ID: 1115878237

View in Genome Browser
Species Human (GRCh38)
Location 14:37885472-37885494
Sequence CTTTCAACACAGAGAGCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 8, 3: 67, 4: 333}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115878237 Original CRISPR CTTTCAACACAGAGAGCACC AGG (reversed) Intronic
901737724 1:11322945-11322967 CATTCAACAAACAGAGCACCTGG - Intergenic
902266231 1:15267580-15267602 CTTCTAAAACAGAAAGCACCAGG - Intronic
903579014 1:24357309-24357331 CTTTGTACACGCAGAGCACCTGG - Exonic
903644233 1:24883397-24883419 CTTCCAAAACAGAAGGCACCAGG - Intergenic
905963943 1:42073184-42073206 CTTCCAAAACAGAAAACACCAGG - Intergenic
906018239 1:42602655-42602677 CTTCTAAAACAGAAAGCACCAGG + Intronic
906347407 1:45026843-45026865 CTTCCAAAACAGAAAGCGCCAGG - Intronic
906701505 1:47861629-47861651 CTTCCAAAACAAAAAGCACCAGG + Intronic
907340540 1:53732269-53732291 CTTTCAACTCTGAGACCACTGGG + Intronic
907389061 1:54144719-54144741 CCTACAACACAGAGTGCAGCTGG - Exonic
907512659 1:54973307-54973329 CTGTCAACAGAGGGAGCAGCTGG + Intergenic
908033120 1:60022410-60022432 CTTTCAAAGCAGAAAGTACCAGG + Intronic
908047754 1:60189904-60189926 CTTCCAAAACAGAAAGCACCAGG + Intergenic
908310728 1:62880195-62880217 CTTTCAACTGAGAGTTCACCTGG + Intergenic
908574817 1:65448647-65448669 CTTCCAAAACAGAAAGCACAAGG - Intronic
908673048 1:66569850-66569872 CTTTTAAAACAGAATGCACCAGG - Intronic
909162960 1:72177851-72177873 CCTCCAACACAGACAGCACAAGG + Intronic
909944000 1:81642549-81642571 CTTCCAAAACTGAAAGCACCAGG + Intronic
911286405 1:95999042-95999064 CTTTCAAAACAGAAAGCATTAGG + Intergenic
911809443 1:102255874-102255896 CTTTCAAAACAGAAATCATCAGG + Intergenic
912970696 1:114279906-114279928 CTTCCAAAACAGAAAGCATCTGG + Intergenic
913092489 1:115487766-115487788 GTTTCAAAACAGAAAGCCCCAGG + Intergenic
913204747 1:116527798-116527820 CTTCCAAAACAGAAAGCACCAGG - Intronic
916533911 1:165685225-165685247 CTTTCATCCCAGTGAACACCTGG - Intronic
918121743 1:181546538-181546560 CTTTCAACATAGAGGACAACAGG - Intronic
918370418 1:183855603-183855625 TTGTCAACAGAGAGAGCACTGGG + Intronic
919420795 1:197367801-197367823 CTTTCCATACAGAGAGCAGATGG - Intronic
920735859 1:208532619-208532641 ATTTCAGCACACAGAGCTCCTGG - Intergenic
921242374 1:213198703-213198725 CTTCCAAAATAGAAAGCACCAGG + Intronic
921544662 1:216460342-216460364 CGTTCAAGACAAAGAGTACCCGG - Intergenic
921674163 1:217959720-217959742 CTTCCAAAACAGAAAGCACCAGG + Intergenic
921797713 1:219366716-219366738 CTTACCACAGAGAGAGCACAGGG + Intergenic
922521865 1:226260198-226260220 CTTCCAAAACAGATAGCACCAGG + Intronic
922573172 1:226645622-226645644 CTTCCAACCCAGACAGCAGCAGG - Intronic
923023171 1:230181866-230181888 CTTCCCAAACAGAAAGCACCTGG - Intronic
923419974 1:233803415-233803437 ATTTCAAAACAGAAAACACCAGG + Intergenic
923709262 1:236372684-236372706 CTTCCAAAACAGAAAGCACCAGG - Intronic
924364743 1:243280027-243280049 CTTTCAAAACAGAAAGCACCAGG - Intronic
924437491 1:244055030-244055052 CTTCCCACACAGCGAGCACGTGG - Exonic
1062876129 10:944330-944352 TTTTCACCACAGGGAGAACCTGG + Intergenic
1062966232 10:1609696-1609718 TTATCAACACAGGGAGCACATGG + Intronic
1063938270 10:11101465-11101487 CTCTCAAGACATAGAGCACCAGG + Intronic
1064880623 10:20048987-20049009 CAATCAACATAAAGAGCACCAGG - Intronic
1064977270 10:21131253-21131275 CTTTGAAAACAGAAAGCACAAGG + Intronic
1065613522 10:27497321-27497343 CTTTCAAAAAATAAAGCACCAGG + Intergenic
1065677298 10:28191144-28191166 CTTACAAAACAGCAAGCACCAGG + Intronic
1066043088 10:31571134-31571156 ATTCCAAAACAGAAAGCACCAGG + Intergenic
1066485692 10:35841944-35841966 CTTACAAAACAGAAAGCACTAGG - Intergenic
