 5:29335410-29335432 TGAACCAACCTTGCATCCCATGG - Intergenic
988309404 5:29538478-29538500 TGAACCAGCCTTGCATCTCAGGG + Intergenic
988871926 5:35399899-35399921 TGAACCAACCTTGCATCCCAGGG - Intergenic
989143186 5:38222268-38222290 TGAACCAACCTTGCATCCCAGGG - Intergenic
989216706 5:38911733-38911755 TGACACAACCTTGCATCCCAGGG - Intronic
989418587 5:41209042-41209064 TTAAACAGACTTGCATCCCAGGG - Intronic
989455780 5:41642336-41642358 TGAACCAACCTTGCATCCCAGGG - Intergenic
989627182 5:43441183-43441205 TGAACCAGCCTTGCATCTCAGGG + Intergenic
989670666 5:43912796-43912818 TGAACCAGCCTTGCATCTCAGGG + Intergenic
989683890 5:44062210-44062232 TGAACCAGCCTTGCATCTCAGGG + Intergenic
989716039 5:44464634-44464656 TGAACCAACCTTGCATCACAGGG + Intergenic
989778549 5:45237417-45237439 TGAACCAACCTTGCATCCCAGGG + Intergenic
989860968 5:46375059-46375081 GGAACCATCCTTGCATCCCAGGG - Intergenic
989941798 5:50159805-50159827 TGAATCAGCCTTGCATCTCAGGG - Intergenic
989945543 5:50223135-50223157 GAAACCAGCCTTGCATCCCAGGG + Intergenic
989949799 5:50283895-50283917 TGAACCAACCTTGCATCTCAGGG - Intergenic
989953899 5:50333892-50333914 TGAACCAACCTTGCATCTCAGGG - Intergenic
989966117 5:50467612-50467634 TGAACCAGCCTTGCATCTCAGGG + Intergenic
990187789 5:53226526-53226548 TGAACCAACCTTGCATCCCAGGG + Intergenic
990659622 5:57998743-57998765 GGAACCAGCCTTGCATCCCAGGG - Intergenic
990782037 5:59375858-59375880 TGAACCAACCTTGCATCTCAAGG - Intronic
990898049 5:60720385-60720407 TAAACCAACCTTGCATCCCAGGG - Intergenic
991160960 5:63502219-63502241 TGAACCAACCTTGCATCCCAGGG + Intergenic
991532319 5:67629266-67629288 TAAACCAGCCTTGCATCTCAGGG + Intergenic
991571882 5:68063504-68063526 TGAACCAACCTTGCATCCCAGGG - Intergenic
991961856 5:72052768-72052790 TGAACCAGCCTTGCATCTCAGGG - Intergenic
992345617 5:75874225-75874247 TGAACCAACCTTGCATCCCAGGG - Intergenic
992757077 5:79917512-79917534 TGAACCAACCTTGCATCCCAGGG - Intergenic
993336134 5:86661331-86661353 GGAACCAAACTTGCATCCCAGGG + Intergenic
993455655 5:88124024-88124046 TTAACCAGCCTTGCATCCCAGGG - Intergenic
993634022 5:90322522-90322544 TGAACCAACCTTGCATCCCAAGG + Intergenic
993794753 5:92252894-92252916 TGAACCAACCTTGCATCTCAGGG - Intergenic
994016562 5:94973361-94973383 GTATACAATCTTGTCTCTCATGG - Intronic
994119639 5:96099645-96099667 TGAAACAAACTTGCATCCCAAGG + Intergenic
994224481 5:97236584-97236606 GGAACCAGCCTTGCATCCCAGGG + Intergenic
994452598 5:99961235-99961257 GGAACCAGCCTTGCATCCCAGGG + Intergenic
994897592 5:105725454-105725476 TGAAACAACCTTGCATCCCAGGG - Intergenic
995268123 5:110188498-110188520 TGAAACAGCCTTGCATCCCAGGG - Intergenic
995302547 5:110600978-110601000 TGAACCAGCCTTGCATCTCAGGG - Intronic
995329352 5:110929840-110929862 TTAACCAACCTTGCATCGTAGGG + Intergenic
995343595 5:111087203-111087225 GGAACCAGCCTTGCATCCCAGGG + Intergenic
995467202 5:112463060-112463082 TGAAACAGCCTTGCATCCCAGGG + Intergenic
995699360 5:114916986-114917008 TGAACCAACCTTGCATCCCAGGG + Intergenic
995961018 5:117839904-117839926 TGAACCAACCTTGCATCCCAGGG - Intergenic
996162648 5:120184529-120184551 TGAACCATCCTTGCATCTCAGGG - Intergenic
996426284 5:123316851-123316873 GGAACCAGCCTTGCATCCCAGGG + Intergenic
996427558 5:123331678-123331700 GGAACCAGCCTTGCATCCCAGGG + Intergenic
996751394 5:126892609-126892631 TGAACCAACCTTGCATCCCAGGG + Intronic
996910516 5:128652285-128652307 TGAAACAGCCTTGCATCCCAGGG + Intronic
997027822 5:130087038-130087060 TGAAACAGCCTTGCATCCCAGGG - Intronic
997245571 5:132345778-132345800 TGAAACAGCCTTGCATCCCAGGG + Intergenic
997789605 5:136745930-136745952 TGAATCATCCTTGCATCTCAGGG - Intergenic
997790318 5:136753650-136753672 TGAAACAGCCTTGCATCCCAGGG + Intergenic
997799899 5:136850030-136850052 TGAACCAGCCTTGCATCTCAGGG + Intergenic
998718123 5:144909344-144909366 TGAACCAACCTTGCATCCCAGGG - Intergenic
998774437 5:145583112-145583134 TGAAGCAACCTTGCATCCCAGGG - Intronic
998931322 5:147184575-147184597 TTAACCAGCCTTGCATCCCAGGG - Intergenic
999070849 5:148742115-148742137 TGAACCAACCTTGCATCCCAGGG - Intergenic
999567148 5:152877049-152877071 CGAACCAACCTTGCATCCCAGGG - Intergenic
999579281 5:153017532-153017554 ATAAACAACTTTACATCTCATGG + Intergenic
1000032110 5:157411244-157411266 TGAACCAACCTTGCATCCCAGGG - Intronic
1001190329 5:169624495-169624517 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1001839357 5:174861261-174861283 GGAACCAGCCTTGCATCCCAGGG + Intergenic
1002216238 5:177635881-177635903 TGAAACAGCCTTGCATCCCAGGG + Intergenic
