ID: 1115890449

View in Genome Browser
Species Human (GRCh38)
Location 14:38021553-38021575
Sequence TCTTGTCTCTAAAATGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 7, 3: 41, 4: 390}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115890446_1115890449 -10 Left 1115890446 14:38021540-38021562 CCAGTCCTTGTTTTCTTGTCTCT 0: 1
1: 0
2: 0
3: 70
4: 936
Right 1115890449 14:38021553-38021575 TCTTGTCTCTAAAATGTGGATGG 0: 1
1: 0
2: 7
3: 41
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115890449 Original CRISPR TCTTGTCTCTAAAATGTGGA TGG Intronic
900873332 1:5322169-5322191 TCTTGTCACTAAGTTGGGGATGG + Intergenic
902430601 1:16360141-16360163 TGTTGTGTCTAAACTGTGAAAGG + Intronic
902721267 1:18305839-18305861 TCCTTTCTGTAAAATGAGGACGG - Intronic
902890051 1:19436535-19436557 TCTTCTATCTAAAATTTTGAAGG + Intronic
903193006 1:21667344-21667366 TCTTGTCTCCTAAGGGTGGAAGG + Intronic
903817792 1:26077664-26077686 TCTCATCTGTAAAATGGGGATGG - Intergenic
905972090 1:42149635-42149657 TCTTGACTCTGAAATCTGCAGGG - Intergenic
906815978 1:48879456-48879478 TCTTGTCTATACAAAGTGTAAGG - Intronic
908285533 1:62594711-62594733 TATTGTTTCTACAATGTGTAAGG + Intronic
908392945 1:63699868-63699890 ACTTGACTCGAGAATGTGGAAGG - Intergenic
908648921 1:66310835-66310857 TCTTATCTGTAAAATGGGGAAGG + Intronic
909484613 1:76159052-76159074 TCTTGTCCCTAAAATGGGAAAGG - Intronic
909686268 1:78352806-78352828 TCTTGCCTCTAAAATGTCATTGG - Intronic
910286235 1:85557415-85557437 TCTCATCTCTCAAATGAGGATGG - Intronic
913117969 1:115713931-115713953 TCTTGTCTTTCAAATGTTGGAGG + Intronic
913355565 1:117917560-117917582 CCTCATCTCTAAAATGGGGATGG - Intronic
916389305 1:164313636-164313658 TCCTGTCTATAAAATGGGGCTGG - Intergenic
917985898 1:180318261-180318283 TTTTATCTTTAAAATGTTGAGGG - Intronic
919210076 1:194471093-194471115 TCTGGTCTTTTAATTGTGGAAGG + Intergenic
920104446 1:203541407-203541429 TTTAGTCTCTAAAGTGGGGAAGG + Intergenic
920501702 1:206489746-206489768 TCTCATCTATAAAATGGGGAGGG - Intronic
920618130 1:207514711-207514733 TCTTATCTCTAAAATATGTTAGG - Intronic
921247923 1:213265529-213265551 TCTACTGACTAAAATGTGGAAGG - Intronic
921307407 1:213810817-213810839 TCTTATCTGTAAAATGAGGATGG - Intergenic
921374331 1:214458575-214458597 TCTTATCTGTAAAATGGAGATGG - Intronic
921485589 1:215712142-215712164 TCATATTTCTAAAATGTGGTAGG + Intronic
922023354 1:221727035-221727057 GCTTGTCTATAAAATGGGGAGGG - Intronic
922714654 1:227860709-227860731 TATCCTCTCTGAAATGTGGAGGG + Intergenic
923071865 1:230573050-230573072 TGTTGTGTCTAAACTGTGAAGGG + Intergenic
924362880 1:243259521-243259543 TCTTGTTTTTAAAATGAGGTTGG + Intronic
1063521870 10:6748606-6748628 TCTGGTATCTAAAGTGGGGACGG - Intergenic
1063771594 10:9209350-9209372 TTTTGTCTCTAAAATGTGCATGG - Intergenic
1064485225 10:15781299-15781321 TCATGTATCTAAATTGTGGAAGG - Intronic
1064672183 10:17726892-17726914 TCATTTCTATAAAAGGTGGATGG + Intergenic
1066092499 10:32038432-32038454 TCTTGTTTATAAAATGTGGGTGG - Intronic
1066305252 10:34134072-34134094 GCCTGTCTCAAAAGTGTGGAGGG - Intronic
1067688231 10:48480750-48480772 TCTCATCTGTAAAATGTGGTTGG - Intronic
1068814354 10:61293000-61293022 TCTTGTCTCTCAAAAATGCAGGG - Intergenic
1069132925 10:64728617-64728639 TCTGATCTGTAAAATGGGGATGG + Intergenic
1069223507 10:65912102-65912124 TCTTGTATCTAAAAATTGGTGGG - Intergenic
1069231600 10:66016119-66016141 TATTGTCTCTAAAATGAGTTTGG - Intronic
1071042499 10:81330625-81330647 TCTTGTTTCTAAACTGTTGAAGG + Intergenic
1071418202 10:85460890-85460912 TCTAGTCAATAAAATGTGAAGGG - Intergenic
1072250109 10:93574930-93574952 TCCAGTCACCAAAATGTGGAAGG + Intronic
1072484940 10:95846086-95846108 TCTTGTCTTCAAAATGCAGAAGG - Intronic