1066511408 10:36101686-36101708 CTTCCAACACAGAAAGTTCCAGG + Intergenic
1067664434 10:48263660-48263682 CTTCCAAAACATAAAGCACCAGG + Intronic
1067671573 10:48327711-48327733 CTTTTAAAACAGAAAACACCAGG - Intronic
1069253454 10:66301188-66301210 CTTCCAAAACAGAAAGAACCAGG + Intronic
1070463606 10:76694706-76694728 CTTCTAAAACAGAAAGCACCTGG + Intergenic
1071047162 10:81394682-81394704 CTTCCAAAACAGAAAGCACGAGG - Intergenic
1071606045 10:86990819-86990841 CTTCCAAAACAGAAAGCACTTGG + Intergenic
1072026604 10:91466060-91466082 CTTCTAAAACAGAAAGCACCAGG - Intronic
1072490411 10:95900144-95900166 CTTTCACCACAGATCCCACCTGG + Intronic
1072510942 10:96124306-96124328 CTTTCAACAAAGAAATCACAAGG - Intergenic
1075647639 10:124107182-124107204 CTTTTAACACAGAGATGGCCAGG - Intergenic
1077348720 11:2078718-2078740 CTTTGAACAATGAGAACACCTGG - Intergenic
1077437210 11:2548696-2548718 CTTGCATCTCAGATAGCACCAGG + Intronic
1078293917 11:10045824-10045846 TTTCCAAAACAGAAAGCACCAGG + Intronic
1078860550 11:15242740-15242762 TTTGCACCACAGAGAGCTCCTGG - Intronic
1079118309 11:17655090-17655112 CTTCCATCACACAGAGTACCTGG + Intergenic
1079641188 11:22807620-22807642 CTTTCCACGCAGAGAGCAATAGG - Intronic
1079982559 11:27166446-27166468 CTTTCAACACAGAGACGTCAGGG + Intergenic
1082246778 11:49932482-49932504 CTTCCAAAGCAGAAAGCACCAGG + Intergenic
1083093633 11:60226162-60226184 TTTTCAAAACAGAAAGCACCAGG + Intronic
1084584549 11:70050013-70050035 CTTAAAACACAGACAGCAGCTGG - Intergenic
1085085483 11:73663929-73663951 CTTTCCACACAGAGAACAGATGG + Intergenic
1087999628 11:104861132-104861154 CCTTCAAAACAGAAATCACCAGG + Intergenic
1089977732 11:122747001-122747023 GGTTCAACAGAGAGAACACCAGG + Intronic
1090168169 11:124573922-124573944 CTTTCAAAACAGAAAACACCAGG + Intergenic
1090841554 11:130493115-130493137 CTTTCAAAACAGAAAGAACCAGG - Intergenic
1091171896 11:133526889-133526911 CTTTCCAGACAGAGAGGGCCAGG - Intronic
1091438198 12:490892-490914 CTTTCAAAACAGAAAGCCCCAGG + Intronic
1093239388 12:16650962-16650984 CTTTCAAAATGGAAAGCACCAGG + Intergenic
1093506806 12:19876382-19876404 CTTCCAAAACAGAAAGCACCAGG - Intergenic
1093578323 12:20762582-20762604 GTTTCAACACAGAGCTCAGCCGG + Intergenic
1094254251 12:28403272-28403294 CCTTCCAAACAGAAAGCACCTGG - Intronic
1095258608 12:40071632-40071654 CTTCCAAAACTGAAAGCACCAGG - Intronic
1095634220 12:44413230-44413252 CTTCCAAAACAGAAAGTACCAGG + Intergenic
1095763839 12:45871739-45871761 CCTTCAAAACAGAAAGTACCAGG - Intronic
1096129055 12:49142888-49142910 CTTCCCAAACAGAAAGCACCAGG - Intergenic
1096251392 12:50035217-50035239 CTTTGAAAACAGAGACCGCCGGG + Intergenic
1096518958 12:52173491-52173513 CTTTCAGGACAGAGAGCTGCAGG + Intronic
1098777767 12:74643019-74643041 CTTCCAAAACAGAAAACACCAGG - Intergenic
1098832870 12:75384516-75384538 CTTCCAAAACAGAAAGCACCAGG + Intronic
1099517486 12:83615394-83615416 CTTTCTGTACAGAGAGCAGCAGG + Intergenic
1101026943 12:100618107-100618129 CTCTGAACACAGAGAGGATCTGG + Intronic
1101127888 12:101657706-101657728 CTTACAAAACAGAAAGCAACAGG + Intronic
1101425354 12:104583690-104583712 CTTTGAAAACTGAGAGCACAAGG - Intronic
1101649633 12:106664185-106664207 CTTCCAAAACAGAAAGCACCAGG - Intronic
1102792702 12:115660597-115660619 GTTTCAGCAGAGAGAGCACAAGG - Intergenic
1103193978 12:119026061-119026083 CTTCAACCACAGAGGGCACCAGG - Intronic
1103701889 12:122852419-122852441 CTCTCAGCACAGAGCCCACCAGG + Intronic
1103972465 12:124680686-124680708 CTTTTAAAAAAGAGAGAACCAGG - Intergenic
1105445629 13:20454017-20454039 CTATCAACACAGAAAACTCCAGG + Intronic
1105619526 13:22053389-22053411 AAGTCAACACAGAGAGCCCCTGG - Intergenic
