ID: 1115889554

View in Genome Browser
Species Human (GRCh38)
Location 14:38011573-38011595
Sequence CCCGGCAGGTTCCCCAAGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 93}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115889554_1115889561 -9 Left 1115889554 14:38011573-38011595 CCGGACTTGGGGAACCTGCCGGG 0: 1
1: 0
2: 1
3: 17
4: 93
Right 1115889561 14:38011587-38011609 CCTGCCGGGTGGTGTGGGGCTGG 0: 2
1: 15
2: 34
3: 153
4: 918
1115889554_1115889567 24 Left 1115889554 14:38011573-38011595 CCGGACTTGGGGAACCTGCCGGG 0: 1
1: 0
2: 1
3: 17
4: 93
Right 1115889567 14:38011620-38011642 ACAGAAGAAGACAGCAAGATGGG 0: 1
1: 3
2: 27
3: 153
4: 801
1115889554_1115889566 23 Left 1115889554 14:38011573-38011595 CCGGACTTGGGGAACCTGCCGGG 0: 1
1: 0
2: 1
3: 17
4: 93
Right 1115889566 14:38011619-38011641 CACAGAAGAAGACAGCAAGATGG 0: 1
1: 3
2: 16
3: 139
4: 878
1115889554_1115889568 25 Left 1115889554 14:38011573-38011595 CCGGACTTGGGGAACCTGCCGGG 0: 1
1: 0
2: 1
3: 17
4: 93
Right 1115889568 14:38011621-38011643 CAGAAGAAGACAGCAAGATGGGG 0: 9
1: 577
2: 1959
3: 1943
4: 1640

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115889554 Original CRISPR CCCGGCAGGTTCCCCAAGTC CGG (reversed) Intronic
901221787 1:7587564-7587586 CCTCGCAGCTTCCCCATGTCAGG + Intronic
901849426 1:12006299-12006321 CCTGGCAGCTTCCCCGAGTGTGG - Intronic
901941726 1:12667388-12667410 ACAGGTAGGTTCACCAAGTCAGG + Intergenic
902583458 1:17423728-17423750 TCCGTCAGTTTCCCCACGTCAGG - Intronic
902935417 1:19761428-19761450 TCCGGCAGGATCCAAAAGTCTGG - Intronic
902994517 1:20213264-20213286 CCAGGCAGGTTCCTGAAGGCAGG + Intergenic
907389039 1:54144585-54144607 CCCAGCAGGTTGCCCTTGTCTGG + Exonic
914267684 1:146052136-146052158 CCCTGCAGTTTCCCCAAATGTGG - Intergenic
915244805 1:154549004-154549026 CCAGGCAGTTGTCCCAAGTCTGG + Exonic
922886054 1:229021607-229021629 TCCTGCAGTTTCCCCCAGTCTGG + Intergenic
924775104 1:247111133-247111155 CCCGGCGGGTACCCCGAGTCCGG - Exonic
1064782368 10:18856671-18856693 CCCAGCAGGTACCCCGAGTCCGG + Intergenic
1067695684 10:48534116-48534138 CCAGCCAGGTTCCCCAGCTCGGG + Intronic
1069647015 10:70007776-70007798 CCCTGCATGTTCTCCAAGCCAGG - Intergenic
1070570813 10:77638259-77638281 CGCGGCAGGTTCACCGCGTCCGG + Intronic
1074703979 10:116115398-116115420 CCTGGCAGGTTCCCAGAGTCAGG + Intronic
1075597948 10:123746018-123746040 CCCTGGAGGTTCCCCAGGTAGGG - Exonic
1078522940 11:12077846-12077868 CCCTGCAGGTTCCCTAACACTGG - Intergenic
1080668705 11:34357576-34357598 CTCGGCAGGCTCCCCATGGCCGG - Exonic
1084290651 11:68163945-68163967 CTCTGCAGGTGCCACAAGTCAGG - Intronic
1084797622 11:71519020-71519042 CCGGGCAGGTTCCTCAAGCCCGG - Intronic
1090629504 11:128633766-128633788 CCATGCAGGTGCTCCAAGTCAGG + Intergenic
1106754742 13:32811261-32811283 CCCTGCAGGTCCCCCAGGTCAGG + Intergenic
1107247918 13:38319747-38319769 CCCAGCGGGTACCCCGAGTCCGG + Intergenic
1111195373 13:84869689-84869711 CCCAGCAGGTATCCCAAGTCTGG - Intergenic
1115889554 14:38011573-38011595 CCCGGCAGGTTCCCCAAGTCCGG - Intronic
