ID: 1115882893

View in Genome Browser
Species Human (GRCh38)
Location 14:37939926-37939948
Sequence CCTACAATGTAAAATGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 305}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115882890_1115882893 17 Left 1115882890 14:37939886-37939908 CCACTCACTGGCTGTGTCACTTA 0: 1
1: 2
2: 10
3: 119
4: 755
Right 1115882893 14:37939926-37939948 CCTACAATGTAAAATGAGAATGG 0: 1
1: 0
2: 1
3: 22
4: 305
1115882888_1115882893 28 Left 1115882888 14:37939875-37939897 CCCTGGCTCTGCCACTCACTGGC 0: 1
1: 7
2: 41
3: 235
4: 884
Right 1115882893 14:37939926-37939948 CCTACAATGTAAAATGAGAATGG 0: 1
1: 0
2: 1
3: 22
4: 305
1115882889_1115882893 27 Left 1115882889 14:37939876-37939898 CCTGGCTCTGCCACTCACTGGCT 0: 3
1: 43
2: 229
3: 986
4: 3103
Right 1115882893 14:37939926-37939948 CCTACAATGTAAAATGAGAATGG 0: 1
1: 0
2: 1
3: 22
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115882893 Original CRISPR CCTACAATGTAAAATGAGAA TGG Intronic
901082332 1:6590574-6590596 GCTACAATCTGAGATGAGAAAGG + Intergenic
901666587 1:10829711-10829733 CATACACTGTGAAGTGAGAAGGG + Intergenic
902708355 1:18221965-18221987 CCTCATCTGTAAAATGAGAAGGG - Intronic
904797699 1:33069828-33069850 CTTACAATATAGAATGAGAGTGG - Intronic
906206660 1:43990907-43990929 CCTACAATGTTGAATGAAAAAGG - Exonic
907025298 1:51111956-51111978 TCTAAAAGGTAAAATGAGGATGG - Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
908519511 1:64927562-64927584 CCTATAATGTAAAAGGAGACAGG - Intronic
909205234 1:72748096-72748118 CCTACTATTTAAAATGTAAATGG + Intergenic
909434811 1:75628845-75628867 CCTACACTATAACATGGGAAAGG + Intergenic
909635876 1:77816847-77816869 CCTCAAATGTAGAATAAGAATGG + Intronic
911284759 1:95975624-95975646 CATCCAATGTAAAATCTGAAAGG + Intergenic
912221253 1:107679121-107679143 CATACAATAACAAATGAGAATGG + Intronic
914373934 1:147055484-147055506 CCTCAAATGTAAAAAGAAAATGG + Intergenic
915651448 1:157314624-157314646 CCCACAAAGTAAAAACAGAATGG + Intergenic
917221435 1:172733227-172733249 CATACAATGTGTAATGATAAGGG - Intergenic
918175825 1:182044414-182044436 CCTAGAAAATAAAATGAGAGAGG - Intergenic
918220489 1:182432207-182432229 CCTCCACTATAAAATGAGGACGG - Intergenic
919278497 1:195452626-195452648 CATACAATGTAATCTGAAAATGG - Intergenic
919396804 1:197059766-197059788 CCTACAATTTAATATGAGGAGGG - Intronic
919689780 1:200518838-200518860 TATAAAATGTTAAATGAGAAAGG + Intergenic
921445438 1:215241793-215241815 CCTAATATGTAAAATGACGATGG + Intergenic
923805820 1:237256766-237256788 TCTAAAATGCAAAGTGAGAACGG + Intronic
924219883 1:241863221-241863243 CCTCATCTGTAAAATGAGAATGG - Intronic
924325812 1:242892847-242892869 CTTTCAATGTAAAATGTGATGGG + Intergenic
924469505 1:244328906-244328928 CCTATAATGGAAAAGGAGGAAGG - Intergenic
924498304 1:244611676-244611698 CCTTCAATGAAAAATCAGGAGGG - Intronic
1063249161 10:4254834-4254856 ACAACAAAGTAACATGAGAAGGG + Intergenic
1064636318 10:17371481-17371503 TCTACAGTGAAGAATGAGAAGGG + Intronic