1002233774 5:177788500-177788522 TGAAACAGCCTTGCATCCCAGGG + Intronic
1002582759 5:180219895-180219917 TGAACCAACCTTGCATCTCAGGG + Intergenic
1002850155 6:987365-987387 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1003437272 6:6102680-6102702 TGAACCAACCTTGCATCTAAGGG + Intergenic
1003807557 6:9742666-9742688 TGAACCAACCTTGCATCCCAGGG + Intronic
1003842391 6:10135464-10135486 TTAAACAACCTTGCATCCTTAGG - Intronic
1003902309 6:10666171-10666193 TGAAGCAACCTTGCATCCCAGGG + Intergenic
1003932432 6:10938231-10938253 GGAAACTTCCTTGAATCTCAGGG - Intronic
1004929796 6:20451878-20451900 TGAACCAACCTTGCATCCCAGGG + Intronic
1005170946 6:22984003-22984025 TGAACCAACCTTGCATCCCAGGG + Intergenic
1005208162 6:23428996-23429018 TTGAACCAGCTTGCATCTCAGGG + Intergenic
1005785502 6:29241300-29241322 TGAACCACCCTTGCATCTCAGGG + Intergenic
1006217270 6:32455085-32455107 TGAACTAACCTTGCATCTCAGGG - Intergenic
1006712536 6:36086966-36086988 TAAAACAGCCTTGCATCCCAGGG - Intronic
1007972841 6:46069893-46069915 TGAACCAACCTTGCATCCCAGGG - Intronic
1007988044 6:46227107-46227129 TGAACCAGCCTTGCATCTCAGGG + Intronic
1008173563 6:48238209-48238231 TGAAACAACCTTGCATCCCAAGG - Intergenic
1008193874 6:48494381-48494403 GGAACCAGCCTTGCATCCCAGGG - Intergenic
1008332105 6:50257811-50257833 TGAAACAACCTTGCATCCCAGGG + Intergenic
1008372460 6:50748967-50748989 AGAAACAATCTTACATCTCAAGG - Intronic
1008404394 6:51102514-51102536 TGAAACACCCTTGCATCCCAGGG + Intergenic
1008406623 6:51125247-51125269 TGAAACACCCTTGCATCCCAGGG - Intergenic
1008688417 6:53949601-53949623 TGAACCAACCTTGCATCCCAGGG - Intronic
1008865786 6:56207855-56207877 TGAATCAGCCTTGCATCTCAGGG - Intronic
1009307545 6:62109156-62109178 GTAAACAACTTTGCATTTCTAGG - Intronic
1009381890 6:63041841-63041863 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1009383042 6:63055885-63055907 TTGAACAGCCTTGCATCCCAGGG - Intergenic
1009476087 6:64094075-64094097 GGAACCAGCCTTGCATCCCAGGG + Intronic
1009511796 6:64561011-64561033 TGAACCAACCTTGCATCCCAGGG - Intronic
1009647484 6:66425297-66425319 TGAAACAGCCTTGCATCCCAGGG - Intergenic
1009745195 6:67804141-67804163 GAAACCATCCTTGCATCTCTGGG - Intergenic
1009822047 6:68814807-68814829 TGAAACAGCCTTGCATCCCAGGG - Intronic
1009946134 6:70343540-70343562 TTAATCACCCTTGCATCCCAGGG + Intergenic
1009959140 6:70497794-70497816 TGAACCAGCCTTGCATCTCAGGG + Intronic
1010019903 6:71147109-71147131 TGAACCAACCTTGCATTTCAAGG - Intergenic
1010125676 6:72428998-72429020 TTGAACCACCTTGCATCCCAGGG + Intergenic
1010286242 6:74081361-74081383 TGAAACAGCCTTGCATCCCAGGG + Intergenic
1010544078 6:77128210-77128232 TGAAACAACCTTGCATCCCAGGG - Intergenic
1010587490 6:77671407-77671429 GCAAACAACCTTGCAGTACAAGG - Intergenic
1010608369 6:77920320-77920342 TGAAACAGCCTTGCATCCCACGG - Intronic
1010620614 6:78069752-78069774 TGAACCAACCTTGCATCCCAGGG - Intergenic
1010648471 6:78422824-78422846 TGAGCCAACCTTGCATCTCAGGG - Intergenic
1010680830 6:78796979-78797001 TGAACCAACCTTGCATCACATGG + Intergenic
1010682678 6:78815247-78815269 CGAACCAACCTTGCATCCCAGGG - Intergenic
1010812100 6:80312750-80312772 TGAACCAACCTTGCATCCCACGG + Intronic
1010871537 6:81048228-81048250 TGAACCAACCTTGCATCCCAGGG + Intergenic
1010883439 6:81208534-81208556 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1011076038 6:83440095-83440117 TGAAACAGCCTTGCATCCCAGGG + Intergenic
1011086846 6:83550305-83550327 TGAACCAGCCTTGCATCTCAGGG - Intergenic
1011199508 6:84819891-84819913 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1011391882 6:86863181-86863203 TGAACCAACCTTGCATCCCAGGG - Intergenic
1011429679 6:87272089-87272111 TGAACCAACCTTGCATCCCATGG + Intergenic
1011537720 6:88394527-88394549 TGAACCAGCCTTGCATCTCAGGG - Intergenic
1011922678 6:92600410-92600432 TTGAACAACCTTGCATCCCAGGG - Intergenic
1012142994 6:95646674-95646696 TGAACCAACCTTGCATCCCAGGG - Intergenic
1012169495 6:96001498-96001520 TGAACCAACCTTGCATCCCAAGG - Intergenic
1012339461 6:98101869-98101891 GGAACCAAACTTGCATCCCAGGG + Intergenic
1012544972 6:100408730-100408752 GGAACCAACCTTGCATCCCAGGG + Intronic
1012576961 6:100814260-100814282 TGAACCAACCTTGCATCCCAGGG + Intronic
1012620332 6:101336775-101336797 TTAACCATCCTTGCATCTCAGGG + Intergenic
1012706885 6:102542771-102542793 TAAACCAACCTTGCATCTTAGGG + Intergenic
1012830333 6:104196584-104196606 TGAACCAACCTTGCATATCAGGG - Intergenic
1012834238 6:104245020-104245042 GCAACCAACCTTGCATCCTAGGG - Intergenic