1106900216 13:34347842-34347864 CTTACAAAACAGAAAGCACATGG - Intergenic
1107823203 13:44304850-44304872 CTTTCAGCAGAGAGAGGACACGG + Intergenic
1110214832 13:73013983-73014005 TTTTCAAAACAGAAAGCACTAGG + Intronic
1110259119 13:73465343-73465365 CTTTCAACAGAGATAGCATTTGG + Intergenic
1111326120 13:86698119-86698141 CTTCCAAATCAGAAAGCACCGGG + Intergenic
1111689672 13:91547509-91547531 CTTCCAAAACAGAAAGCACCAGG + Intronic
1112348076 13:98609445-98609467 CTTTCAACACAGAATGCGGCCGG + Intergenic
1112398767 13:99057774-99057796 CTTACAACACAGAGATCAGCAGG + Intronic
1112433296 13:99372294-99372316 CTTTCAACTCTAAGAGCACTTGG - Intronic
1112801112 13:103110591-103110613 CACTTAACACAGAAAGCACCTGG - Intergenic
1115719267 14:36142608-36142630 CTTCCAAAACACAAAGCACCAGG - Intergenic
1115878237 14:37885472-37885494 CTTTCAACACAGAGAGCACCAGG - Intronic
1116723584 14:48532227-48532249 TTTTCAAAACAGAAAGCACAAGG - Intergenic
1118841065 14:69512021-69512043 CTTCCAAAACAGAAAGCACCAGG - Intronic
1120837165 14:89050812-89050834 CTTCCAAAACAGAAAGCACTGGG + Intergenic
1121656226 14:95597812-95597834 CTTTGAACGCTGACAGCACCAGG - Intergenic
1121701845 14:95960757-95960779 CTGACAGCACAGACAGCACCTGG + Intergenic
1121895076 14:97639413-97639435 TTTTCTACACAGGGACCACCTGG - Intergenic
1122392752 14:101401607-101401629 GTTTCAACACAGAGCTCAGCTGG - Intergenic
1123150307 14:106175111-106175133 TTATAAGCACAGAGAGCACCTGG + Intergenic
1124004645 15:25786044-25786066 ATGTCATCACTGAGAGCACCAGG + Intronic
1124559709 15:30760357-30760379 GTTTTAAAACAGACAGCACCAGG + Intronic
1124671541 15:31645364-31645386 GTTTTAAAACAGACAGCACCAGG - Intronic
1124713826 15:32038891-32038913 CTTCCAAAACAGAAAGCAACAGG - Intronic
1125357124 15:38828019-38828041 CTTTCAGCCCAGAGAACCCCTGG - Intergenic
1129867663 15:78921824-78921846 CTTTCCACATATAGAGCTCCAGG - Exonic
1130096854 15:80862482-80862504 CATTCAACACACATAGGACCTGG - Intronic
1131526165 15:93154413-93154435 CTTCCAAAACAGAGGGCACAAGG - Intergenic
1131892632 15:96989174-96989196 CTTTCAGAACAGAGAGCACAAGG - Intergenic
1132022851 15:98378875-98378897 CTTCCAAAATAGAAAGCACCAGG + Intergenic
1132239926 15:100249618-100249640 CTTGGAACACAGGCAGCACCTGG - Intronic
1132487597 16:203239-203261 CTTCCAAAACAGAAAGCATCAGG + Intronic
1135836715 16:25832331-25832353 CCATGAACACAGAGAGCCCCTGG + Intronic
1136078459 16:27834548-27834570 CTTTCAAAACAGAAATCTCCAGG - Intronic
1137373898 16:47934241-47934263 CTTCCAACTCTGAAAGCACCAGG - Intergenic
1137446894 16:48537417-48537439 CCGTCACCAGAGAGAGCACCCGG - Intergenic
1137473595 16:48785851-48785873 CTTTCTAAACAGAAAACACCAGG - Intergenic
1138592220 16:58007340-58007362 CTTCCAAAACAGAAGGCACCAGG - Intronic
1140617752 16:76687686-76687708 CTTCCAAAACAGAAAGCACCAGG + Intergenic
1140768760 16:78184040-78184062 CTTCACACACAGAGAGCAACGGG - Intronic
1142186327 16:88696432-88696454 CCTCCAACACAGACAGCAGCTGG + Intergenic
1144852948 17:18253247-18253269 CTTGCAGCACAGAGAACCCCGGG - Intronic
1145956450 17:28858152-28858174 CTTCCAACAAAGAGAGCTCCAGG - Exonic
1147354329 17:39881779-39881801 CTTCCAAGACAGAAAGCATCAGG - Intergenic
1147450961 17:40503692-40503714 CTTCCAAAACAGAAAGCACCAGG - Intergenic
1150178158 17:63084110-63084132 CTTCCAAAACAGAAAGCACCAGG - Intronic
1151917827 17:77131589-77131611 CTCTGAACACAGTGAGCACTGGG - Intronic
1152330634 17:79670624-79670646 CTGTGAACCCAGAGAGGACCGGG + Intergenic
1152436466 17:80279263-80279285 GCTTCACCACAGAGAGCAGCAGG + Intronic
1152549329 17:81021491-81021513 GTTTCTCCACGGAGAGCACCGGG + Intergenic
1153782162 18:8504494-8504516 CTGTCACCACAGGGAGCACTGGG - Intergenic