1065263655 10:23952665-23952687 CCTAACCTGTAAAATGGGAATGG + Intronic
1067250617 10:44583373-44583395 CAGACAATGTAAAATCATAATGG - Intergenic
1067701551 10:48576813-48576835 ACTAAAATGTAAAATCAAAAAGG - Intronic
1067961662 10:50859753-50859775 CCTAAGATGCAAAATGGGAATGG - Intronic
1068286116 10:54937872-54937894 AGTACAATGTCAAATGGGAATGG + Intronic
1068330823 10:55565632-55565654 ACTACAATGAGAAATGAAAATGG + Intronic
1069297624 10:66866851-66866873 GCTACAATTTAAGATGAGTATGG - Intronic
1071928927 10:90443497-90443519 CTAACAAAGAAAAATGAGAAAGG + Intergenic
1072553534 10:96496964-96496986 CTTACAATGTAATATGTGAATGG - Intronic
1073590286 10:104750895-104750917 CCTATATTCTAGAATGAGAATGG + Intronic
1073952908 10:108831325-108831347 CCTATATTATAAAATCAGAAAGG + Intergenic
1074704842 10:116121444-116121466 CCTAAAATGGAAAAGGAAAAAGG + Intronic
1076355593 10:129850667-129850689 CCTGCAATTTAAAAAGAGAGGGG - Intronic
1077664088 11:4092828-4092850 GCTACAAAGTAACATGAAAATGG - Exonic
1078373623 11:10773905-10773927 CCTTCATTGTCAAATGACAATGG + Intronic
1078402983 11:11044499-11044521 CCTCAACTGTAAAATGAGGATGG + Intergenic
1079756564 11:24272309-24272331 CCTACAATTTAAAACAAAAATGG + Intergenic
1080730087 11:34941746-34941768 TCTAGAATTTAAAAAGAGAAAGG + Intronic
1080883425 11:36343867-36343889 TCTACATTGTAAAAAGAGCATGG - Intronic
1081048190 11:38303285-38303307 CCTACAATTTACAAAGAGAGAGG - Intergenic
1086231196 11:84571991-84572013 CTCTCCATGTAAAATGAGAATGG - Intronic
1088232641 11:107688539-107688561 GCTACAAAGTAAAATTACAAAGG - Intergenic
1088488507 11:110364673-110364695 CCCAAAATGTGAAATGAGCAAGG + Intergenic
1088512391 11:110591187-110591209 CTTACAGTGTAAGAAGAGAATGG + Intronic
1089637437 11:119824410-119824432 CCTCATCTGTAAAATGAGAATGG - Intergenic
1091320167 11:134643721-134643743 CCTCCTCTGTAAAATGAGAATGG + Intergenic
1091905599 12:4185947-4185969 CCTATAATTTAAAATGTTAATGG + Intergenic
1091954038 12:4622011-4622033 CCTACAATGCAATAAGAAAATGG + Intronic
1093506764 12:19875777-19875799 AGTACAATGTTAAAAGAGAATGG + Intergenic
1093953037 12:25185601-25185623 CTTATAATGAAAAATGAGATAGG - Intronic
1094392008 12:29962002-29962024 ACTTAAATGTAAAAGGAGAAAGG - Intergenic
1094462251 12:30708993-30709015 TCTCAAATGTAAAATGTGAATGG - Intergenic
1094487467 12:30936492-30936514 CCTACAATGATAAATGAGGAGGG + Intronic
1095656509 12:44675735-44675757 CATCCTATGTAAAATGGGAAAGG + Intronic
1095855108 12:46851840-46851862 CATACAATAAAAAATGATAAAGG + Intergenic
1096041134 12:48518529-48518551 CCTATAATGGAAAAAGAAAAGGG + Intronic
1096969027 12:55650759-55650781 ACTACAATTCAAAATGAGATTGG - Intergenic
1097015740 12:55985962-55985984 CCTTCAACCAAAAATGAGAAAGG + Intronic
1098468027 12:70810722-70810744 CCTAAAATTTTAAATGACAATGG + Intronic
1098532978 12:71561835-71561857 CTTACATTGTAATAAGAGAAGGG - Exonic
1101849570 12:108391354-108391376 CCTCAACTATAAAATGAGAATGG + Intergenic
1101912261 12:108869058-108869080 CCTCCTAAGTAAAATGGGAAGGG - Intronic
1102615604 12:114151594-114151616 CCTACAATTCAAGATGAGATTGG - Intergenic