1013362662 6:109409041-109409063 TGAACCATCCTTGCATCTCAAGG - Intronic
1013393397 6:109710275-109710297 TGAACCAACCTTGCATCCCAGGG + Intronic
1013741674 6:113294631-113294653 TGAATTAACCTTGCATCTCAGGG - Intergenic
1013898720 6:115125061-115125083 GGAACCAGCCTTGCATCCCAGGG - Intergenic
1013939951 6:115648969-115648991 TTAACCATCCTTGCATCCCAGGG - Intergenic
1014013631 6:116504702-116504724 TTAACCAGCCTTGCATCCCAGGG - Intronic
1014157405 6:118127301-118127323 TGAAACAGCCTTGCATCCCAGGG + Intronic
1014185919 6:118433876-118433898 TGAACCAACCTTGCATCCCAGGG - Intergenic
1014347694 6:120294864-120294886 TGAAACAGCCTTGCATCCCAGGG + Intergenic
1014529225 6:122539502-122539524 GGAACCAGCCTTGCATCCCAGGG + Intronic
1014589575 6:123246923-123246945 TGAACCAACCTTGCATCCCAGGG - Intronic
1014959849 6:127669743-127669765 TGAACCAACCTTGCATCCCAGGG + Intergenic
1015200132 6:130570261-130570283 TTAACCAGCCTTGCATCCCAGGG - Intergenic
1015211669 6:130705429-130705451 TGAACCAACCTTGCATCCCAGGG - Intergenic
1015432850 6:133151389-133151411 TGAACCAACCTTGCATCCCAGGG + Intergenic
1016423384 6:143909088-143909110 TGAACCAACCTTGCATCTCAGGG + Intronic
1016569240 6:145493805-145493827 TGAACCAACCTTGCATCCCAAGG + Intergenic
1017384497 6:153867710-153867732 TGAACCAACCTTGCATCCCAGGG - Intergenic
1019853152 7:3579346-3579368 TGAACCAACCTTGCATCCCAGGG - Intronic
1020753057 7:12167203-12167225 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1020877018 7:13710379-13710401 TGAACCAACCTTGCATCCCAGGG - Intergenic
1020881514 7:13767673-13767695 CGAACCAGCCTTGCATCTCAGGG - Intergenic
1021015029 7:15521518-15521540 TGAACCAGCCTTGCATCTCAGGG - Intronic
1021060124 7:16100972-16100994 TGAAACAGCCTTGCATCCCAGGG + Intronic
1021288061 7:18806799-18806821 TGAAACAACCTTGCAACTTAGGG + Intronic
1021350848 7:19592335-19592357 TGAACCAACCTTGCATCCCAGGG + Intergenic
1021369293 7:19821378-19821400 GGAAACATCTTTGCATCTCTGGG + Intergenic
1021425960 7:20499658-20499680 TCAACCAACCTTGCATCCCAGGG - Intergenic
1021916644 7:25440416-25440438 TGAACCAACCTTGCATCCCAGGG + Intergenic
1021967530 7:25935751-25935773 TGAAACAGCCTTGCATCCCAGGG - Intergenic
1022545370 7:31182900-31182922 TGAACCCACCTTGCATCTCAGGG + Intergenic
1022635009 7:32123526-32123548 TTAACCAGCCTTGCATCCCAGGG - Intronic
1022876809 7:34542024-34542046 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1023290916 7:38668188-38668210 TAAACCAACCTTGCATCCCAGGG + Intergenic
1023331036 7:39117255-39117277 GTAAACAACCATGCCTCACAAGG + Intronic
1023510745 7:40950777-40950799 TGAAACAGCCTTGCATCCCAGGG + Intergenic
1023639954 7:42247472-42247494 GTAAACATCCTGAGATCTCAGGG + Intergenic
1024497096 7:50060982-50061004 TGAACCAACCTTGCATCCCAGGG - Intronic
1024625381 7:51204044-51204066 TGAACCATCCTTGCATCTCAGGG - Intronic
1024778628 7:52820037-52820059 TGAAATAACCTTGCATTTCAGGG - Intergenic
1025641407 7:63375248-63375270 GTAAACATTCTTTCATCTCAGGG + Intergenic
1025714817 7:63945411-63945433 TGAACCAGCCTTGCATCTCAGGG - Intergenic
1025862723 7:65346988-65347010 TGAACCAGCCTTGCATCTCAAGG + Intergenic
1027627134 7:80560262-80560284 TGAACCAACCTTGCATCCCAGGG + Intronic
1028079196 7:86552750-86552772 TGAACCAACCTTGCATCCCAGGG - Intergenic
1028183429 7:87752195-87752217 GGAACCAGCCTTGCATCCCAGGG + Intronic
1028640189 7:93033591-93033613 TGAATCAACCTTGCATCCCAGGG - Intergenic
1028793002 7:94874808-94874830 GAAAAAAACCTTTTATCTCAGGG - Intergenic
1028858203 7:95616361-95616383 CTAACCAACGTTGCATCTCAGGG - Intergenic
1028966950 7:96812700-96812722 TGAACCAGCCTTGCATCTCAGGG - Intergenic
1029037413 7:97536690-97536712 GGAACCAGCCTTGCATCCCAGGG - Intergenic
1029041806 7:97583841-97583863 TGAACCAGCCTTGCATCTCAGGG - Intergenic
1029060171 7:97789388-97789410 GGAACCATCCTTGCATCCCAGGG - Intergenic
1029807825 7:103015017-103015039 TGAACCAACCTTGCATCTTAGGG - Intronic
1030786460 7:113669678-113669700 TTAAACAACCTTGCATTCCTGGG - Intergenic
1030791828 7:113739726-113739748 TGAAACAGCCTTGCATCCCAGGG + Intergenic
1031173092 7:118315929-118315951 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1031302073 7:120072867-120072889 ATAGACAACGATGCATCTCAAGG + Intergenic
1031673518 7:124580868-124580890 TGAACCAACCTTGCATCCCAGGG + Intergenic
1032939897 7:136777079-136777101 TGAACCAACCTTGCATCCCAGGG + Intergenic
1033000241 7:137495630-137495652 TTGAACCACCTTGCATCGCAGGG - Intronic
1033149022 7:138897028-138897050 GTAAAGATCCTGGGATCTCAGGG - Intronic