1153792389 18:8590889-8590911 CTTCCAAAACAGAAAGCACCAGG + Intergenic
1154232171 18:12566712-12566734 CTTCCAAAACAGAAAGCACCAGG + Intronic
1155030452 18:21979284-21979306 CTTTTAACACAAAGCACACCAGG + Intergenic
1155575294 18:27239081-27239103 CTTTCAACCAAGAGAGCAACAGG - Intergenic
1155904462 18:31432658-31432680 CTTTCCAAACAGAAAGCAACAGG + Intergenic
1159497410 18:69224150-69224172 ATTTTAACACAGAGATAACCAGG + Intergenic
1160862737 19:1244586-1244608 CTTTCAACACAGGCAGGGCCTGG - Exonic
1163728399 19:18935458-18935480 ATTTCAACAAAGAGAGCCTCAGG + Intronic
1165059534 19:33198348-33198370 CTCCCATCACAGAGGGCACCAGG - Intronic
1165283980 19:34822931-34822953 CTTCCAAAACAGAAAGCACTAGG + Intergenic
1167234197 19:48303824-48303846 CCTCCAACACAGAGACCTCCTGG + Intronic
1167472857 19:49685056-49685078 GTTTCAACCCAGGGGGCACCTGG - Intronic
925110836 2:1335320-1335342 CTCTCAACACTGAGAGAGCCAGG - Intronic
925420430 2:3705981-3706003 AGTTCAACATAGAGAGCACGTGG + Intronic
925937719 2:8782537-8782559 TTTTCAAAACAGAAAGCACCAGG + Intronic
926432906 2:12807772-12807794 CTTTGAACACAGGCAGAACCAGG + Intergenic
926534819 2:14098839-14098861 CCTTCATCTCAGAGGGCACCAGG - Intergenic
927037727 2:19197559-19197581 ATTTCAAAACAGAAAACACCAGG + Intergenic
927625769 2:24716764-24716786 CTTTCAAAACAGAAATCACTAGG + Intronic
927771024 2:25861478-25861500 CTTTCAAAACAGAAAGCCTCAGG + Intronic
928452759 2:31391936-31391958 CCTTTAACACAGAAAGCACCAGG - Intronic
929900422 2:45996945-45996967 CTTCCAAAACAGAAAGCACTAGG - Intronic
930376867 2:50578918-50578940 CTCTCAACACTGAGGGCATCTGG + Intronic
930447618 2:51495135-51495157 CTATACACACAGAGAGCATCTGG + Intergenic
932712090 2:74073848-74073870 ATTTCAAGACAGAGAGAAGCAGG - Intronic
934126268 2:88894289-88894311 CTTTCAAAACAGAAAACACCAGG - Intergenic
934611921 2:95745515-95745537 CTTTCAAAATAGAAAGCACCAGG + Intergenic
934649057 2:96078376-96078398 CTTTCAAAACATAAAGTACCAGG - Intergenic
935890600 2:107673836-107673858 CTTTCAACACAAAAATCACGAGG - Intergenic
936069985 2:109361438-109361460 CTTTCAAAACAGAAAGAACCAGG - Intronic
937542623 2:122977416-122977438 CTTCCAAAACAGAAAGCACCAGG + Intergenic
937721729 2:125105276-125105298 TTTTTAAAACAGAAAGCACCTGG - Intergenic
937861275 2:126712862-126712884 CTTTCCACAGAGAGAGCACCGGG + Intergenic
937883594 2:126885899-126885921 CCTTCACCACAGACAGCGCCGGG + Intergenic
937970883 2:127547947-127547969 CTTTCAAAAAAGGAAGCACCAGG - Intronic
938506719 2:131892240-131892262 CTTTCTACAGACAGAACACCTGG - Intergenic
939236864 2:139505225-139505247 CTTCCAAAACAGAAAGCACCAGG + Intergenic
939650586 2:144757396-144757418 CTTCCAACTCAGATAGCATCTGG + Intergenic
940163767 2:150744222-150744244 CTTCCAAAACACAAAGCACCAGG + Intergenic
940410213 2:153354025-153354047 CTTCCAAAACAGAAAGTACCAGG - Intergenic
940472969 2:154122551-154122573 CTTCCAACAAAGAAAGCACCAGG - Intronic
940714104 2:157199131-157199153 CTTCCAAAACAGAAAACACCAGG + Intergenic
941058835 2:160821740-160821762 CTTTCAAAGCAGAAACCACCAGG - Intergenic
941060404 2:160840902-160840924 CTTCCAAAACAGAAAGCACCAGG + Intergenic
941402793 2:165051915-165051937 CTTTCAAAATAGAAAGAACCAGG + Intergenic
941603791 2:167570290-167570312 CTTCCAAAACAGAAAGCACCAGG - Intergenic
941805245 2:169706014-169706036 CTTTCAACAGAGAAAACTCCAGG - Intronic
943246858 2:185465072-185465094 TTTTCAAAACAGAAAGAACCAGG + Intergenic
943839090 2:192554711-192554733 TTTTCAACACAGACAGTCCCCGG + Intergenic
945165975 2:206945999-206946021 CTTCTAAAACAGAAAGCACCAGG + Intronic
945309265 2:208291599-208291621 TTTCCAAAACAGAAAGCACCAGG - Intronic
946381625 2:219352809-219352831 CTTTCCACACAGACAGACCCAGG - Intergenic