1103365340 12:120378428-120378450 AATACTATGTAAAATGAAAAGGG + Intergenic
1103402266 12:120650944-120650966 TCTAGGATGTAAAATGAAAAGGG + Intronic
1105069208 12:133224272-133224294 CAGACAATGTAAAAAGAAAAAGG + Intronic
1107902070 13:45026902-45026924 CCTCCTTTGTTAAATGAGAAAGG + Intronic
1109639075 13:65163394-65163416 CATAAAATAAAAAATGAGAAAGG + Intergenic
1110129342 13:71987683-71987705 CCAAGAATCTAAAATGAAAATGG + Intergenic
1110816643 13:79867678-79867700 CCTACTCAGTAAAAGGAGAATGG + Intergenic
1111226755 13:85283727-85283749 CCAGCAAAGTAAAAGGAGAATGG + Intergenic
1112970846 13:105260299-105260321 CCTACAAGGTGAAACGAGACAGG + Intergenic
1114345643 14:21791756-21791778 ACTGCAAAGGAAAATGAGAATGG + Intergenic
1115688630 14:35822938-35822960 ACAATACTGTAAAATGAGAAAGG + Intergenic
1115882893 14:37939926-37939948 CCTACAATGTAAAATGAGAATGG + Intronic
1116130987 14:40855474-40855496 CATACAATGTTAAATGTTAAGGG + Intergenic
1116135063 14:40912515-40912537 CCTAATCTATAAAATGAGAATGG + Intergenic
1117408055 14:55424021-55424043 CCTGGAATGAAAAATAAGAAAGG - Intronic
1118887164 14:69877231-69877253 CCTACAAGGTGAACTGAGACTGG - Intronic
1118931739 14:70248386-70248408 CTTACAATGAAAAATGAAAATGG + Intergenic
1119117551 14:72039850-72039872 CATACAAAAGAAAATGAGAAAGG - Intronic
1122185807 14:99994409-99994431 CATACAATGGGAAATGATAAGGG - Intronic
1123786973 15:23684099-23684121 CCCACAATTTTAAATGATAACGG + Intergenic
1124667031 15:31601748-31601770 CACACAATGGAAAATGATAAAGG + Intronic
1125922147 15:43531310-43531332 CCTACAGAGTGAAATGAAAACGG + Exonic
1126204693 15:46032531-46032553 CGTACTATGTAAAATAGGAATGG + Intergenic
1126538315 15:49793599-49793621 CCTACAATTTTGAATGAAAATGG + Intergenic
1126999379 15:54483836-54483858 CCTACAATGCAAAATGCCACTGG + Intronic
1127020657 15:54744297-54744319 ACTACTATGTTAAATAAGAATGG - Intergenic
1127128336 15:55835546-55835568 GATACAATGGAAAATGTGAAAGG - Intronic
1127759536 15:62124854-62124876 CCTAAAAGGAAAAATGAGAGAGG - Intergenic
1128650169 15:69405954-69405976 CTTCCTATGCAAAATGAGAAGGG + Exonic
1128708144 15:69852227-69852249 CCTGCAAGGAACAATGAGAAGGG + Intergenic
1131023622 15:89121223-89121245 CCTTCTATGTAAAATGAAATAGG + Intronic
1131503841 15:92998295-92998317 CCCATTTTGTAAAATGAGAACGG + Intronic
1133400580 16:5483504-5483526 TCTACAAAGTAAAATCAGAAGGG - Intergenic
1134160351 16:11883305-11883327 CCTATAATTTAAAAAGAAAATGG + Intronic
1134753015 16:16641262-16641284 AGTTCAATGTAAAATGACAAAGG - Intergenic
1134993042 16:18717814-18717836 AGTTCAATGTAAAATGACAAAGG + Intergenic
1136492915 16:30622205-30622227 CCCACATTGGGAAATGAGAAGGG - Intronic
1137026298 16:35478886-35478908 CTTTCAAGGTAAAAAGAGAAAGG - Intergenic
1138219472 16:55238654-55238676 ACTCCAATGTCACATGAGAAGGG - Intergenic
1139206165 16:65030971-65030993 CCTACAATGTAAAAGGCCTAAGG + Intronic
1144481295 17:15631604-15631626 CCTCCAATGTAAGTTGTGAACGG - Exonic
1144917010 17:18732127-18732149 CCTCCAATGTAAGTTGTGAACGG + Exonic