1116683794 14:48011733-48011755 CCCGGCGGGTACCCCGAGTCCGG - Intergenic
1118068964 14:62224149-62224171 CCTGGCAGTTTCCCAATGTCTGG + Intergenic
1122823862 14:104360246-104360268 CCAGGCAGTTTCCCCAACCCAGG - Intergenic
1123123969 14:105931226-105931248 CCAGGCAGATTTCCCAAATCCGG - Intronic
1133111384 16:3550087-3550109 CGCAGCAGGCTCCCCAAGTGTGG + Intronic
1134001783 16:10788520-10788542 CCCGTAAGGTACCCGAAGTCCGG + Intronic
1137553641 16:49456643-49456665 CCTGTCAGGTTCCCAAAGTTGGG - Intergenic
1139651778 16:68365815-68365837 CCTGGCAGGATCCCAAAGGCTGG + Intronic
1141749241 16:85947113-85947135 CCTGCCAGGTTCCCCAAGCCTGG - Intergenic
1141932894 16:87217439-87217461 CCTGACAGCTTCCCCAAGCCAGG + Intronic
1142283052 16:89159522-89159544 CCCGGCAGGTGCCTCCAGTGTGG - Intergenic
1143499585 17:7330792-7330814 CCCTGCAGGTCCCCCAGGCCCGG - Intergenic
1145796963 17:27661147-27661169 CCTGGCTGGTTCCACAAGCCTGG + Intergenic
1150675660 17:67244774-67244796 CCCGGCACGTTCCCCTCCTCCGG - Intronic
1152592071 17:81218650-81218672 CCAAGCAGGTTCCCAAAGCCTGG - Intronic
1153135573 18:1913510-1913532 CCCGGCAGTTGCCTCAACTCTGG - Intergenic
1153388469 18:4527644-4527666 CCCAGCGGGTACCCCGAGTCCGG + Intergenic
1155270843 18:24139776-24139798 CCCCACACGTTCCCAAAGTCGGG + Intronic
1155868543 18:30996904-30996926 CCCGGCAGGATTCCAAGGTCTGG + Exonic
1155874497 18:31069007-31069029 CCCGGCAGGATTCCGAGGTCTGG + Exonic
1157340313 18:46772179-46772201 TCCTCCAGGTTCCCCAAGTGTGG - Intergenic
1163636069 19:18437701-18437723 CCCGGCAGGTGCCCCGGCTCGGG - Exonic
1165431666 19:35776442-35776464 CCCATAAGGTTCCCCAAGGCAGG - Intronic
1168269699 19:55242680-55242702 CCCGGAAGGCTCCCCAGGACAGG + Intronic
932042941 2:68319384-68319406 CCCGGCAGGTCCCCCATGTCTGG + Exonic
932213282 2:69948925-69948947 CCAGGCAGGCTCCCCAAGTGGGG - Intergenic
933066809 2:77808138-77808160 CCCAGTGGGTACCCCAAGTCCGG - Intergenic
933362355 2:81304456-81304478 CCCAGCTGGTACCCCAAGTCCGG + Intergenic
935147809 2:100408053-100408075 CTTCCCAGGTTCCCCAAGTCGGG + Intronic
939138994 2:138330997-138331019 ACTGGCAGATGCCCCAAGTCAGG + Intergenic
943833208 2:192487900-192487922 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
943960439 2:194256185-194256207 CCCGGCCGGTACCCCGAGTCCGG + Intergenic
948879860 2:240851138-240851160 CCCGTCAGGATTCCCAAGGCAGG + Intergenic
1170924672 20:20712319-20712341 CCCGGCAGGTGCCCCTAACCCGG + Intronic
1172694485 20:36812819-36812841 TCCGGCAGGTCCCTGAAGTCAGG + Exonic
1173688332 20:44939566-44939588 CCCTGCAGGGTGCCCAAGCCAGG - Intronic
1176135674 20:63521049-63521071 CCCACCAGGTTCCCGACGTCTGG + Intronic
1177833860 21:26169818-26169840 CCCCGCGCCTTCCCCAAGTCTGG - Intronic
1183035058 22:35135005-35135027 CCAGGCACCTTCCCCAAGTCTGG - Intergenic
1183989340 22:41587793-41587815 CCGGCCAGGCTCCCCAAGTGCGG + Intronic
1184606460 22:45577285-45577307 CCAGGCAGGATCCCCCACTCTGG - Intronic
950742752 3:15063364-15063386 CCCAGCAGGTACCCAAAGACTGG + Intronic
950866850 3:16196467-16196489 ACAGGCAGGTTCTGCAAGTCTGG - Intronic