947834237 2:233163893-233163915 CTTTTAAAACAGTGAGCAGCTGG + Exonic
948185795 2:236020276-236020298 CTTTGAAAACAGAGAGAATCTGG - Intronic
1168761085 20:349810-349832 CTTCCAACACAGTGAGGGCCAGG - Exonic
1168819655 20:764326-764348 CTTCCAAGTCAGAAAGCACCAGG - Intronic
1168974911 20:1957494-1957516 CTTTGAAGTCAGAGAGGACCTGG + Intergenic
1168988602 20:2073666-2073688 CTTCCAAAACAAAAAGCACCAGG + Intergenic
1170378800 20:15732920-15732942 CTTCCAAAACAGAAAGCACCAGG - Intronic
1170416883 20:16153150-16153172 CTTTCAAAACAGAAAACACCAGG + Intergenic
1170751468 20:19151166-19151188 TTTTCAAAACAGAAAACACCAGG + Intergenic
1170754769 20:19190665-19190687 CTTTCAAAACATAAAGTACCAGG - Intergenic
1171404190 20:24898816-24898838 CTTTCAGCAGAGAGGGGACCTGG + Intergenic
1172311462 20:33921496-33921518 CTTTCTACACACTGAGTACCAGG + Intergenic
1172809762 20:37638838-37638860 CTTTCAAGTCAGAGAGAAACAGG + Intergenic
1173276170 20:41585592-41585614 CTTCCAACAAAGAGAACTCCAGG + Intronic
1173647782 20:44644343-44644365 CATTGAACACAGAGAGCACTAGG - Intronic
1173848865 20:46205300-46205322 CTTCCAACCCTGAGAGCACCAGG + Intronic
1173926456 20:46784753-46784775 CTTCCCACACAGAGAGAAACTGG - Intergenic
1174275410 20:49400179-49400201 CTTTTAACACAGTGAACACAGGG + Intronic
1175296138 20:57910050-57910072 CTCTCCACACAGTCAGCACCTGG + Intergenic
1176010953 20:62895210-62895232 CTGTCAATACAGAGAGCTTCTGG + Intronic
1176312757 21:5162227-5162249 ATTTCAATACAGATAGAACCAGG + Intergenic
1176312783 21:5162383-5162405 ATTTCAATACAGATAGAACCAGG + Intergenic
1176312794 21:5162461-5162483 ATTTCAATACAGATAGAACCAGG + Intergenic
1177383692 21:20380337-20380359 CTTCCAAAACAGACAGCATCAGG - Intergenic
1177962557 21:27685695-27685717 CTTTGAAAAAAGAAAGCACCAGG - Intergenic
1177985516 21:27970147-27970169 CTTTCTACAGACAGAACACCTGG + Intergenic
1178031559 21:28532915-28532937 CTTCCAAAACAGAAAGCATCAGG - Intergenic
1179572240 21:42284584-42284606 CTTTCATCAGCGAGACCACCTGG - Exonic
1179844254 21:44099569-44099591 ATTTCAATACAGATAGAACCAGG - Intronic
1179844265 21:44099647-44099669 ATTTCAATACAGATAGAACCAGG - Intronic
1179844291 21:44099803-44099825 ATTTCAATACAGATAGAACCAGG - Intronic
1180121538 21:45752684-45752706 CTGCAAACACAGAGATCACCTGG - Intronic
1181395702 22:22619753-22619775 CTTTCAACACAGAGTGTGGCAGG + Intergenic
1182056733 22:27362665-27362687 CTTCCAAAACAGAAAGCACTAGG - Intergenic
1182294859 22:29306841-29306863 CTCTCGACGCAGAGAGCCCCAGG - Intronic
1183281410 22:36934670-36934692 CTTTCACCACAGTGACCACCAGG + Intronic
1183918754 22:41146493-41146515 CTATCAACATTGAAAGCACCCGG + Intronic
949335340 3:2968697-2968719 TTTTGAACACAGAGAGCAAAAGG + Intronic
949983395 3:9518535-9518557 CTTCCAAAAGAGAAAGCACCAGG - Intronic
950618504 3:14182143-14182165 CTGGCAACACAGAGAACTCCTGG - Intronic
951134363 3:19086491-19086513 CTTTCAAAACAGAAAGCATCAGG + Intergenic
952735411 3:36686184-36686206 CTTCCAAAACAGAAAGAACCAGG + Intergenic
956091726 3:65674694-65674716 CCTTCAAACCAGAGAACACCTGG - Intronic
957016875 3:75075911-75075933 CTTTCAAAAAAGAAAGCACTAGG - Intergenic
957223363 3:77412640-77412662 CTTTGAACTCAGAGAACACTGGG - Intronic
957429427 3:80083061-80083083 CTTGAAACAGAGAGAGCAGCCGG - Intergenic
957945944 3:87063061-87063083 CTTTTAACTCAGAATGCACCAGG - Intergenic
958443788 3:94190126-94190148 CTTCCAACACAGATAGCACCTGG - Intergenic
960045043 3:113188849-113188871 CTTACAACACAGTGAGCTCTTGG + Intergenic
960756232 3:121016799-121016821 CTTCCAAAACAGAAAGCACCAGG + Intronic
960893209 3:122473239-122473261 CTTCCAAAACAGAAAACACCAGG + Intronic
961470400 3:127107712-127107734 CCTTCTACACAGAGTGCACTGGG + Intergenic