1146136724 17:30328474-30328496 CTTACAATTCAAAATGACAAAGG + Intronic
1146798048 17:35796505-35796527 ACTACATTGTAAAATGCAAATGG + Intronic
1147347319 17:39809359-39809381 CCTACCAGTCAAAATGAGAAAGG + Intronic
1151263283 17:72933855-72933877 TCTAAAATGTGAAAGGAGAAAGG + Intronic
1153167273 18:2276341-2276363 CCTACCAAGTAAAATAGGAAAGG - Intergenic
1155415419 18:25593590-25593612 ACTACAATGTAAACTGATAATGG + Intergenic
1155858849 18:30870587-30870609 CCTATACTGTAACATCAGAAAGG - Intergenic
1156191163 18:34722088-34722110 AATACAATTTTAAATGAGAAAGG - Intronic
1156602392 18:38624678-38624700 CATACAAGGTAGAATGTGAAGGG - Intergenic
1156754707 18:40508325-40508347 CCTATAAAGTAAAATGTGAAAGG - Intergenic
1157210606 18:45739068-45739090 CCTACAATGTAATTTTAGATTGG - Intronic
1157316847 18:46598284-46598306 CTTACAATATAAAAGTAGAAGGG + Intronic
1162273644 19:9636307-9636329 CCTACAAAGTACATTCAGAAGGG + Intronic
1164104495 19:22095771-22095793 CCTACATTACTAAATGAGAAAGG + Intergenic
1166141994 19:40810244-40810266 CCTACAATGGATCATTAGAATGG - Intronic
1166501976 19:43348386-43348408 CCTAAAGTGTATAAAGAGAAAGG - Intergenic
1166508140 19:43385065-43385087 CCTAAAGTGTATAAAGAGAAAGG + Intergenic
1167462499 19:49633240-49633262 CCTTCAATGTATATCGAGAAGGG - Intergenic
925320518 2:2963038-2963060 TATACAAAATAAAATGAGAAAGG - Intergenic
926350040 2:11985803-11985825 TCTCCAGTGTAAAATGAGATTGG - Intergenic
927385482 2:22528388-22528410 CTGACAATATAAAATGACAATGG - Intergenic
927704606 2:25289398-25289420 CCTACAAAGTTAAATAAGATTGG - Intronic
928140027 2:28720306-28720328 CATAGAATGTAAAATTAGAAGGG - Intergenic
928187164 2:29121899-29121921 CCTGGAATGTGAAATGAGATTGG + Intronic
929938193 2:46310303-46310325 CCTAGAATCCAGAATGAGAAAGG - Intronic
930420232 2:51142277-51142299 GTTAAAATGTAAAATGAAAAAGG - Intergenic
930631399 2:53758370-53758392 CCTACAAGGGAAAAGGACAAAGG + Intronic
931480694 2:62636559-62636581 GATACAATAAAAAATGAGAAAGG + Intergenic
931631090 2:64300253-64300275 CCTACCATGTAAGCAGAGAAAGG - Intergenic
933622114 2:84554909-84554931 CCTATAATAGGAAATGAGAAGGG - Intronic
936745139 2:115566859-115566881 CCTGTAATATTAAATGAGAATGG - Intronic
936907763 2:117556628-117556650 CCCAGGTTGTAAAATGAGAAGGG - Intergenic
938863524 2:135394671-135394693 ACTACACTGTAAAATTAAAATGG + Intronic
940506912 2:154567152-154567174 CATAAAATGTAAAATTACAACGG - Intergenic
941356606 2:164500837-164500859 CCTTCAATGGAAAAAGACAAGGG + Intronic
943405650 2:187480434-187480456 TTTCCAATGTAAAATGAGGATGG - Intronic
944231828 2:197402826-197402848 CCTAAAATGTAAACAAAGAAAGG + Exonic
944736496 2:202571661-202571683 CCTGTACTGTAAAATGAGCATGG + Intergenic
944963559 2:204903143-204903165 CTTACATTTTAAAATGAGAAAGG + Intronic
945640749 2:212426064-212426086 CAGACATTGTAAAATGTGAAAGG - Intronic
946838188 2:223793942-223793964 CCTACAATTTTTAAAGAGAAAGG + Intronic
948073429 2:235146089-235146111 ACTACAATTCAAAATGAGATTGG + Intergenic
948293639 2:236845492-236845514 CCCACAATGCCAAATCAGAAGGG + Intergenic