1033429666 7:141277913-141277935 GTATACAACATTCCATCTCATGG + Intronic
1033532290 7:142276779-142276801 TGAACCAACCTTGCATCCCAAGG - Intergenic
1033632593 7:143173976-143173998 AAAATCATCCTTGCATCTCAGGG - Intergenic
1033863718 7:145662363-145662385 TGAACCAACCTTGCATCCCAAGG - Intergenic
1033953133 7:146810955-146810977 TGAACCATCCTTGCATCTCAAGG + Intronic
1033996495 7:147356106-147356128 TGAACCAACCTTGCATCCCAGGG - Intronic
1034110478 7:148532785-148532807 GGAACCAGCCTTGCATCCCAGGG - Intergenic
1034718876 7:153269641-153269663 GGAACCAGCCTTGCATCCCAGGG + Intergenic
1036427898 8:8663325-8663347 GAAAACAACCTATCATTTCATGG - Intergenic
1036742264 8:11374195-11374217 TGAACCAACCTTGCATCCCAGGG - Intergenic
1036804167 8:11817189-11817211 TTGAACAGCCTTGCATCCCAGGG + Intronic
1037207241 8:16337949-16337971 TTAACCAGCCTTGCATCCCAGGG + Intronic
1038162497 8:25053241-25053263 TTTTACAACCTTGCATCTGACGG + Intergenic
1038878502 8:31579603-31579625 TGAACCAACCTTGCATCCCAGGG - Intergenic
1039125211 8:34193563-34193585 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1039658540 8:39436848-39436870 TGAACCAACCTTGCATCCCAGGG - Intergenic
1040657702 8:49530818-49530840 GCAACCAGCCTTGCATCCCAGGG + Intergenic
1041129632 8:54684132-54684154 TGAATCAACCTTGCATCCCAGGG + Intergenic
1041204123 8:55480222-55480244 TGAAACAGCCTTGCATCCCAGGG - Intronic
1041295239 8:56350407-56350429 TGAACCAACCTTGCATCCCAGGG + Intergenic
1041332602 8:56743534-56743556 GTATTCTACCTTGCATTTCAAGG + Intergenic
1041478248 8:58289283-58289305 TGAAACAGCCTTGCATCCCAGGG + Intergenic
1041583604 8:59491454-59491476 TGAACCAACCTTGCATCCCATGG + Intergenic
1041859342 8:62494341-62494363 TGAACCAACCTTGCATCCCAGGG + Intronic
1041900280 8:62974981-62975003 TGAAACAGCCTTGCATCCCAGGG + Intronic
1042008953 8:64217414-64217436 TTAAACAACTTTGCATTTCTGGG - Intergenic
1042633799 8:70850608-70850630 TGAAACCACCTTGCATCCCAGGG - Intergenic
1043001343 8:74763786-74763808 TGAACCAACCTTGCATCCCAGGG - Intronic
1043067460 8:75592850-75592872 TCAATCAACCTTGCATCCCAGGG + Intergenic
1043214047 8:77563028-77563050 TGAACCAACCTTGCATCCCAGGG + Intergenic
1043298832 8:78701809-78701831 GGAGTCAACCTTGCATCCCAGGG + Intronic
1043339693 8:79222647-79222669 TTAACCAACCTTGCATCCCGGGG + Intergenic
1043362826 8:79495774-79495796 TGAACCAACCTTGCATCCCAGGG + Intergenic
1043761937 8:84079107-84079129 TTAACCAGCCTTGCATCCCAGGG + Intergenic
1043869950 8:85421168-85421190 TGAACCAGCCTTGCATCTCAGGG + Intronic
1044038250 8:87333687-87333709 TAAACCAGCCTTGCATCTCAGGG + Intronic
1044113641 8:88306600-88306622 TGAACCAACCTTGCATCCCAGGG - Intronic
1044162126 8:88932552-88932574 TGAACCAACCTTGCATCCCAGGG + Intergenic
1044203295 8:89461332-89461354 TGAACCAGCCTTGCATCTCAGGG - Intergenic
1044314664 8:90735870-90735892 TAAACCAACCTTGCATCCCAGGG - Intronic
1044317359 8:90765314-90765336 ACAAAGAACCTGGCATCTCATGG - Intronic
1044452623 8:92355526-92355548 TGAACCAACCTTGCATTTCAGGG + Intergenic
1044470292 8:92559144-92559166 TGAACCAACCTTGCATCCCAGGG + Intergenic
1045103906 8:98872163-98872185 TTAACCAGCCTTGCATCCCAGGG + Intronic
1045170889 8:99666479-99666501 TGAACCAACCTTGCATCCCAGGG - Intronic
1045581872 8:103490570-103490592 TGAACCAACCTTGCATCCCAGGG - Intergenic
1045673108 8:104578748-104578770 TGAATCAACCTTGCATCCCAGGG - Intronic
1045728275 8:105201697-105201719 TGAAACAGCCTTGCATCCCAGGG - Intronic
1045819741 8:106322219-106322241 TGAACCAACCTTGCATCCCAGGG - Intronic
1045978161 8:108152876-108152898 GGAACCAGCCTTGCATCCCAGGG - Intergenic
1046022350 8:108680337-108680359 TGAACCAGCCTTGCATCTCAGGG - Intronic
1046164315 8:110410191-110410213 TAAAGCAACCTTGCATCTCAGGG + Intergenic
1046218564 8:111182005-111182027 GGAACCAGCCTTGCATCCCATGG + Intergenic
1046255402 8:111690596-111690618 TGAACCAACCTTGCATCCCAGGG + Intergenic
1046385239 8:113500608-113500630 TAAACCAGCCTTGCATCTCAGGG - Intergenic
1046433242 8:114155003-114155025 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1046436022 8:114190775-114190797 TGAAACAGCCTTGCATCCCAAGG - Intergenic
1046488189 8:114913222-114913244 TGAAGCAACCTTGCATCTCAGGG - Intergenic
1046505966 8:115138607-115138629 TGAACCAACCTTGCATCCCAAGG + Intergenic
1046602253 8:116330324-116330346 TGAACCAGCCTTGCATCTCAGGG - Intergenic
1046605731 8:116369819-116369841 TGAACCAACCTTGCATCCCAAGG + Intergenic
1046874386 8:119237609-119237631 TTAACCAGCCTTGCATCCCAGGG - Intronic
1046879835 8:119295840-119295862 TGAACCAGCCTTGCATCTCAGGG - Intergenic