962826649 3:139105355-139105377 CTTTCACCACAGAGAGCAGGAGG - Intronic
963014878 3:140813312-140813334 CTTTCAAAACAGAAAGTACCAGG + Intergenic
963574030 3:147036942-147036964 GTTTCAAAACAGAAAGCACCAGG + Intergenic
964741863 3:159974927-159974949 CTTCCAAAACAGAGGGCAACTGG + Intergenic
966545744 3:181145564-181145586 TTTCCAAAACAGAAAGCACCAGG + Intergenic
966719744 3:183050257-183050279 CTTCCAAAACAGAAAGCACAAGG + Intronic
966771252 3:183505900-183505922 CTTTCCACAAAGAAAACACCAGG + Intronic
967763420 3:193250958-193250980 CTTTCAACAGAGAGATCTCTGGG + Intronic
970309348 4:14766009-14766031 CTTTCAGCAAATAAAGCACCTGG + Intergenic
973313722 4:48737490-48737512 CTTCCAAAAGAGAAAGCACCAGG + Intronic
973931454 4:55796647-55796669 CTTTCAACTCAGAGAGACCTGGG + Intergenic
974425139 4:61733015-61733037 TCTTCAACAAAGAGCGCACCAGG + Exonic
974662492 4:64910722-64910744 CTTTCAAAAAAGAAAGTACCAGG - Intergenic
974871449 4:67648525-67648547 GTTTCAACAGAGAGAGGGCCTGG + Intronic
975827632 4:78336558-78336580 CTTTCAACATTGAGAGCCTCAGG + Intronic
976751035 4:88451555-88451577 CTTTTGACACAGAGTGTACCTGG - Intergenic
977874662 4:102134796-102134818 ATTTAACCCCAGAGAGCACCGGG - Intergenic
977933256 4:102772058-102772080 CTTGCAAAACAGAAAGCACCAGG + Intergenic
977964548 4:103129227-103129249 TTTCCAAAACAGAAAGCACCAGG + Intronic
978526103 4:109667216-109667238 TTTCCAAAACAGAAAGCACCAGG - Intronic
980556928 4:134419625-134419647 CTTTCCAAACAGAGAGCTCCAGG - Intergenic
981555944 4:145993969-145993991 TTTGCAATACAGAAAGCACCAGG - Intergenic
982498564 4:156124503-156124525 CTTCCAAAACAGAAAGTACCAGG + Intergenic
982666209 4:158267296-158267318 TTTCCAAAACAGAAAGCACCAGG - Intergenic
983579687 4:169295381-169295403 TTTTCAAAATAGAAAGCACCAGG + Intergenic
983985050 4:174049443-174049465 TTTCCAAAACAGAAAGCACCAGG - Intergenic
984253176 4:177358784-177358806 GTTTCAACCTAGAGAGCTCCAGG - Intronic
985567486 5:627123-627145 CTTCCAAAACAGAAAGTACCAGG - Intronic
986035845 5:3937562-3937584 CTTTCAAAACATAAAGCACCAGG - Intergenic
986230262 5:5857746-5857768 GTCTCAACAGAGAGAGCATCTGG - Intergenic
986538710 5:8820489-8820511 TTTACAAAACAGAAAGCACCAGG - Intergenic
986629789 5:9760209-9760231 CTTACAAAACAGAAAGGACCTGG + Intergenic
986736026 5:10667912-10667934 CTTTCAAGACAGAGCACACTGGG - Intergenic
986911078 5:12558146-12558168 CTTTCAGTGCAGTGAGCACCAGG - Intergenic
988647874 5:33114911-33114933 CTTCCAAAACAGAAAGCACCAGG - Intergenic
989249576 5:39294577-39294599 CTTTCAACAAAGAAAGGTCCAGG + Intronic
989367676 5:40675079-40675101 CTTTCAAAACTGACAACACCTGG + Intergenic
991023534 5:62006184-62006206 CATTTAAACCAGAGAGCACCAGG - Intergenic
992533588 5:77675107-77675129 CTTCAAAAACAGAAAGCACCAGG + Intergenic
992544621 5:77800009-77800031 CTTTCAAAACAGAAAGCACAAGG + Intronic
994279558 5:97885554-97885576 CCTTCTTCACAGAGAGCACTGGG + Intergenic
995311939 5:110723137-110723159 CTTCCAAAACAGAAAGTACCAGG - Intronic
995656351 5:114431217-114431239 CTTCCAAAACAGAAAGCCCCAGG - Intronic
997599900 5:135132067-135132089 TTATCATAACAGAGAGCACCTGG - Intronic
999045362 5:148462530-148462552 CTTTCAAAACAGAAAGTACCAGG + Intronic
999580047 5:153028306-153028328 CTTTCAAAACAGAAAGCACCAGG + Intergenic
999855936 5:155593996-155594018 CTTTTAAGTCAGAGAGTACCAGG + Intergenic
1000251243 5:159497607-159497629 CAATCAAAACAGAGAGGACCGGG + Intergenic
1001316629 5:170646107-170646129 CTTTCGAAACAGAAAGCACCAGG + Intronic
1002009033 5:176261839-176261861 CTTCCAAAACAGAAAGCCCCAGG + Intronic
1002217689 5:177650439-177650461 CTTCCAAAACAGAAAGCCCCAGG - Intergenic
1003198418 6:3935946-3935968 CTTCCAAAACAGAAAGCAGCAGG - Intergenic