1169354265 20:4894374-4894396 CCTCCAATGCAAAAAGACAACGG + Intronic
1169763175 20:9119494-9119516 CTTACAGTGTATAAAGAGAAAGG + Intronic
1170516496 20:17135634-17135656 CCAACAAGGTACTATGAGAAAGG - Intergenic
1171443930 20:25190086-25190108 TATACAATGTAAAATGCTAAAGG + Intergenic
1173120299 20:40282794-40282816 CCTACAAAGAAAAACGACAAAGG + Intergenic
1175034888 20:55990881-55990903 CCTCCAATGTAAAAAAAAAATGG - Intergenic
1175969948 20:62680388-62680410 AGTACAATGTCAAATGGGAACGG + Intronic
1176889222 21:14294078-14294100 CCTTAAATGTAAAAACAGAATGG + Intergenic
1177214414 21:18109936-18109958 GGTACAATATAAAAGGAGAAAGG + Intronic
1177784236 21:25653189-25653211 CATACAATAATAAATGAGAAGGG + Intronic
1179096094 21:38315608-38315630 CATACTTTGTAAAAAGAGAATGG + Intergenic
1181378739 22:22482149-22482171 GCTATAATGCAAAATAAGAAAGG - Intergenic
1182039794 22:27228546-27228568 TCTCCATTATAAAATGAGAATGG - Intergenic
1182177639 22:28308247-28308269 CCTAAAAAGTGAAATGAAAAAGG - Intronic
1183641955 22:39098122-39098144 CCTCCTCTGTAAGATGAGAATGG + Intronic
1184307661 22:43617534-43617556 CCAAGTATGTAAAATGAGGAAGG - Intronic
949207300 3:1455289-1455311 TCCACATTGTAAAATGTGAAGGG - Intergenic
950611457 3:14129658-14129680 CCTAGATTTTAAAAAGAGAAAGG + Intronic
951629982 3:24709207-24709229 CCTAGAAAGTAGAATGTGAATGG + Intergenic
952321361 3:32280791-32280813 CCTTCAATGTAATTTGAGTAGGG - Intronic
952582720 3:34853599-34853621 TCTTCAATATCAAATGAGAAAGG + Intergenic
952684163 3:36130513-36130535 CCTCAAATTCAAAATGAGAAAGG + Intergenic
954096640 3:48333815-48333837 CCTACAAAGGAAAAGGACAAAGG - Intergenic
955916464 3:63912566-63912588 CCTACAATGTAACAAAAAAAAGG - Exonic
956122650 3:65981594-65981616 GCTACAATTCAAGATGAGAAGGG - Intronic
956206612 3:66761554-66761576 CCTCATATGTAAAATGAGAAGGG + Intergenic
956802317 3:72771116-72771138 AGTAGAATGTAAAATGAGGAAGG - Intronic
957513632 3:81222844-81222866 CATAGAATGGAAAATAAGAATGG - Intergenic
957876467 3:86153468-86153490 CCAATAATGTTAACTGAGAAGGG - Intergenic
958605678 3:96355710-96355732 ACTAAATTGAAAAATGAGAAAGG + Intergenic
959993189 3:112651577-112651599 CCTACAATGTAATATCTGAATGG + Intergenic
960193636 3:114738422-114738444 TTTATAATGTAAAATGACAAGGG + Intronic
960209292 3:114940160-114940182 GTCACAGTGTAAAATGAGAAAGG + Intronic
961303247 3:125935801-125935823 ACTAAAATGTACAATGAAAATGG - Intronic
962453293 3:135539928-135539950 CATACAATGAGAGATGAGAATGG + Intergenic
962577031 3:136764116-136764138 GCTACAATTCAAGATGAGAATGG - Intergenic
962824294 3:139085529-139085551 CCTACAAATTAAAAAGAAAAAGG - Intronic
963984515 3:151576226-151576248 TCTAAAATGTATAATGAAAATGG - Intergenic
964277615 3:155024829-155024851 TCTACAATGAAAAATAAAAATGG + Intronic
964444884 3:156748381-156748403 TCTTTAATGTAAAGTGAGAAGGG + Intergenic
964822262 3:160784509-160784531 CACACAATGTAAAATGAGGTCGG + Intronic
965877619 3:173346758-173346780 TATACAATGTGCAATGAGAAAGG - Intergenic
966086812 3:176078349-176078371 CCTACAATTTTGAAGGAGAAGGG - Intergenic