1046894496 8:119458518-119458540 TGAAACAGCCTTGCATCCCAGGG + Intergenic
1046896203 8:119476189-119476211 TGAAACAGCCTTGCATCCCAGGG + Intergenic
1047031545 8:120887167-120887189 GGAACCAGCCTTGCATCCCAGGG + Intergenic
1047159260 8:122358689-122358711 TGAACCAACCTTGCATCCCAGGG + Intergenic
1048587348 8:135787154-135787176 TGAACCAGCCTTGCATCTCAAGG + Intergenic
1049115532 8:140683674-140683696 TGAACCAACCTTGCATCCCAGGG - Intronic
1049187009 8:141261046-141261068 TGAACCAGCCTTGCATCTCAGGG - Intronic
1050007478 9:1148018-1148040 TGAACCAGCCTTGCATCTCAGGG - Intergenic
1050033404 9:1409964-1409986 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1050398460 9:5225535-5225557 TGAACCAACCTTGCATCCCAGGG - Intergenic
1050886322 9:10770845-10770867 TAAAACAACCTTGCATCTTAGGG - Intergenic
1051018141 9:12506607-12506629 TGAACCAACCTTGCATCCCAGGG - Intergenic
1051045401 9:12867136-12867158 TGAAACAGCCTTGCATCCCAGGG + Intergenic
1051113222 9:13663950-13663972 TGAACCAGCCTTGCATCTCAGGG - Intergenic
1051299371 9:15631841-15631863 TGAAACAGCCTTGCATCCCAGGG - Intronic
1051354284 9:16227123-16227145 TGAATCAACCTTGCATCCCAGGG - Intronic
1051494450 9:17703624-17703646 TGAACCAACCTTGCATCCCAGGG - Intronic
1051498845 9:17755306-17755328 TGAACCAACCTTGCATCCCAGGG + Intronic
1051573424 9:18585775-18585797 TGAATCAACCTTGCATCTCTGGG - Intronic
1051968443 9:22858525-22858547 TGAACCAACCTTGCATCCCAGGG - Intergenic
1052082686 9:24226971-24226993 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1052114749 9:24636887-24636909 GGAACCAGCCTTGCATCCCAGGG + Intergenic
1052115120 9:24641051-24641073 TGAACCAACCTTGCATCCCAGGG + Intergenic
1052123902 9:24752743-24752765 TGAACCAACCTTGCATCCCAGGG + Intergenic
1052127082 9:24790606-24790628 TGAACCAGCCTTGCATCTCAGGG - Intergenic
1052146792 9:25060458-25060480 TGAAACAGCCTTGCATCCCAGGG + Intergenic
1052222683 9:26046527-26046549 GGAAGCAGCCTTGCATCCCAGGG - Intergenic
1052263371 9:26543625-26543647 TGAACCAACCTTGCATCCCAGGG - Intergenic
1052335989 9:27320633-27320655 TGAAACAGCCTTGCATCCCAGGG + Intergenic
1052360638 9:27552787-27552809 TGAACCAACCTTGCATCCCAGGG + Intronic
1052384947 9:27811446-27811468 TGAACCAACCTTGCATCCCAGGG - Intergenic
1052579647 9:30338991-30339013 TGAACCAACCTTGCATCCCAGGG + Intergenic
1052694416 9:31857669-31857691 TGAAGCAACCTTGCATCTCAGGG - Intergenic
1053356716 9:37452099-37452121 GTAAACAAAATTCCTTCTCAAGG + Intronic
1053636640 9:40013275-40013297 GAGAACAATCTTGCATCTTAGGG + Intergenic
1053769352 9:41451341-41451363 GAGAACAATCTTGCATCTTAGGG - Intergenic
1054317502 9:63610349-63610371 GAGAACAATCTTGCATCTTAGGG + Intergenic
1054548020 9:66362844-66362866 GAGAACAATCTTGCATCTTAGGG - Intergenic
1054794702 9:69289592-69289614 TGAACCAGCCTTGCATCTCAGGG - Intergenic
1054960684 9:70965598-70965620 TGAACCAACCTTGCATCCCAGGG + Intronic
1055234426 9:74103176-74103198 TGAATCAACCTTGCATCCCAGGG - Intergenic
1055341210 9:75285519-75285541 TGAACCAACCTTGCATCCCAGGG + Intergenic
1055356667 9:75444583-75444605 TGAACCAACCTTGCATCCCAGGG + Intergenic
1055719173 9:79152601-79152623 GTAAACAGGCTTGCATGGCAAGG - Intergenic
1055802518 9:80055280-80055302 GTAATCATCCTTGCATCCTAAGG - Intergenic
1056058579 9:82857941-82857963 TTAAATAACCTTGCATTTCTGGG - Intergenic
1056094591 9:83239792-83239814 TTAAACAACCTTGCATTCCTGGG + Intergenic
1056321270 9:85437211-85437233 GGAACCAGCCTTGCATCCCAGGG - Intergenic
1056375053 9:86000218-86000240 TGAAACAACCTTGCATCCCAGGG + Intronic
1056393560 9:86160774-86160796 TTGAACAGCCTTGCATCCCAGGG - Intergenic
1056417770 9:86393791-86393813 GGAACCAGCCTTGCATCCCAGGG - Intergenic
1056877766 9:90351050-90351072 TGAACCAACCTTGCATCCCAGGG - Intergenic
1057697268 9:97333186-97333208 TGAACCAACCTTGCATCCCAGGG + Intronic
1058101573 9:100923150-100923172 TCAACCAACCTTGCATCCCAGGG - Intergenic
1058266139 9:102901153-102901175 TGAACCAACCTTGCATCCCAGGG + Intergenic
1058408823 9:104707277-104707299 GGAACCAGCCTTGCATCCCAGGG - Intergenic
1058513627 9:105746896-105746918 GGAACCAGCCTTGCATCCCAGGG + Intronic
1058534744 9:105946987-105947009 TGAACCAACCTTGCATCCCAGGG + Intergenic
1058565526 9:106280674-106280696 TGAACCATCCTTGCATCTCAGGG + Intergenic
1058588908 9:106540085-106540107 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1058616345 9:106832488-106832510 TGAACCAACCTTGCATCACAGGG + Intergenic
1058710337 9:107673504-107673526 GAACAGAACCTTGAATCTCAAGG - Intergenic
1058768147 9:108202867-108202889 TGAACCATCCTTGCATCTCAGGG - Intergenic