951649317 3:24932068-24932090 CCAAGCAGGCTCCCCAAGTTGGG - Intergenic
954323446 3:49847771-49847793 TCCTGCAGGTACCCCAAGTTGGG + Intronic
958814496 3:98901270-98901292 GCCCGCAGTGTCCCCAAGTCCGG - Exonic
969855871 4:9999255-9999277 CTCGCCATGTTCCCCAAGGCTGG + Intronic
971132046 4:23822340-23822362 CCCTGAAGGCTCTCCAAGTCAGG + Intronic
975321404 4:73012656-73012678 CCTGGGAGTTCCCCCAAGTCAGG + Intergenic
975652854 4:76611777-76611799 ACGGGCAGTCTCCCCAAGTCAGG - Intronic
976306544 4:83565694-83565716 CCCGGTGGGTACCCCGAGTCCGG + Intronic
979126607 4:116980760-116980782 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
982646191 4:158027321-158027343 CCAGGAAGGTTCTCCAAGCCTGG + Intergenic
983327431 4:166274578-166274600 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
986948896 5:13058196-13058218 CACCTCAGGTTCCCCAAGTACGG + Intergenic
988848648 5:35156610-35156632 CCGGGCAGGTTCCTGAGGTCAGG + Intronic
990500293 5:56389905-56389927 ACCAGCAGGTCCCCCAGGTCTGG + Intergenic
998407608 5:141882920-141882942 CCCGCCTGGTTCCCCAAATCGGG - Intergenic
1002180237 5:177427347-177427369 GCCAGGAGTTTCCCCAAGTCAGG - Intronic
1002286495 5:178165941-178165963 CCCGGCCAGCTCCACAAGTCGGG - Intergenic
1007427836 6:41758823-41758845 CCCGGCAGGTTAGCCAGGTATGG + Intergenic
1007533596 6:42564490-42564512 CACAGCTGTTTCCCCAAGTCTGG - Intronic
1009888851 6:69656322-69656344 CCAGGCAGGTTCTCCAGGCCTGG + Intergenic
1011099412 6:83706297-83706319 CCCATCAGTTTCCCCAACTCTGG - Intronic
1013113659 6:107084125-107084147 CCCGTCTGTTTCGCCAAGTCTGG - Intronic
1018846620 6:167561312-167561334 ACTTGCAGGTTCCCCAAGGCAGG + Intergenic
1019119966 6:169794567-169794589 CCAGGCAGGCTCCCCAAGCCAGG + Intergenic
1020203944 7:6101272-6101294 CACTGCAGGCTCCCTAAGTCTGG + Intergenic
1020225002 7:6272734-6272756 CCCGGCCGGTTCCCGAGGGCGGG - Intergenic
1020939216 7:14509780-14509802 CCCAGCAGGTACCCCGAGTCTGG - Intronic
1024230760 7:47361466-47361488 CCCAGCACGTTCCCCAACTCTGG + Intronic
1027627629 7:80564743-80564765 CCAGGCAGGTCCTCCAGGTCTGG - Intronic
1028192262 7:87867028-87867050 CCCAGTGGGTACCCCAAGTCTGG - Intronic
1029080769 7:97972255-97972277 CCCGGCCGGGTCCCCACCTCGGG + Intergenic
1030639032 7:111983590-111983612 GCATCCAGGTTCCCCAAGTCTGG - Intronic
1030809413 7:113956321-113956343 CTGGGCAGGTTCTCCAGGTCTGG - Intronic
1039620994 8:38996971-38996993 CCCTGCCGGGGCCCCAAGTCTGG - Exonic
1043229892 8:77788436-77788458 CCATGCAGGTCCCCCAGGTCTGG - Intergenic
1045553908 8:103196712-103196734 CCAGGGAGGTTCACCAAGCCAGG - Intronic
1050589576 9:7148249-7148271 ACCTTCAGGTTCCCCAAGCCAGG - Intergenic
1058885518 9:109319612-109319634 CTCGGCAGGCGCCCCAAGTTTGG - Intronic
1059395199 9:114029949-114029971 CCCGGCAGGTGGCCCAGGGCTGG - Intronic
1061538381 9:131263854-131263876 GCCTGCAGGTTCCCTGAGTCTGG - Intronic
1196932613 X:120696359-120696381 CCGGGCAGGTTCTCCAGGCCTGG + Intergenic
1200899735 Y:8417383-8417405 CTGGGCAGGTTCTCCAGGTCTGG + Intergenic
1202113909 Y:21451813-21451835 TCCGGCAGGTACCCCGAGTCCGG + Intergenic