966091719 3:176146156-176146178 ATTACACTGTCAAATGAGAAAGG - Intergenic
966570506 3:181437321-181437343 TCTATAATGTAGAATGAGTACGG + Intergenic
967194890 3:187017562-187017584 CCTACAAAGAAAAAGGGGAAGGG - Intronic
967991550 3:195135310-195135332 CCTCCTGTGTAAAATGAGAAAGG - Intronic
968124764 3:196150810-196150832 CCTACAATGTGAAATGAACACGG - Intergenic
968198866 3:196734754-196734776 GATAAAATGTAAAAGGAGAATGG - Intronic
969152258 4:5179641-5179663 GCTACAAGTTAAAAGGAGAAAGG + Intronic
970316551 4:14833500-14833522 CCCAGAATGTAAACTGAGAATGG + Intergenic
970327937 4:14947363-14947385 CCTAAAAGCAAAAATGAGAAAGG - Intergenic
970814075 4:20132765-20132787 CTAACTATGTAAAATGTGAAAGG + Intergenic
971660949 4:29415099-29415121 CCTACAATGTAATTAGAAAATGG + Intergenic
972324883 4:38006027-38006049 CCTGCTATGTAAAATGAGAAAGG - Intronic
972755867 4:42045354-42045376 ACAACAATGAAAAATGATAAAGG + Intronic
973145098 4:46815446-46815468 CATACAATATAAAAAGAAAAAGG - Intronic
975181326 4:71349029-71349051 CCTACACTGTTAAAGGAAAATGG - Intronic
975341588 4:73248143-73248165 CCTTCAAGGTAAAATTAGAATGG + Intronic
976888429 4:90014158-90014180 CCTAAAATGTAAAATTAACAAGG - Intergenic
976893551 4:90080138-90080160 CCTAAAATGTGAAAGAAGAATGG + Intergenic
976967588 4:91063719-91063741 CCTAAAATCTACAATTAGAATGG + Intronic
977886341 4:102256607-102256629 CCTAAAATGTTTAATGATAATGG + Intronic
978037879 4:104018974-104018996 ACTACAATGTAAATTGTTAAGGG - Intergenic
978165190 4:105598482-105598504 AATACAAAGTAGAATGAGAAAGG - Intronic
978180245 4:105785781-105785803 TCTACATTGGAAAAAGAGAAGGG + Intronic
978311800 4:107392541-107392563 CCTGCAGTAGAAAATGAGAATGG - Intergenic
979095316 4:116541632-116541654 CATGCAATATAAAATGAAAATGG + Intergenic
979353218 4:119670423-119670445 CCTTGTCTGTAAAATGAGAATGG + Intergenic
979551244 4:121993385-121993407 CCTCAAATGTAAATTGAAAAGGG + Intergenic
981731119 4:147899832-147899854 CCTACATTTTATTATGAGAAGGG - Intronic
981770252 4:148300251-148300273 CATAGAATGTCAAACGAGAAAGG - Intronic
982394994 4:154906896-154906918 CCTGCAATGCAAAAGGAGACCGG - Intergenic
985099797 4:186447500-186447522 CCCACAACTTAAAATGAGATGGG + Intronic
985167653 4:187114501-187114523 CCAATAGTGTAAAGTGAGAATGG - Intergenic
985186854 4:187326893-187326915 GCTACAATTTAAGATGAGATTGG + Intergenic
986289828 5:6390861-6390883 ACTACAATCCAAGATGAGAATGG - Intergenic
987014299 5:13801549-13801571 CCAAGATGGTAAAATGAGAAAGG - Intronic
989233124 5:39110125-39110147 TGTACAATTTTAAATGAGAAGGG + Intronic
989692595 5:44162413-44162435 CCTTCATTCTCAAATGAGAATGG + Intergenic
989692603 5:44162517-44162539 CCTTCATTCTCAAATGAGAATGG + Intergenic
989692605 5:44162543-44162565 CCTTCATTCTCAAATGAGAATGG + Intergenic
989692607 5:44162569-44162591 CCTTCATTCTCAAATGAGAATGG + Intergenic
990844732 5:60123790-60123812 GCTTCAGAGTAAAATGAGAAAGG - Intronic
992713293 5:79483207-79483229 CATACAATTGAAAATAAGAATGG + Intronic
994784976 5:104147078-104147100 TTTAAAAAGTAAAATGAGAAAGG + Intergenic
995141169 5:108737131-108737153 ACTACAATGCGAAATGAGAATGG + Intergenic