1058838915 9:108886496-108886518 TAAACCAACCTTGCATCTCTGGG - Intronic
1059017559 9:110536272-110536294 TGAACCAACCTTGCATCCCAGGG + Intronic
1059028761 9:110666670-110666692 TTAACCAGCCTTGCATCCCAGGG - Intergenic
1059261321 9:112979566-112979588 TGAAACAGCCTTGCATCCCAGGG - Intergenic
1059262359 9:112990434-112990456 TGAATCAACCTTGCATCCCAGGG + Intergenic
1059745871 9:117200682-117200704 TGAACCATCCTTGCATCTCAGGG + Intronic
1059778699 9:117503792-117503814 TCAAACAAACTTGCATCCCAGGG + Intergenic
1059979557 9:119755963-119755985 TGAACCATCCTTGCATCTCAAGG + Intergenic
1060389156 9:123264578-123264600 ATAAACCACCTTGATTCTCATGG + Intronic
1062708980 9:137961687-137961709 TGAACCAACCTTGCATCCCAGGG + Intronic
1203461185 Un_GL000220v1:40305-40327 TGAACCAACCTTGCATCCCAGGG + Intergenic
1203369317 Un_KI270442v1:287989-288011 GTAAACCAGCTTGCATCCCTTGG + Intergenic
1186530463 X:10290330-10290352 GTTAAGAACCTTGCATGTCCTGG + Intergenic
1186599350 X:11020290-11020312 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1186600519 X:11031799-11031821 TGAACCAACCTTGCATCCCAGGG - Intergenic
1186743469 X:12541911-12541933 TGAACCAGCCTTGCATCTCAGGG - Intronic
1186783169 X:12933695-12933717 TGAACCAACCTTGCATCCCATGG - Intergenic
1187182948 X:16960001-16960023 TAAACCAATCTTGCATCTCAGGG - Intronic
1187607489 X:20902084-20902106 TGAACCAACCTTGCATCCCAGGG + Intergenic
1187624632 X:21096823-21096845 TGAACCAACCTTGCATCCCAGGG + Intergenic
1187828812 X:23359969-23359991 TGAACCAGCCTTGCATCTCAGGG + Intronic
1187835203 X:23425613-23425635 TGAATCAACCTTGCATCCCAGGG + Intergenic
1188148343 X:26641992-26642014 TGAACCAACCTTGGATCTCAGGG - Intergenic
1188172745 X:26948270-26948292 CCAACCAACCTTGCATCCCAAGG + Intergenic
1188290936 X:28388136-28388158 GGAAACAGCCTTGTATCCCAGGG + Intergenic
1188723215 X:33548592-33548614 GGAACCAACCTTGCATCCCGGGG + Intergenic
1188724863 X:33570356-33570378 TGAAACATCCTTGCATCTCTGGG + Intergenic
1188771445 X:34158830-34158852 TTAACCAGCCTTGCATCCCAGGG + Intergenic
1188785754 X:34344269-34344291 TTAACCAGCCTTGCATCCCAGGG - Intergenic
1188796854 X:34477829-34477851 TGAAACAACCTTGCATCCCAGGG + Intergenic
1188861830 X:35267351-35267373 CGAACCATCCTTGCATCTCAGGG + Intergenic
1189501617 X:41565906-41565928 TTAACCAGCCTTGCATCCCAGGG - Intronic
1189583988 X:42438507-42438529 TGAACCAACCTTGCATCCCAGGG - Intergenic
1189861652 X:45278318-45278340 TAAACCAACCTTGCATCCCAGGG + Intergenic
1189891515 X:45607825-45607847 TGAACCAACCTTGCATCCCATGG + Intergenic
1189898084 X:45676818-45676840 TAAACCAACCTTGCATCCCAGGG - Intergenic
1189904490 X:45743591-45743613 GTAAACAACATTAAATCTTAAGG - Intergenic
1189940310 X:46114198-46114220 CAAATCAACCTTGCATCCCAGGG + Intergenic
1190515450 X:51219312-51219334 TTGGACAACCTTGCATCCCAGGG + Intergenic
1190600306 X:52085527-52085549 TGAATCAACCTTGCATCCCAAGG + Intergenic
1190919069 X:54833531-54833553 TGAACCATCCTTGCATCTCAGGG + Intergenic
1191042884 X:56104032-56104054 TGAACCAACCTTGCATCCCAGGG + Intergenic
1191049863 X:56179811-56179833 TGAAACAGCCTTGCATCCCAGGG + Intergenic
1191122173 X:56917582-56917604 GGAACCAGCCTTGCATCCCAGGG + Intergenic
1191144203 X:57149077-57149099 GTTGACAGCCTTGCATCCCAGGG + Intergenic
1191147862 X:57187882-57187904 TGAACCAGCCTTGCATCTCAAGG + Intergenic
1191177740 X:57523415-57523437 TTGAACAACCTTGCATCCCAGGG + Intergenic
1191195925 X:57722749-57722771 TGAACCAACCTTGCATCCCAGGG + Intergenic
1191209176 X:57866964-57866986 TGAAACAGCCTTGCATCCCAGGG - Intergenic
1191221750 X:57996999-57997021 TAAACCAACCTTGCATCCCAGGG + Intergenic
1191565342 X:62520783-62520805 TGAACCAACCTTGCATCCCAGGG - Intergenic
1191591644 X:62891910-62891932 TGAACCACCCTTGCATCTCAGGG - Intergenic
1191610490 X:63106742-63106764 TTAACCAGCCTTGCATCTCAGGG - Intergenic
1191649665 X:63522936-63522958 TGAAACAGCCTTGCATCCCAGGG - Intergenic
1191704594 X:64081182-64081204 TGAACCAGCCTTGCATCTCATGG + Intergenic
1191722451 X:64245084-64245106 TGAATCAACCTTGGATCTCAGGG + Intergenic
1191738523 X:64412834-64412856 TGATCCAACCTTGCATCTCAGGG + Intergenic
1191745348 X:64480690-64480712 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1191747428 X:64504666-64504688 TGAACCAACCTTGCATCCCAGGG - Intergenic
1191774560 X:64799668-64799690 TGAAACATCCTTGCATCCCAGGG + Intergenic
1191924146 X:66291164-66291186 TGAACCATCCTTGCATCTCAGGG + Intergenic
1191929638 X:66356574-66356596 TGAAACAACCTTGCATCCAAGGG - Intergenic
