ID: 1115889554

View in Genome Browser
Species Human (GRCh38)
Location 14:38011573-38011595
Sequence CCCGGCAGGTTCCCCAAGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 93}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115889554_1115889568 25 Left 1115889554 14:38011573-38011595 CCGGACTTGGGGAACCTGCCGGG 0: 1
1: 0
2: 1
3: 17
4: 93
Right 1115889568 14:38011621-38011643 CAGAAGAAGACAGCAAGATGGGG 0: 9
1: 577
2: 1959
3: 1943
4: 1640
1115889554_1115889566 23 Left 1115889554 14:38011573-38011595 CCGGACTTGGGGAACCTGCCGGG 0: 1
1: 0
2: 1
3: 17
4: 93
Right 1115889566 14:38011619-38011641 CACAGAAGAAGACAGCAAGATGG 0: 1
1: 3
2: 16
3: 139
4: 878
1115889554_1115889561 -9 Left 1115889554 14:38011573-38011595 CCGGACTTGGGGAACCTGCCGGG 0: 1
1: 0
2: 1
3: 17
4: 93
Right 1115889561 14:38011587-38011609 CCTGCCGGGTGGTGTGGGGCTGG 0: 2
1: 15
2: 34
3: 153
4: 918
1115889554_1115889567 24 Left 1115889554 14:38011573-38011595 CCGGACTTGGGGAACCTGCCGGG 0: 1
1: 0
2: 1
3: 17
4: 93
Right 1115889567 14:38011620-38011642 ACAGAAGAAGACAGCAAGATGGG 0: 1
1: 3
2: 27
3: 153
4: 801

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115889554 Original CRISPR CCCGGCAGGTTCCCCAAGTC CGG (reversed) Intronic