995307263 5:110667689-110667711 CCTCACCTGTAAAATGAGAATGG + Intronic
995435571 5:112131286-112131308 CCTCCTTTGTAAAATGAGTATGG + Intergenic
995446794 5:112253873-112253895 ATTACCATGTAAAATGTGAAAGG + Intronic
998975976 5:147648474-147648496 CCTACAAAGAAAAATTAAAATGG + Exonic
999917597 5:156280352-156280374 AAAACAATGTACAATGAGAATGG + Intronic
999996231 5:157095035-157095057 CCTTCACTGTAAAATGGGGATGG + Intronic
1000453336 5:161418302-161418324 CCAGGAATGTAATATGAGAAAGG - Intronic
1004326262 6:14676471-14676493 CCTCACCTGTAAAATGAGAAGGG + Intergenic
1004792901 6:19048255-19048277 CCTAATATGCAAAAAGAGAAAGG - Intergenic
1006808926 6:36807345-36807367 CCTCCTCTGTAAAATGGGAATGG + Intronic
1008885539 6:56428835-56428857 CAGACAATGTCAAATGAGGAGGG - Intergenic
1009874061 6:69483479-69483501 GATACAATGAAAAATGATAAAGG + Intergenic
1010715649 6:79226347-79226369 TCTCATATGTAAAATGAGAACGG + Intronic
1012102584 6:95109006-95109028 ACTACAATGTAAACTGATATAGG - Intergenic
1012200670 6:96402503-96402525 GCTTCAGTGTTAAATGAGAAAGG + Intergenic
1013692074 6:112657719-112657741 TCTATTTTGTAAAATGAGAATGG - Intergenic
1014003102 6:116386858-116386880 TCTACTATGTTAAATGGGAAAGG - Intronic
1015358048 6:132303935-132303957 ACTACAAGCAAAAATGAGAATGG - Intronic
1015606845 6:134966186-134966208 ACTACAACCTAAAATGAGTAAGG + Intronic
1016650943 6:146459564-146459586 CCTACATTGGAAAAGTAGAAAGG - Intergenic
1017221105 6:151967075-151967097 ACTGCAATGAAAAAGGAGAATGG - Intronic
1017479337 6:154834739-154834761 CCTGCAAGGTAAACTGAGTAGGG + Intronic
1018588359 6:165387892-165387914 CATACAGTGTAAAAAAAGAAAGG + Intronic
1019200176 6:170307419-170307441 CCCACAATGTAGAAAGAAAAGGG + Intronic
1019301722 7:307856-307878 ACCACAATGCAAAATGAGGAGGG + Intergenic
1021911924 7:25394387-25394409 TCTTCAATCTCAAATGAGAAAGG - Intergenic
1021933839 7:25609756-25609778 ACAACAAGGTAAAATAAGAATGG + Intergenic
1022266182 7:28757193-28757215 CCTCCTCTGTAAAATAAGAATGG - Intronic
1025873638 7:65459336-65459358 CCTTAACTGTAAATTGAGAATGG - Intergenic
1026953330 7:74361695-74361717 CCTGATGTGTAAAATGAGAATGG - Intronic
1027997391 7:85441772-85441794 GCTACAATGTTAATTGAGAAAGG - Intergenic
1028733644 7:94181646-94181668 CATAAAATGTTAAATGAGGAGGG - Intergenic
1030216917 7:107053302-107053324 CCTACAATATAAATTTTGAAAGG + Intronic
1030831539 7:114228752-114228774 TATACAAAATAAAATGAGAAAGG + Intronic
1030889286 7:114979308-114979330 ACTAAAATGGAAAATGGGAACGG - Intronic
1030952217 7:115805154-115805176 CCCACAATGCAAAATGGAAAAGG + Intergenic
1031024742 7:116667937-116667959 CCCTCAATGTAAACCGAGAAGGG + Intergenic
1033963271 7:146940599-146940621 CCAACAAGGTATCATGAGAATGG - Intronic
1034206405 7:149319507-149319529 ACTACAATAGAAGATGAGAAGGG - Intergenic
1036533866 8:9625701-9625723 ACTAGAAAGTAACATGAGAAAGG - Intronic
1040780299 8:51099265-51099287 CCTACATTGAAAAATGACATTGG + Intergenic
1041108304 8:54462409-54462431 CCTGTACTTTAAAATGAGAAAGG - Intergenic