1073189131 10:101637754-101637776 CCTTATCTCTAAAAGGAGGAGGG - Intronic
1073831174 10:107385068-107385090 TCTTGTTTCTAAAGAGTGGGAGG - Intergenic
1074358069 10:112803369-112803391 ACTTCTCTCTAAAATGAAGAAGG - Intronic
1074596945 10:114876453-114876475 CCTTATCTGTAAAATGGGGATGG + Intronic
1074687622 10:115974833-115974855 TCTTCTCTCTACAGAGTGGAGGG - Intergenic
1074913886 10:117937647-117937669 TCTCATCTGTAAAATGTTGATGG - Intergenic
1075080334 10:119379243-119379265 TCTAGTCTGTAAACTGCGGACGG - Intronic
1075242312 10:120790367-120790389 TCTTGTCTCTACTCTGAGGAAGG - Intergenic
1075683457 10:124348387-124348409 TTTTGTCTGTAAATTCTGGAGGG - Intergenic
1076479984 10:130778537-130778559 TCTGGTCTCTCAAATGTGCTTGG + Intergenic
1077812065 11:5648169-5648191 TCTTCTTCCTAGAATGTGGATGG - Intergenic
1077852609 11:6088174-6088196 TCTTTTCTGTAAAATGTGCTAGG - Intergenic
1079400301 11:20101613-20101635 CCTTCTCTGTAAAATGGGGATGG - Intronic
1079479667 11:20865998-20866020 TCTTTTCAGTAAAATGGGGATGG + Intronic
1080197944 11:29633511-29633533 ACTTTTCTGCAAAATGTGGAAGG + Intergenic
1080357237 11:31464203-31464225 TCTTGTCTATAAATTGAGGATGG - Intronic
1081917520 11:46742391-46742413 CCTTGTCTCAAAAAAGAGGAGGG - Intergenic
1083237937 11:61363847-61363869 TCTCATCTGTAAAATGGGGAAGG + Intronic
1084146584 11:67268131-67268153 TCTCATCTGTGAAATGTGGATGG + Intronic
1085453943 11:76655385-76655407 TCAGTTCTCTAAAATGAGGATGG + Intergenic
1085483839 11:76845154-76845176 TCTTATCTATAAAATGAGGATGG + Intergenic
1085523269 11:77150403-77150425 TCTTGTTTGTAAAATTAGGAGGG + Intronic
1085708843 11:78811134-78811156 CCTTGTCTATAAAATGGGAATGG - Intronic
1085876924 11:80418754-80418776 CCTTGTCTGTAAAATGGGAAGGG + Intergenic
1086564433 11:88209392-88209414 TCTGGCCAATAAAATGTGGAGGG + Intergenic
1087369706 11:97267621-97267643 TCTAGTCTCTTATATATGGATGG + Intergenic
1088739797 11:112757885-112757907 TCTTCTCTGTAAAATGGGAATGG + Intergenic
1089911184 11:122102103-122102125 GCTTGTCTCCAAGATATGGAAGG - Intergenic
1090281091 11:125456366-125456388 TCTATTCTCAAAAATGGGGATGG + Intronic
1090428999 11:126630312-126630334 CCTTGTCTATAAAATGAGAATGG - Intronic
1090429734 11:126635716-126635738 CCTTATCTGTAAAATGTGGCTGG + Intronic
1091056659 11:132425475-132425497 TTTTATGTATAAAATGTGGAAGG + Intronic
1092324173 12:7511551-7511573 TCTTGTCTTTAAAATTTGTTAGG - Intergenic
1092728274 12:11505382-11505404 TCTTGTCTGGAAAATGGGGTTGG - Intergenic
1093305253 12:17508952-17508974 ACATGTCTCTAGAATGTGAAAGG - Intergenic
1093654131 12:21675505-21675527 TCTGGTCTCCAAAATGTGTGAGG - Intronic
1093806827 12:23444353-23444375 TCTTGTCTCTAGAATATAAAAGG + Intergenic
1094675193 12:32612761-32612783 TCTTGTGTCTAAAATATCTATGG + Intronic
1096618152 12:52846282-52846304 CCTTGTCTCCAGGATGTGGATGG - Exonic
1097440173 12:59598258-59598280 TCTTGTCTATAAAATGAGATTGG + Intronic
1098546636 12:71718826-71718848 TCTTGCCTCTGAAAAGAGGAGGG - Intergenic
1099098726 12:78409405-78409427 TCTTTTCTCCAAAATGTCCAAGG + Intergenic
1099657543 12:85513652-85513674 CCTTGTCTCTAGAATCTGGAAGG - Intergenic
1099813404 12:87614870-87614892 TCTTGCCTCTACAATCTGGGTGG + Intergenic
1099979998 12:89587873-89587895 TCTTGCCTCTAAAATGAGAGTGG - Intergenic
1100271783 12:93032399-93032421 CCTTGTCTATAAAATGGGCATGG - Intergenic
1100820889 12:98428544-98428566 TCTTATCTCTAAAACGGGGATGG - Intergenic
1101504199 12:105331039-105331061 TCCTGTCCCGAAAATGGGGACGG - Intronic
1102946648 12:116995294-116995316 TCTCTTCTGTAAAATGAGGAGGG + Intronic
1103240035 12:119405404-119405426 TCTTGACTCTGAAATGAGCATGG + Intronic
1104098947 12:125588228-125588250 CCTTATCTATAAAATGGGGATGG + Intronic
1104379586 12:128295434-128295456 TCTCATCTGTAAAATGGGGATGG - Intronic
1104528717 12:129548848-129548870 TCTTGTTTGTAAAATGAGAAAGG - Intronic