1004772836 6:18804790-18804812 CCTTCAAAACAGAAAGTACCAGG - Intergenic
1004776909 6:18857612-18857634 CTTTCCCCACAGAGAGCAGCAGG - Intergenic
1005225217 6:23634616-23634638 TCTTCAACTCAGAGAACACCTGG + Intergenic
1007093751 6:39200772-39200794 CAGTCAGCACAGTGAGCACCTGG - Intronic
1008094317 6:47323436-47323458 ATTTCAACTGAGAGACCACCTGG + Intergenic
1009951859 6:70406581-70406603 TTCTCAACTCAGAGATCACCAGG - Intergenic
1011505297 6:88035307-88035329 CTGTCAAAACAGAAAGCACCAGG - Intergenic
1011651492 6:89510425-89510447 CTTTATATACAGAAAGCACCTGG + Intronic
1012891866 6:104906127-104906149 CTTTCAAAACAGAAAGCACTAGG - Intergenic
1013308968 6:108875477-108875499 TTTTCAGCACAGAGACCAGCTGG - Intronic
1013651542 6:112200082-112200104 CTTACAACACTGCGAGCAGCTGG + Intronic
1014497863 6:122149393-122149415 TTTTCAAAACAGAAAGCAACAGG - Intergenic
1014654710 6:124086795-124086817 CTTTCAAAACAGAAAGCACCAGG + Intronic
1014950603 6:127550295-127550317 CTTTCAAGAAAGAAAGCACCAGG + Intronic
1016510206 6:144834146-144834168 CTTACAACACAGTTAGCAACTGG - Intronic
1016533247 6:145081887-145081909 CTGTCAAGACAGAGAACCCCAGG - Intergenic
1017909022 6:158777036-158777058 CTTTCAACACACAGTTCCCCAGG + Intronic
1018097517 6:160403411-160403433 TTTTCAAAACAGGAAGCACCAGG + Intronic
1019300212 7:299237-299259 CGTTCGACACAGAGTCCACCAGG - Intergenic
1020980227 7:15057589-15057611 CTTTTAAAACAGAGATCACCAGG + Intergenic
1021548778 7:21846830-21846852 CTTTCAAAACAGAAAGCACCAGG - Intronic
1022648981 7:32257807-32257829 CATGCAAGTCAGAGAGCACCAGG - Intronic
1023037416 7:36144603-36144625 TTTCCAAAACAGAAAGCACCAGG + Intergenic
1023181639 7:37490650-37490672 CTTTCAGCACAGTGAGGACTAGG + Intergenic
1023210708 7:37801600-37801622 ATTTCAAAACAGAGAGCACCAGG - Intronic
1023613952 7:41999586-41999608 CCTTCACCACAGAGAGCTTCAGG - Intronic
1023878129 7:44302264-44302286 TTTCCAAAACAGAAAGCACCAGG + Intronic
1023961306 7:44928550-44928572 CTTTCCATACAGAGACCCCCAGG + Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1026365475 7:69644164-69644186 CTTGCTACACAGAGAACACAGGG - Intronic
1028473280 7:91227400-91227422 CTCTCAAGGGAGAGAGCACCAGG + Intergenic
1028653159 7:93173045-93173067 CTTTCAAAAAAGAAAGCACCAGG + Intergenic
1030045164 7:105488837-105488859 TTTTCAACACAGAAAGAACTAGG - Intronic
1030423585 7:109341557-109341579 CTTCCAAAAGAGAAAGCACCAGG - Intergenic
1030722701 7:112887571-112887593 CTTTTAAAACAGGAAGCACCAGG - Intronic
1031113002 7:117634120-117634142 CTTCCAAAACAGAAAGCACCAGG - Intronic
1032634138 7:133687691-133687713 CTTTCTGCACAGTGAGCAGCAGG + Intronic
1032743187 7:134760076-134760098 CCTGCAACACACTGAGCACCTGG - Intronic
1034107247 7:148500988-148501010 CTTGAAACCCAGAGGGCACCTGG + Intergenic
1036481997 8:9148268-9148290 GTTCCAACACAGGAAGCACCAGG + Intronic
1037949796 8:23011551-23011573 GTTCCAACTCAGAGAGCCCCTGG - Intronic
1038157859 8:25007764-25007786 CTTCCAACACAGAGGGAACTTGG - Intergenic
1038323642 8:26553164-26553186 CTTCCAAAACCGAAAGCACCAGG + Intronic
1038565139 8:28613611-28613633 CTTCCAAAACAGAAAGCACCAGG - Intronic
1038752581 8:30310369-30310391 CTTTCAAAACAGAAATCACCAGG - Intergenic
1039687017 8:39814022-39814044 TTTTCAACACACACAGCTCCTGG - Intronic
1039841180 8:41294206-41294228 CTTTAAACCCTGAGAGCAGCTGG - Intronic
1039975511 8:42360771-42360793 CAGTCAACACAGAGAGATCCAGG - Intronic
1040580095 8:48690593-48690615 CTTTCAGCAGAGAGAGCGCAGGG - Intergenic
1040624240 8:49127683-49127705 CTTCCAAAACAGAAAGCATCAGG - Intergenic
1040699916 8:50050464-50050486 CTTCCAAAACAAAAAGCACCAGG + Intronic
1041033609 8:53764042-53764064 CTTACAAAACAGAAAGCAACAGG + Intronic