1191985244 X:66972662-66972684 GGAACCAGCCTTGCATCCCAGGG + Intergenic
1192030934 X:67511532-67511554 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1192063595 X:67857022-67857044 TGAACCAACCTTGCATCCCAGGG - Intergenic
1192128630 X:68526794-68526816 TGAACCAACCTTGCATCCCAGGG + Intronic
1192253677 X:69436042-69436064 TGAACCAACCTTGCATCCCAGGG + Intergenic
1192296810 X:69858550-69858572 TGAACCAACCTTGCATCCCAGGG + Intronic
1192411811 X:70940278-70940300 GGAACCAGCCTTGCATCCCAGGG + Intergenic
1192520847 X:71799020-71799042 TGAACCAACCTTGCATCCCAGGG + Intergenic
1192525529 X:71840245-71840267 TGAAACAGCCTTGCATCCCAGGG + Intergenic
1192685186 X:73296836-73296858 TTGAACAACCTTGCATCCCAGGG - Intergenic
1192849494 X:74939850-74939872 TGAACCAACCTTGCATCCCAGGG + Intergenic
1192853989 X:74987762-74987784 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1192894914 X:75432232-75432254 GTAAAATACCTTTCATCTAAAGG - Intronic
1192920929 X:75705302-75705324 TGAACCAACATTGCATCTCAGGG - Intergenic
1192990242 X:76445112-76445134 GGAACCATCCTTGCATCCCAGGG + Intergenic
1192993314 X:76485860-76485882 TTAACCAGCCTTGCATCCCAGGG + Intergenic
1193043477 X:77028093-77028115 TAAACCAACCTTGCATCCCACGG + Intergenic
1193065923 X:77259917-77259939 TGAAACAGCCTTGCATCCCAGGG - Intergenic
1193173165 X:78360035-78360057 TAAACCAACCTTGCATCCCAAGG - Intergenic
1193195655 X:78628614-78628636 TGAACCAACCTTGCATCCCAGGG + Intergenic
1193218547 X:78895130-78895152 TGAACCAACCTTGCAGCTCAGGG + Intergenic
1193277686 X:79608716-79608738 TGAAGCAACCTTGCATCCCAGGG - Intergenic
1193281171 X:79652717-79652739 TGAAACAGCCTTGCATCCCAGGG + Intergenic
1193294205 X:79815310-79815332 TGAACCAACCTTGCATCTCAAGG + Intergenic
1193452991 X:81693776-81693798 TGAATCAACCTTGCATCTCAGGG + Intergenic
1193455593 X:81727901-81727923 TGAATCAATCTTGCATCTCAGGG - Intergenic
1193458359 X:81758630-81758652 TGAACCAACCTTGCATCCCAGGG - Intergenic
1193483018 X:82050584-82050606 TGAACCAACCTTGCATCCCAGGG - Intergenic
1193516683 X:82474412-82474434 TGAACCAACCTTGCATCCCAGGG + Intergenic
1193615657 X:83685230-83685252 TTAACCAGCCTTGCATCACAGGG + Intergenic
1193616471 X:83694222-83694244 TGAAACAGCCTTGCATCCCAGGG + Intergenic
1193631506 X:83894032-83894054 GAAACCATCCTTGCATCCCAGGG + Intergenic
1193665747 X:84314181-84314203 TGAAACATCCTTGCATCCCAGGG - Intergenic
1193673913 X:84423634-84423656 TGAAACACCCTTGCATCTTAGGG - Intronic
1193746823 X:85292256-85292278 CTAACCAACCTTGCATTCCAGGG + Intronic
1193789887 X:85804727-85804749 TGAAACAAGCTTGCATCCCAGGG + Intergenic
1193854544 X:86583034-86583056 TGAATCAACCTTGCATCACAGGG - Intronic
1193897588 X:87132208-87132230 TGAAACAGCCTTGCATCCCAGGG - Intergenic
1194040468 X:88936024-88936046 TGAACCAACCTTGCATCCCAGGG + Intergenic
1194114831 X:89882944-89882966 TGAAACATTCTTGCATCTCAAGG - Intergenic
1194139758 X:90195387-90195409 TGAAACAGCCTTGCATCCCAGGG + Intergenic
1194190437 X:90829128-90829150 TAAACCAACCTTGCATCTCAGGG + Intergenic
1194201886 X:90961817-90961839 TGAACCAACATTGCATCTCAGGG - Intergenic
1194229563 X:91305687-91305709 TTCAACCACCTTGCATCCCAGGG - Intergenic
1194338414 X:92678604-92678626 TTAAACATCTTTGCATCCCAGGG + Intergenic
1194542662 X:95193415-95193437 TTAACCAACCTTGCATCCCAGGG + Intergenic
1194549444 X:95277886-95277908 TGAACCAACCTTGCATCTAAGGG - Intergenic
1194555647 X:95355189-95355211 TGAAGCAGCCTTGCATCTCAGGG + Intergenic
1194851254 X:98872318-98872340 TGAACCAACCTTGCATCCCAGGG + Intergenic
1194901068 X:99512329-99512351 TGAAGCAACCTTGCATCCCAGGG + Intergenic
1195075161 X:101319886-101319908 CTAATCAACCTTGCATCCCGGGG + Intergenic
1195305724 X:103581563-103581585 TTAACCAACCTTGCATCTCGGGG - Intronic
1195452492 X:105031564-105031586 TGAACCAACCTTGCATCCCAGGG + Intronic
1195473130 X:105255973-105255995 TGAACCAACCTTGCATCTCAGGG + Intronic
1195568608 X:106374217-106374239 TGAACCAACCTTGCATCCCAGGG - Intergenic
1195661023 X:107378342-107378364 TTAACCAGCCTTGCATCCCAGGG + Intergenic
1195733358 X:107988398-107988420 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1195784791 X:108507392-108507414 TGAACCAACCTTGCATCCCAGGG - Intronic
1195855876 X:109332136-109332158 TGAACCAACCTTGCATCCCAGGG + Intergenic
1195947791 X:110233652-110233674 TGAACCAGCCTTGCATCTCAGGG - Intronic
1195984281 X:110612386-110612408 TGAAACAGCCTTGCATCCCAGGG - Intergenic
1196216977 X:113064564-113064586 TGAACCAACCTTGCATCCCAGGG + Intergenic
1196218677 X:113086383-113086405 TCAACCAACCTTGCATCCCAGGG + Intergenic