1104791284 12:131483649-131483671 CCATGTCTCAATAATGTGGAGGG + Intergenic
1106502943 13:30346747-30346769 ACTTGCCTCTAAATTTTGGAAGG + Intergenic
1106685929 13:32058975-32058997 CATTGACTCTAAAATGTAGATGG + Intronic
1107129619 13:36881233-36881255 GCTGGTTTCTAAAATCTGGAAGG - Intronic
1107145680 13:37058493-37058515 TCTTGTCACTAAATTGGGGATGG + Intronic
1107303531 13:38993144-38993166 TCTCATCTGTAAAATGGGGATGG + Intergenic
1107413340 13:40177799-40177821 GCTTCTCTCTAAAATGTTGAGGG - Intergenic
1107741861 13:43459177-43459199 TCATCTGTCTAAAATGTTGATGG - Intronic
1108735018 13:53274521-53274543 TCTTATCTCAAAAGTGAGGAAGG - Intergenic
1108932603 13:55846460-55846482 TTTTTTCTCTAAAATGTAGATGG + Intergenic
1109041823 13:57348238-57348260 TCTTGTGTCTAAAGACTGGAAGG + Intergenic
1109642996 13:65216357-65216379 TTTTGTTTCTAAAACATGGAAGG - Intergenic
1109652042 13:65340279-65340301 TGTATTCTCTAAAATGTGAATGG - Intergenic
1109874581 13:68383660-68383682 TCTTGTCTCTAAAATGTCTAGGG + Intergenic
1110097214 13:71542769-71542791 TTTTCTCTATAACATGTGGATGG - Intronic
1110240714 13:73263465-73263487 TCTTGCCTCTAAAAACTGGAAGG + Intergenic
1111263917 13:85781720-85781742 TCTTGTTTCTGAAATGTCTAAGG + Intergenic
1111649893 13:91076247-91076269 CCTTCTCTGTGAAATGTGGAAGG + Intergenic
1112047933 13:95616431-95616453 TCATGTGTCTGAAATGTGGTTGG - Intronic
1113918567 13:113889913-113889935 TCTGGTCCTCAAAATGTGGAGGG - Intergenic
1114411354 14:22503532-22503554 TCTCATCTGTAAAATGGGGATGG + Intergenic
1114539897 14:23447195-23447217 TCTTATCTGTAAAATGTGGATGG + Intergenic
1115890449 14:38021553-38021575 TCTTGTCTCTAAAATGTGGATGG + Intronic
1116162149 14:41281639-41281661 TTTTGTCTTAAAAATGTGAATGG - Intergenic
1116449337 14:45047690-45047712 CCTTGTCTATAAAATTAGGAAGG + Intronic
1117278480 14:54213626-54213648 TCCTATCTCTGAATTGTGGATGG - Intergenic
1118948864 14:70415957-70415979 TATCATCTCTAAAATGGGGATGG - Intronic
1119391753 14:74295681-74295703 TCTTGTCTCTAAAGTGGAAATGG - Intronic
1119574389 14:75705578-75705600 TTTAATCTATAAAATGTGGATGG + Intronic
1120016749 14:79482624-79482646 TGTTGTCTGTGAAATGTAGATGG - Intronic
1120281250 14:82441223-82441245 TCTTGTTTCTAAATGTTGGAGGG + Intergenic
1120300172 14:82695806-82695828 TCCTGTGAGTAAAATGTGGATGG + Intergenic
1120319349 14:82939712-82939734 TCTCATCACTAAAATGGGGATGG + Intergenic
1121096920 14:91223853-91223875 GCTTATCTGTAAAATGGGGAGGG - Intronic
1121319856 14:92985894-92985916 TCCTATCTGTAAAATGGGGAGGG - Intronic
1121647629 14:95530701-95530723 TCCTGTCTCCAAGATGTGGGCGG + Intergenic
1121743621 14:96270793-96270815 TATAGCCTCTAAAATGAGGAAGG + Intergenic
1122094130 14:99358935-99358957 TCTTCTCTGTAAAGTGAGGAAGG - Intergenic
1122609666 14:102973300-102973322 TCTGTTCTCTAAAATGTGCCAGG - Intronic
1126678711 15:51183981-51184003 TGTTGTCTGAAAAGTGTGGAGGG + Intergenic
1126909725 15:53404907-53404929 TCTTATCTGTAAAATGCAGATGG + Intergenic
1127302602 15:57670762-57670784 TCTTTTCTCTAATATGTTGGTGG + Intronic
1128603224 15:69015368-69015390 TCTTGTTTCTGAAAAGTGGGAGG + Intronic
1128891098 15:71332432-71332454 TCTTGGCTGTAAAATGCAGAAGG + Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130754846 15:86752392-86752414 CTTTGTCTTTAAAATCTGGATGG - Intronic
1130926177 15:88387592-88387614 CCTTATCTGTAAAATGGGGATGG + Intergenic
1131885236 15:96905208-96905230 TCATTTCTCTAGAATGTAGATGG + Intergenic
1132000754 15:98177682-98177704 ACTTTTCTCTAAAGTATGGAAGG - Intergenic
1133395421 16:5443206-5443228 TCCTATCTCTAAAATGAGCACGG - Intergenic
1133713954 16:8429024-8429046 TCTAACCTCTAAAATGTGGCTGG - Intergenic
1134108483 16:11500199-11500221 TCTGGTCTCTATAAGGAGGATGG - Intronic
1134351662 16:13443427-13443449 TGTTATCTATAAAATGGGGATGG + Intergenic