1042551337 8:69996445-69996467 CTTACATTTTAAAATTAGAAAGG - Intergenic
1042560256 8:70068666-70068688 CAGACCATGTAAAATGAGCAGGG - Intronic
1043471261 8:80565630-80565652 CCTAAAAAGTATAGTGAGAATGG - Intergenic
1044019573 8:87087833-87087855 CCTCATCTGTAAAATGAGAAAGG - Intronic
1044469445 8:92549736-92549758 CTTACAATTTAAAATCAAAATGG - Intergenic
1044710333 8:95051225-95051247 TTTACAAGGTAAAAGGAGAAAGG + Intronic
1045930791 8:107624270-107624292 CAAACAAAGAAAAATGAGAATGG - Intergenic
1048812196 8:138298827-138298849 TCTGAAATGCAAAATGAGAAAGG + Intronic
1048812334 8:138300196-138300218 TCTGAAATGTGAAATGAGAAAGG - Intronic
1048878178 8:138852833-138852855 TCTTAAATGTCAAATGAGAAGGG + Intronic
1050417393 9:5431983-5432005 CCTAAAATGTAAAAAAAGCAAGG + Exonic
1050464451 9:5906863-5906885 CCTGAAATGTAAATTGATAAAGG - Exonic
1053493118 9:38526543-38526565 CATAGAATGTAAAATGATAGAGG + Intergenic
1055585658 9:77756812-77756834 CCTTATCTGTAAAATGAGAAGGG + Intronic
1055648247 9:78381124-78381146 CATACAATCTAAAATAGGAATGG - Intergenic
1055682037 9:78725096-78725118 CCTACAGTGTCAGTTGAGAAGGG - Intergenic
1055789225 9:79903776-79903798 CCTAAAATGCAAAATGTAAAAGG - Intergenic
1056960859 9:91121798-91121820 GCTACAATTTAAGATGAGATTGG - Intergenic
1057017661 9:91666739-91666761 CTTAAAATGTGAAATGAGACCGG - Intronic
1058241228 9:102563441-102563463 CCTATAATTTAAAATAAAAAGGG + Intergenic
1058299894 9:103358865-103358887 CCTCCAATTTAACATGAGATTGG + Intergenic
1059620411 9:115998478-115998500 CCTTCTGTGTAAAATGAGAATGG + Intergenic
1059788643 9:117615628-117615650 CCTAATCTGTAAAATGGGAATGG - Intergenic
1186096800 X:6111070-6111092 CCTATATCTTAAAATGAGAATGG - Intronic
1187121900 X:16417317-16417339 CCTCACCTGTAAAATGAGAATGG - Intergenic
1188087708 X:25921216-25921238 ACTACAAAGTCACATGAGAAAGG + Intergenic
1188448493 X:30283652-30283674 CCAACAATTTGAAATGACAAAGG - Intergenic
1188488151 X:30705644-30705666 AGTACAATGTACAATGAGGAAGG + Intronic
1191647251 X:63495382-63495404 GACACAATGAAAAATGAGAAAGG + Intergenic
1191795967 X:65021817-65021839 GCTGCAATATAAAATGATAAAGG + Intronic
1193506878 X:82355574-82355596 CATAAAATGTGAAATGAGCAGGG - Intergenic
1194404461 X:93477674-93477696 CCTACATTAAAAAATAAGAAGGG + Intergenic
1194945691 X:100064247-100064269 TCTCCAATGTAGGATGAGAAGGG + Intergenic
1195005048 X:100677618-100677640 CCTACAAAGAAAACTGAGAAGGG + Intronic
1195737021 X:108022573-108022595 CATACAATGTTAAATAGGAATGG + Intergenic
1195935847 X:110125094-110125116 TTTACATTGTAAAATGAGGACGG + Intronic
1196315541 X:114218420-114218442 CCTATGATCTAAAAAGAGAATGG - Intergenic
1196919276 X:120569281-120569303 CCTACATTGCCAATTGAGAATGG - Intronic
1196996833 X:121393086-121393108 CATAAAATGTAAAAAGAGACTGG - Intergenic
1197600881 X:128527996-128528018 CCTACATTGAGAAATTAGAAAGG + Intergenic
1199971075 X:152861989-152862011 CATACAATGTTGAATAAGAATGG + Intronic
1201223261 Y:11791387-11791409 CTTTCAATGTAAAATGTGATGGG + Intergenic
1201934086 Y:19387141-19387163 CCTAAAAAGTACAATCAGAAGGG - Intergenic