1196232143 X:113236484-113236506 AGAAACATCCTTGCATCCCAGGG + Intergenic
1196249983 X:113449122-113449144 TGAAACAGCCTTGCATCCCAGGG - Intergenic
1196473414 X:116054785-116054807 TGAACCAACCTTGCATCTCAGGG + Intergenic
1196606920 X:117667827-117667849 TGAAACAGCCTTGCATCCCAGGG + Intergenic
1197029749 X:121799459-121799481 TGAAGCAACCTTGCATCCCAGGG + Intergenic
1197046082 X:122000354-122000376 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1197136580 X:123067552-123067574 TGAACCAACCTTGCATCCCAGGG - Intergenic
1197259092 X:124297450-124297472 TGAACCAACCTTGCATCCCAGGG - Intronic
1197388620 X:125831903-125831925 TGAACCAACCTTGCATCACAGGG - Intergenic
1197406790 X:126063805-126063827 TGAAACAACCTTGCATCCCAGGG - Intergenic
1197459934 X:126728467-126728489 TGAAACATCCTTGCATCCCAGGG - Intergenic
1197468762 X:126840256-126840278 CTAACCATCCTTGCATCTCTGGG - Intergenic
1197558374 X:127986377-127986399 TTGAACAACCTTGCATACCAGGG + Intergenic
1197573718 X:128181500-128181522 TGAACCAACCTTGCATCCCAGGG - Intergenic
1197915333 X:131528287-131528309 TGAACCAGCCTTGCATCTCAGGG - Intergenic
1197986924 X:132276504-132276526 TGAAACATCCTTGCATCCCAGGG + Intergenic
1198579010 X:138042773-138042795 TGAACCAGCCTTGCATCTCAGGG - Intergenic
1198895662 X:141451729-141451751 TTAACCAGCCTTGCATCCCAGGG - Intergenic
1198925347 X:141785687-141785709 TGAACCATCCTTGCATCTCAGGG + Intergenic
1198995049 X:142565087-142565109 GGAACCACACTTGCATCTCAGGG + Intergenic
1199011697 X:142766157-142766179 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1199027023 X:142951827-142951849 TGAAACAACCTTCCATCCCACGG + Intergenic
1199137437 X:144269528-144269550 TGAACCAACCTTGAATCTCAGGG - Intergenic
1199245889 X:145603548-145603570 TGAAACAACCTTGCATCTCAGGG - Intergenic
1199325748 X:146495806-146495828 TGAACCAACCTTGCATCCCAGGG - Intergenic
1199485687 X:148345604-148345626 TGAACCAACCTTGCATCCCAGGG - Intergenic
1199786249 X:151108253-151108275 TAAACCAACCTTGCATCCCAAGG + Intergenic
1199864979 X:151837545-151837567 TTAATCAATCTTGCATTTCAAGG - Intergenic
1200336610 X:155357528-155357550 TGAACCAACCTTGCATCCCAGGG - Intergenic
1200349860 X:155483699-155483721 TGAACCAACCTTGCATCCCAGGG + Intergenic
1200361088 X:155607244-155607266 TGAACCAACCTTGCATCCCAGGG - Intronic
1200467622 Y:3540035-3540057 TGAAACATTCTTGCATCTCAAGG - Intergenic
1200485502 Y:3764356-3764378 TGAAACAGCCTTGCATCCCAGGG + Intergenic
1200537096 Y:4411550-4411572 TAAACCAACCTTGCATCTCAGGG + Intergenic
1200547724 Y:4537269-4537291 TGAACCAACATTGCATCTCAGGG - Intergenic
1200583385 Y:4977053-4977075 TGAAACAGCCTTGCATCCCAGGG - Intergenic
1200646816 Y:5795387-5795409 TTAAACATCTTTGCATCCCAGGG + Intergenic
1200819931 Y:7572373-7572395 TGAAACAGCCTTGCATCCCAGGG + Intergenic
1200879449 Y:8197266-8197288 TGAACCAACCTTGCATCTCAGGG - Intergenic
1201068964 Y:10126972-10126994 GTAAACTAGCTTGCATCACCTGG - Intergenic
1201230271 Y:11857436-11857458 TGAAACAGCCTTGCATCCCAAGG + Intergenic
1201409458 Y:13684262-13684284 TGAACCAGCCTTGCATCTCAGGG - Intergenic
1201449565 Y:14096601-14096623 TGAACCAGCCTTGCATCTCACGG + Intergenic
1201483046 Y:14461194-14461216 TGAACCAGCCTTGCATCTCAGGG - Intergenic
1201511840 Y:14772740-14772762 TAAATCAGCCTTGCATCTCAGGG - Intronic
1201563176 Y:15339536-15339558 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1201618556 Y:15928876-15928898 TTAACCAGCCTTGCATCCCAGGG - Intergenic
1201669762 Y:16505994-16506016 GGAACCAGCCTTGCATCCCAGGG + Intergenic
1201759588 Y:17522458-17522480 GTAAACCACTTTGCATCCCCTGG + Intergenic
1201841966 Y:18383532-18383554 GTAAACCACTTTGCATCCCCTGG - Intergenic
1201930169 Y:19336041-19336063 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1201936417 Y:19415315-19415337 GGAACCAGCCTTGCATCCCAGGG + Intergenic
1201939032 Y:19438833-19438855 TGAACCAACCTTGCATCCCAGGG - Intergenic
1201956240 Y:19626458-19626480 TGAACCAGCCTTGCATCTCAAGG + Intergenic
1201991076 Y:20026935-20026957 TGAATCAACCTTGCATCCCAAGG - Intergenic
1201992117 Y:20038612-20038634 TGAAACAACCTTGCATCCCAAGG - Intergenic
1202035332 Y:20627842-20627864 TGAACCAGCCTTGCATCTCAGGG + Intergenic
1202079247 Y:21067421-21067443 GAAACCAGCCTTGCATCCCATGG - Intergenic
1202105352 Y:21358210-21358232 TGAACCAACCTTGCATCACAGGG - Intergenic
1202248946 Y:22849562-22849584 TGAAACAGCCTTGCATCCCAGGG + Intergenic
1202401934 Y:24483310-24483332 TGAAACAGCCTTGCATCCCAGGG + Intergenic
1202468847 Y:25186773-25186795 TGAAACAGCCTTGCATCCCAGGG - Intergenic