1134433898 16:14237264-14237286 TCTCCTCTCTAAAATGTTGGAGG - Intronic
1134861918 16:17567982-17568004 ACCAGTCTCTAAAATGGGGATGG - Intergenic
1135838541 16:25851558-25851580 TCTGGTCACTAAAATGTGCAGGG - Intronic
1137571666 16:49570332-49570354 TCTTATCTGTAAAATGGGGATGG - Intronic
1137699314 16:50484912-50484934 CCCTGTCTGTAAAATGGGGAGGG - Intergenic
1137864652 16:51880679-51880701 TGTTCTCTGTAAAATGTAGATGG - Intergenic
1138265874 16:55659055-55659077 GCTTGTCTCTAGACAGTGGAAGG + Intronic
1138472873 16:57252092-57252114 TCTTGCCTCTGACATGGGGAAGG - Intronic
1138835629 16:60431105-60431127 TCCTATCTGTAAAATGAGGAAGG - Intergenic
1139372260 16:66476423-66476445 CCTTGTCTGTAGAATGGGGATGG + Intronic
1139658250 16:68402258-68402280 TCTCCTCTATAAAATGGGGAAGG + Intronic
1140788168 16:78363711-78363733 TCTTGTTTCTAACAGGTTGAGGG - Intronic
1141880598 16:86856530-86856552 TCTTGTCTCTTCCATGGGGATGG - Intergenic
1144391264 17:14795561-14795583 TCTTGTCTGTAAAATGGAAATGG - Intergenic
1144757356 17:17687700-17687722 TCTTCTGTCAAAAATGTGAACGG + Intronic
1144950449 17:18990881-18990903 TCCTGTCTATAAAATGGGAAAGG - Intronic
1146472275 17:33134191-33134213 TCTTATATGTAAAATGGGGATGG - Intronic
1146654580 17:34627379-34627401 CCTTGTCTGTAAAATGTCTAAGG - Intronic
1146691275 17:34877891-34877913 TCCTGCCTGTAAAATGTGAAGGG + Intergenic
1146950415 17:36901518-36901540 TCTTGTCTGTAAAATGGGGATGG - Intergenic
1150298490 17:64028557-64028579 TCTTGTCTATAACATGAAGAAGG - Intergenic
1150553824 17:66235663-66235685 TCTTTTCTCTGAAATGTGGTTGG - Intronic
1151308502 17:73279277-73279299 TCCTATCTCTAAAATGAGCAGGG + Intergenic
1152655746 17:81518518-81518540 TCCTATCTCAAAAACGTGGAAGG + Intronic
1154238853 18:12633061-12633083 TCTTATCTATAAAATGTTAATGG - Intronic
1156625913 18:38908932-38908954 ACAAGTCCCTAAAATGTGGAAGG + Intergenic
1156823222 18:41398171-41398193 TGTTCTCTCTAAAATGTGAAAGG - Intergenic
1157380256 18:47208073-47208095 TCTTATCTATAAAATGTGGATGG - Intergenic
1158001412 18:52623460-52623482 TTTTGTTTCTAAAGTGTGGGGGG + Intronic
1159160850 18:64642083-64642105 TGTTGTCTCAGAAATGTGCAAGG - Intergenic
1159442758 18:68502848-68502870 CCTTGTCTGCAAAATGGGGATGG - Intergenic
1159936441 18:74371907-74371929 TCTTGTCTAAAAACTGTTGAGGG - Intergenic
1160377925 18:78428051-78428073 TCTAGTCTCAAATATGTGGCAGG + Intergenic
1163088407 19:15000437-15000459 TCTTCTCACTTATATGTGGAAGG - Intronic
1164690316 19:30206097-30206119 CCTTCTCTATAAAATGGGGATGG - Intergenic
925404262 2:3595730-3595752 TCTTGTCTCCAAAATTGGAAAGG + Intronic
925839613 2:7979321-7979343 TCTTGTCTGTAAAATAGGAATGG + Intergenic
926088500 2:10035142-10035164 TCTCATCTGTAAAATGGGGATGG - Intergenic
926302686 2:11615973-11615995 GCTCGTCTGTAAAATGTAGATGG + Intronic
927154723 2:20214946-20214968 TCTCATCTGTAAAATGTGCATGG - Intronic
927161676 2:20268855-20268877 TTTTGTTTCTGAAATGTGGCAGG + Intronic
928409791 2:31046116-31046138 TTTTATATGTAAAATGTGGATGG - Intronic
928498824 2:31865361-31865383 TCTCATTTGTAAAATGTGGAGGG - Exonic
929420250 2:41783044-41783066 CCTTTTCTATAAAATGAGGAGGG - Intergenic
931070418 2:58641719-58641741 TCCTGTCACTAAATTTTGGAAGG - Intergenic
931185533 2:59947491-59947513 GCTTCTCTCTCAAATGTGCAAGG - Intergenic
931185946 2:59951494-59951516 GCTTGTCCCTGAAATGTGGGTGG + Intergenic
931236482 2:60417224-60417246 TTTTCTCTCTCAAATGAGGACGG + Intergenic
933097237 2:78201835-78201857 TATTGTTTTTAAAATGTAGAAGG + Intergenic
933188013 2:79300464-79300486 TCTTCTCTCTCCAATGGGGAAGG + Intronic
933564021 2:83927069-83927091 TGTTGTATTTAAAAAGTGGAGGG - Intergenic
934934439 2:98454449-98454471 TCTCATCTGTAAAATGGGGAAGG + Intronic
935109778 2:100081815-100081837 TCATGTCTATAAAGTGAGGATGG - Intronic