1041093108 8:54322284-54322306 CTTTCAAAGCACAAAGCACCAGG + Intergenic
1041339527 8:56828528-56828550 GTTCCAAAACAGACAGCACCAGG + Intergenic
1041360606 8:57049526-57049548 CTTTCAGCAAAGAGAGGACATGG - Intergenic
1042697709 8:71574990-71575012 CTTCCAACAGAGAAAACACCAGG - Intronic
1042971129 8:74409986-74410008 CTTTCTGCACAGTGAGCAGCAGG + Intronic
1043412858 8:80017613-80017635 CTTCCAAAACAGAAAGCCCCAGG + Intronic
1044537767 8:93376684-93376706 CACTCAAAACAGTGAGCACCTGG - Intergenic
1045643641 8:104279469-104279491 CTTTCTATACAGTGAGCAGCAGG - Intergenic
1046459956 8:114520439-114520461 CTTTCAACAATGAAAACACCTGG - Intergenic
1047537820 8:125735325-125735347 CTTTCAGCACAGAGGGAACACGG - Intergenic
1048134362 8:131733288-131733310 CTTTCATAAGAGAAAGCACCAGG + Intergenic
1048388881 8:133941138-133941160 CTTCCAAAACAGAAAGCATCAGG + Intergenic
1048548661 8:135412666-135412688 CTTTCAGAAAAGAAAGCACCAGG - Intergenic
1048930532 8:139311888-139311910 CTGTCAAGACAGAAAGCACATGG + Intergenic
1048988892 8:139749965-139749987 CTGGCAACACAGAGACGACCAGG + Intronic
1049784341 8:144443480-144443502 CTGTCACCACAGAGAGCCCTTGG - Intronic
1050111731 9:2223848-2223870 CTTCCAAAACAGAAAGCACCAGG - Intergenic
1050695340 9:8273353-8273375 CTTCCAAAACAGAAAGCACCAGG - Intergenic
1051983220 9:23049481-23049503 TTTTCAAAACAGAAACCACCAGG + Intergenic
1052694970 9:31866083-31866105 CTTTCAACAAAGAAAACTCCAGG - Intergenic
1053098886 9:35352606-35352628 GGATCAACAGAGAGAGCACCAGG + Intronic
1053409790 9:37908467-37908489 CTATCAACACTCAGAGCACTTGG - Intronic
1055378453 9:75678262-75678284 CTTTCAAAACAGAGACCACTGGG + Intergenic
1056212544 9:84378515-84378537 CTTCCAAAACAGAAAGTACCAGG - Intergenic
1056427917 9:86496770-86496792 CTTCCAAAATAGAAAGCACCAGG - Intergenic
1056983114 9:91335200-91335222 CTTTCCACACAGAAAGCACCGGG - Intronic
1057199047 9:93130717-93130739 CTTTCAAAACAGTGAGAGCCAGG - Intronic
1057287504 9:93771323-93771345 CTTCCAAAACAGAAAGCATCAGG + Intergenic
1058490870 9:105497491-105497513 TTTCCAAAACAGAAAGCACCAGG - Intronic
1187770334 X:22688721-22688743 CTCTAAACACAGTGACCACCAGG - Intergenic
1187784089 X:22865198-22865220 CTTTCCACAAAGAGAACTCCAGG + Intergenic
1191817876 X:65268366-65268388 CTTTCAAAAAAGAGAGCTACAGG + Intergenic
1192836826 X:74808695-74808717 CTTCCAAAACAGAAAGCACCAGG - Intronic
1192903869 X:75528702-75528724 CTTCCAAAACAGAAATCACCAGG - Intergenic
1194517493 X:94873970-94873992 CTTTCAACAAAGAAAGGCCCGGG + Intergenic
1196852731 X:119953871-119953893 CTTCCAGAACAGAAAGCACCTGG - Intergenic
1197030861 X:121813296-121813318 TTTTCGACATAGAAAGCACCAGG - Intergenic
1197539357 X:127737172-127737194 CATCCAAAACAGAAAGCACCTGG + Intergenic
1199544379 X:148992097-148992119 CTTTGCACACAGAGAACCCCAGG - Exonic
1199864763 X:151833225-151833247 CTTACAAAACAGAAAGCACCAGG + Intergenic
1200001696 X:153065450-153065472 CGTTCAACACACATAGCACCTGG + Intergenic
1200175305 X:154110643-154110665 CTTCCAAAAAAGAAAGCACCAGG - Intergenic
1201473823 Y:14360069-14360091 TTATGAACACAGAGATCACCTGG + Intergenic
1201856678 Y:18552356-18552378 GTTGGAACATAGAGAGCACCAGG + Intronic
1201876643 Y:18768024-18768046 GTTGGAACATAGAGAGCACCAGG - Intronic
1202170548 Y:22039097-22039119 GTTGAAACATAGAGAGCACCAGG - Intergenic
1202220816 Y:22547276-22547298 GTTGAAACATAGAGAGCACCAGG + Intergenic
1202300053 Y:23403621-23403643 CTTTGATCATAGAGAGCCCCAGG + Intergenic
1202322297 Y:23648387-23648409 GTTGAAACATAGAGAGCACCAGG - Intergenic
1202548473 Y:26021669-26021691 GTTGAAACATAGAGAGCACCAGG + Intergenic
1202570757 Y:26266977-26266999 CTTTGATCATAGAGAGCCCCAGG - Intergenic