935359272 2:102233674-102233696 TCTCATCTGTAAAATGGGGATGG + Intronic
936125196 2:109783394-109783416 TCATGTCTATAAAGTGAGGATGG + Intergenic
936219497 2:110588074-110588096 TCATGTCTATAAAGTGAGGATGG - Intergenic
936434011 2:112487641-112487663 TCTCATCTGTAAAATGGGGATGG + Intronic
936975725 2:118219911-118219933 TATGGTCTCTAAAATGTGTGTGG + Intergenic
937792179 2:125973519-125973541 TCTTGTCACACAAATTTGGAAGG + Intergenic
939453274 2:142400315-142400337 TAGTGTGTCTAAAATGTGAATGG - Intergenic
939583517 2:143979628-143979650 TCTCGTTTATAAAATGAGGAAGG - Intronic
940098285 2:150003850-150003872 TCTTGTTTATAAAATGAGGGAGG + Intergenic
940371718 2:152909459-152909481 TCTGGTCACTAAAATGTGTGTGG + Intergenic
940888361 2:159011101-159011123 TCTCATCTGTAAAATGGGGATGG - Intronic
940932005 2:159443917-159443939 TGTTGCCTCTACAATGTGTAAGG - Intronic
941574369 2:167212573-167212595 TCTTGTCTATAAAATTTGCAGGG - Intronic
941979236 2:171436659-171436681 ACTTGTATCTAAAATATGTAAGG - Intronic
942552632 2:177135382-177135404 TCTTGTGTGTAGAATATGGAGGG - Intergenic
942873344 2:180762760-180762782 TCTTGTCTATAAAATGGGAATGG + Intergenic
944992651 2:205255381-205255403 TCTGGTCACCAAAATGTGTATGG + Intronic
945430034 2:209753447-209753469 TCCTCTCTATAAAATGTGGCAGG - Intergenic
946596686 2:221313377-221313399 TCTTAATTCTAAAATGTGCAAGG + Intergenic
947195399 2:227560556-227560578 TCATGACTCTAAAAAGTGCATGG + Intronic
947673773 2:231959920-231959942 ACTTGTCTTTGAAATGTAGAGGG - Intergenic
1168807581 20:681468-681490 TCTTGTCTGTCAAATGGGAATGG + Intergenic
1168994046 20:2119338-2119360 TCTAGTCTCTCAAATGTGCCAGG - Intronic
1169923666 20:10760452-10760474 TCTTGTCACTAGAAGGAGGAAGG + Intergenic
1170971435 20:21120590-21120612 ACTGCTCTCCAAAATGTGGATGG - Intergenic
1171453101 20:25249637-25249659 TCTTTTTTCTAAAATGGAGATGG + Intronic
1172311468 20:33921571-33921593 TCTCGTCTGTAAAATGAGGACGG - Intergenic
1173140166 20:40474973-40474995 GCTCATCTCAAAAATGTGGAAGG + Intergenic
1174365464 20:50053726-50053748 TCTCATCTGTAAAATGGGGATGG + Intergenic
1175359796 20:58400036-58400058 TCTCATCTCTAAAATGGAGATGG - Intronic
1175693779 20:61085830-61085852 TCTCATCTATAAAATGGGGAGGG - Intergenic
1176014449 20:62922593-62922615 TCCTGTCTGTGAAATGGGGACGG + Intronic
1176192951 20:63822107-63822129 TCATGTTTCTAAAATGTTAATGG - Intronic
1177255388 21:18654918-18654940 TTTTGACATTAAAATGTGGAAGG - Intergenic
1177625211 21:23650589-23650611 ACTTTTCTCTCAAATGTGAAAGG + Intergenic
1177894992 21:26846528-26846550 TCTTCTCTCCAAAAAGTGGGAGG + Intergenic
1177996164 21:28101707-28101729 CCTTGTATATAAACTGTGGATGG + Intergenic
1178161247 21:29918373-29918395 TCTTGTCTGTAAAATGAGATTGG - Intronic
1178635889 21:34302815-34302837 TGATGTTTCTAACATGTGGAAGG + Intergenic
1179078897 21:38151852-38151874 ACATGTCTCCAAAATGTGGTTGG - Intronic
1179230350 21:39498456-39498478 TCCTGTCTCTGAAGTGTGGGTGG + Intronic
1181457256 22:23066843-23066865 GCTTGTCTCTAAACCATGGATGG - Intronic
1181762825 22:25069639-25069661 TCCTCTCTGTAAAATGGGGATGG + Intronic
1182719243 22:32384359-32384381 CACTGTCTCTAAAATGAGGAGGG + Intergenic
949626328 3:5870686-5870708 TATTGTCTGTAAAATGTTCAGGG - Intergenic
950023518 3:9805700-9805722 TTTGGTCTCTAAAATGTGCAGGG + Intronic
951278770 3:20721417-20721439 TCTCATCTCTAGAATGGGGATGG + Intergenic
951600803 3:24372701-24372723 TCCTGTCTGTAAAATGGGGATGG - Intronic
952000735 3:28782941-28782963 TCTTGTCTCCATCATTTGGAAGG + Intergenic
952253086 3:31673114-31673136 TCTTCTTTCTAAAATGCAGAAGG - Intronic
952257753 3:31710179-31710201 TCCTGTCTCTAAAATGGAGATGG + Intronic
952474465 3:33692608-33692630 CCTTGTCTGTAAAATACGGAAGG + Intronic
954494938 3:50948784-50948806 AGTTGACTCTAAAATGTGTATGG + Intronic
955781549 3:62490029-62490051 TCTTGTGGCTCAGATGTGGAAGG + Intronic
956469272 3:69548665-69548687 TCTTGATTATAAAATGTTGACGG + Intergenic
958159045 3:89792619-89792641 TCTTATTTCCAAAATGTGGTTGG + Intergenic
958923719 3:100134874-100134896 TATTGCCTCTCAAATTTGGAAGG - Intronic
960377164 3:116917301-116917323 GCTAGTCTCCAAAATTTGGATGG + Intronic
960997238 3:123348281-123348303 GCTCGTCTGTAAAATGAGGATGG + Intronic
961070537 3:123919956-123919978 TCTTCTCTTTAAAATGTTCAGGG + Intronic
961203794 3:125065048-125065070 TCTTATCTGTAAAATATGAACGG + Intergenic
961335886 3:126179618-126179640 TCTTGTCTCTAAAATCGGGAGGG - Intronic
961816059 3:129550982-129551004 TCTTATCTGTAAGATGGGGATGG - Intronic
962171826 3:133109230-133109252 TCTTGCCCATAAAATGAGGAAGG + Intronic
962786147 3:138769871-138769893 TCTTATCTTTAAAATGGGTAGGG - Intronic
963775368 3:149433732-149433754 TCTAGTTTCTAAAATTTGCATGG + Intergenic
964203001 3:154139242-154139264 TCTGTTCTCTAAATTTTGGAGGG + Intronic
965361106 3:167739150-167739172 TTTAGTCTTTAAAATTTGGAAGG + Intronic
966474405 3:180326881-180326903 TGTTTTCTTTAAAATGTGAAGGG + Intergenic
966808031 3:183821357-183821379 CCTTGTCTGTAGAATGGGGACGG + Intronic
966833132 3:184028194-184028216 CCTTATCTCTAAAATTGGGAGGG - Intergenic
966868078 3:184272306-184272328 CCCTGTCTCTAAAAATTGGAAGG + Intronic
967265552 3:187688105-187688127 TCTGGTCACTAAAATGTGTGGGG - Intergenic
969268520 4:6082109-6082131 CTTTGTCTATAAAATGCGGATGG - Intronic
970063679 4:12066333-12066355 TTTTCTCTCTAAAATGTGCAAGG - Intergenic
971673902 4:29599150-29599172 TTCTGTCTCTGAAATGTAGAAGG - Intergenic
972211850 4:36848168-36848190 TCTACTCACTCAAATGTGGAAGG + Intergenic
972654332 4:41050372-41050394 TCTCATCTGTAAAATGGGGATGG - Intronic
973054182 4:45633770-45633792 CCTTTTCTCTAAGATTTGGAAGG + Intergenic
973127207 4:46601806-46601828 TCTTGTTTCAAAAATAGGGAGGG - Intergenic
973194508 4:47424330-47424352 CCTTATCTATAAAATGGGGATGG + Intronic
973259793 4:48151233-48151255 TCTTGTCTCTCAGTTCTGGAAGG - Intronic
973668846 4:53192664-53192686 TCTTATCTACAAAATGGGGATGG + Intronic
973917748 4:55653558-55653580 TCTCATCTATAAAATGTGTATGG - Intergenic
974021963 4:56699488-56699510 TCTCATCTCTAAAATGAGCATGG - Intergenic
974510648 4:62835886-62835908 TTTTGGCTCTAATATGTGGCAGG + Intergenic
975835979 4:78422591-78422613 CCTTGTGTCTGAAATGTGAAGGG + Intronic
978939894 4:114423446-114423468 TCTGGTCACCAAAATGTGTATGG - Intergenic
979353218 4:119670423-119670445 CCTTGTCTGTAAAATGAGAATGG + Intergenic
979718405 4:123869474-123869496 TCTTTTCCCAAAAATGTGGAGGG - Intergenic
980486354 4:133461991-133462013 AATTGTAGCTAAAATGTGGAAGG + Intergenic
981411104 4:144433723-144433745 TCTTATCTGTAAAATGGGAATGG - Intergenic
985821381 5:2163195-2163217 TCTCATCTCTAACATGGGGATGG + Intergenic
987153128 5:15061352-15061374 TCTTGTCTCCAAAATCCAGATGG - Intergenic
987237631 5:15958929-15958951 TCTGGTCTCTAAAAGGTGGCTGG - Intergenic
987370318 5:17187072-17187094 ACTCTTCTATAAAATGTGGACGG + Intronic
987904792 5:24061621-24061643 TATTGTCCCTAAAATGTTAATGG + Intronic
989110451 5:37902109-37902131 CCTCCTCTCTAAAATGAGGAAGG + Intergenic
992212267 5:74492651-74492673 TCTGGTCTCCAAAATGTGTGGGG + Intergenic
992484819 5:77184401-77184423 TATTGTCTATAAACTATGGATGG + Intergenic
992673540 5:79083072-79083094 TCTTATCTGTAAATTGTGGGAGG + Intronic
993000311 5:82374259-82374281 GCTTGTCTTTGAAATGTGAATGG + Intronic
993666308 5:90701263-90701285 TCTTTTCCCTTAAATTTGGAAGG + Intronic
994093238 5:95826645-95826667 TCCTGTCTCTAAAATGTTGGTGG - Intergenic
994480070 5:100323157-100323179 TGTTCTCTCTAAGATGTGGCTGG + Intergenic
994924733 5:106100120-106100142 ACTTTTCTCTAGAATGTGCATGG - Intergenic
995269267 5:110202930-110202952 TTTTATCTCTAAAATGTAGATGG + Intergenic
995294710 5:110506022-110506044 TCTTTTCACTAAAATATAGAGGG + Intronic
995658095 5:114449751-114449773 TCTTATCTCTTAAATCTGTAAGG - Intronic
995694064 5:114860024-114860046 TCTAGTATCTAAAATGAGGTGGG + Intergenic
996329148 5:122311229-122311251 TATTGTCTCTTAATTGTTGAGGG - Intergenic
997025765 5:130059104-130059126 TATCTTCTGTAAAATGTGGATGG + Intronic
998890970 5:146745313-146745335 TCTCAACTCTAAAATGTGGCAGG + Intronic
999183732 5:149690038-149690060 TCTTGTCTTTGAAGTGTGGGTGG + Intergenic
1000414401 5:160968084-160968106 TCTTATCTGTCAAATGTGGGTGG + Intergenic
1000426984 5:161102571-161102593 TCTTGTCTCTAAAATTAGGCAGG - Intergenic
1001699117 5:173694054-173694076 CCTCCTCTCTAAAATGGGGATGG - Intergenic
1003238418 6:4319437-4319459 TCTTCTCTTTCAAATGAGGAAGG - Intergenic
1003684428 6:8287175-8287197 TCTTTTCTCTTAAATATTGAAGG + Intergenic
1004136126 6:12968641-12968663 TTTTGTCACTAAAATGCGAAAGG + Intronic
1004161078 6:13213493-13213515 TATTCTCTCTTTAATGTGGATGG + Intronic
1004329199 6:14706305-14706327 TGTTGTCTATAAAAAGTGAAAGG + Intergenic
1004476321 6:15976194-15976216 TCATGTCTTTAAAATATTGAGGG - Intergenic
1005395702 6:25379613-25379635 TCTGATCACTAAAAGGTGGATGG + Intronic
1005599928 6:27416221-27416243 CCTTGTCTATAAAATGAGAATGG + Intergenic
1005649550 6:27874089-27874111 TCTTGCCCCAAAAATGTGGTTGG - Intergenic
1006601432 6:35229104-35229126 TCTCCTCTCTAAAATGGGGGTGG + Intronic
1008411163 6:51181268-51181290 TCTTGACTGTAAAATATGAAAGG + Intergenic
1008827089 6:55709341-55709363 TCTTCTCTCTAAAAAGAAGATGG - Intergenic
1009844281 6:69116186-69116208 TTTGCCCTCTAAAATGTGGATGG - Intronic
1009924837 6:70107560-70107582 TCTTCTCTCTACAGTGTGAATGG - Intronic
1010831098 6:80530519-80530541 TCTCATCTGTAAAATCTGGAAGG - Intergenic
1011178331 6:84588987-84589009 TATTGTCTGGAAAATGGGGAAGG - Intergenic
1014371246 6:120610627-120610649 TCTTTTCTCTAAAATGTTGAAGG - Intergenic
1015315789 6:131814615-131814637 TCTTAACTCTAGAATATGGAAGG + Intronic
1015744350 6:136493929-136493951 TCATGTCTGTAAAATGGGGAAGG + Intronic
1015780164 6:136857137-136857159 TCTTGTCTCTGAAATGGCTAAGG - Intronic
1016037043 6:139394057-139394079 TTTTCTATCTAAAATGTGGCAGG - Intergenic
1017033161 6:150241978-150242000 TCATGTCACCAAAATGTGGGTGG - Intronic
1017224548 6:152005678-152005700 TCCTGTCTGTAAAATGCAGATGG - Intronic
1017256051 6:152334899-152334921 CCTTGTCTCTGACATTTGGAAGG - Intronic
1019798558 7:3070784-3070806 TCTTGTCATTTAAAAGTGGATGG - Intergenic
1020386711 7:7613968-7613990 ACTTGTCTCTAAATTGTGTCTGG - Intergenic
1020983205 7:15097409-15097431 TATTGTTTGTAAAATGTTGACGG + Intergenic
1021197247 7:17687347-17687369 TCCTGTCTCTACAATGAAGATGG + Intergenic
1021459907 7:20874807-20874829 TCTCATCTATAAAATGGGGATGG - Intergenic
1021721817 7:23511923-23511945 TTTTGTGTCTATAATGAGGAAGG - Intronic
1021902914 7:25305245-25305267 TCTTGATTCTCAAATGTGAAAGG + Intergenic
1021957013 7:25835315-25835337 TTAGGCCTCTAAAATGTGGATGG + Intergenic
1022081736 7:27029275-27029297 TCTTGTCTCAAAAATGCTGTGGG - Intergenic
1022086047 7:27068649-27068671 TCTTCTCTGAAAAGTGTGGAGGG - Intergenic
1022613637 7:31905483-31905505 TTTTGGCTCTAAAGTGTAGAAGG - Intronic
1022693356 7:32680416-32680438 TCTTGTCTCTGAAGGCTGGAGGG - Intergenic
1022822145 7:33972525-33972547 TCTTGTGTATAAACAGTGGATGG - Intronic
1022921034 7:35014997-35015019 TCTTGTCTCTGAAGGCTGGAGGG - Intronic
1023333943 7:39148909-39148931 TTTTGTCAGTAAAGTGTGGAAGG + Intronic
1023372817 7:39529170-39529192 TCTCTTCTCTAAAATATGGAAGG - Intergenic
1024302277 7:47896409-47896431 TGTTGTGTCTAAACTGTGAAAGG + Intronic
1024430729 7:49285293-49285315 TCTTGTCTCTGACAGATGGAGGG + Intergenic
1024445316 7:49470843-49470865 TCTTGTCACCAAAATGTGCGAGG - Intergenic
1024474089 7:49792288-49792310 TTTTATCTGTAAAATGAGGATGG - Intronic
1025781956 7:64609751-64609773 TCTTGAATCTCACATGTGGATGG + Intergenic
1025828291 7:65028620-65028642 TCTTCTCCATAAAATGGGGATGG - Intergenic
1025915817 7:65865053-65865075 TCTTCTCCATAAAATGGGGATGG - Intergenic
1026412306 7:70136699-70136721 GCATGTCTTTGAAATGTGGATGG + Intronic
1027508343 7:79046937-79046959 TCTTGTATCTAGATTCTGGAAGG + Intronic
1027522209 7:79223516-79223538 TCTTGTCTGAAAAATGGAGATGG - Intronic
1027987527 7:85312561-85312583 CCTTGTCTCTAAAATTGGGATGG - Intergenic
1028470137 7:91197082-91197104 TTTTGGTTCTAAAATGTGGGTGG - Intronic
1028579595 7:92394142-92394164 TCTCATCTTTACAATGTGGATGG + Intronic
1028970704 7:96855596-96855618 TCCTGTCTATAAAATATGCATGG - Intergenic
1029681565 7:102114874-102114896 ACTTGTCTCTTAAAAATGGAAGG + Intronic
1030218857 7:107075926-107075948 TTTTGTCTCTGAATTGGGGAGGG + Intronic
1030463932 7:109875930-109875952 TCTTGGCTCTTAAAGGTTGAGGG + Intergenic
1031521639 7:122773827-122773849 TCATTTCTTTAAAATGTGAAAGG - Intronic
1031870620 7:127086678-127086700 TCTTGGCTCTAAACTTTGAAGGG + Intronic
1032698481 7:134358289-134358311 TCTCATCTGTAAAATGGGGATGG + Intergenic
1032699454 7:134366008-134366030 TCTGGTCTCTATATTGTGGCTGG + Intergenic
1032762802 7:134960125-134960147 TTTTGTCTCTTAAGTGTAGAGGG + Intronic
1034761029 7:153671899-153671921 CCATGTCTATAAAACGTGGAGGG + Intergenic
1036238123 8:7059737-7059759 TCTTTTCACTAAAAGGTGTAAGG - Intergenic
1036820904 8:11938572-11938594 TATTGTTCCTAAAATCTGGAAGG + Intergenic
1039724009 8:40195844-40195866 TGCTGACTTTAAAATGTGGAAGG - Intergenic
1039897537 8:41726787-41726809 TCTTGACTCTTAACTTTGGATGG - Intronic
1042125565 8:65534371-65534393 TCTTATGTCTAAAATGAGAATGG - Intergenic
1042413578 8:68492974-68492996 CCTTCTCTGTAAAATGTAGATGG + Intronic
1044318429 8:90775760-90775782 TCCTGTCTCTAGTATGTGGTAGG - Intronic
1045261200 8:100575983-100576005 CTTTGTCTGTAAAATGTAGATGG - Intronic
1046756667 8:117979629-117979651 TCTAGTTACTAAAATGTGGAGGG - Intronic
1047289171 8:123514096-123514118 TAGTGTCTCTAAAATGTAGCTGG + Intronic
1047506538 8:125485081-125485103 CCTTATCTCTAAAGTGGGGAGGG + Intergenic
1048653158 8:136503561-136503583 TCTTGTCTGTATTATTTGGATGG - Intergenic
1048732617 8:137460659-137460681 TCTTGCCTCTAAACACTGGAAGG - Intergenic
1049264850 8:141662413-141662435 TCTTTTCTGTAAAATGTGGGTGG - Intergenic
1052207560 9:25861713-25861735 TTTAGATTCTAAAATGTGGAAGG + Intergenic
1053282246 9:36828046-36828068 TCTGGTCACTAGAATGTGAATGG + Intergenic
1053419479 9:37968276-37968298 ACTTATCTGTAAAATGGGGATGG - Intronic
1055465513 9:76561596-76561618 TTTTGCCTCTGCAATGTGGAGGG - Intergenic
1055568711 9:77594655-77594677 TGTTGTCTCTAAAAGGTGAAAGG + Intronic
1056296543 9:85198814-85198836 CCTTATCCCTAAAATGAGGATGG + Intergenic
1056481310 9:87009273-87009295 TTTTGAATCTAAAATTTGGATGG - Intergenic
1056948794 9:91025352-91025374 CTTTATCTGTAAAATGTGGATGG + Intergenic
1057592228 9:96382694-96382716 TTTGGGCTCTAAAATGTTGATGG + Intronic
1057908004 9:98997213-98997235 TCTTGTCTGTAAAATGAGGGTGG - Intronic
1057936162 9:99240624-99240646 CCTTGTCTATAAAATGTGCCTGG - Intergenic
1058420050 9:104824795-104824817 CCTCATCTCTAAAATGGGGATGG - Intronic
1059351671 9:113669800-113669822 TCTGGTCAATAGAATGTGGATGG + Intergenic
1059404620 9:114092233-114092255 TCTTATCTCTGAAATGGGGTGGG - Intronic
1059536345 9:115084584-115084606 TGTTGCCTCTAAAATGCAGATGG + Intronic
1059923316 9:119181469-119181491 TCTTATCTGTCAAATGGGGAAGG + Intronic
1060392756 9:123291901-123291923 TCTCATCTGTAAAATGTGCAGGG - Intergenic
1060552954 9:124494270-124494292 TCTTCTCTCTATCATGTGGGTGG - Intronic
1060571240 9:124642365-124642387 TATTATCTATAAAATGGGGATGG + Intronic
1060753853 9:126194598-126194620 TCATATGTCTATAATGTGGATGG + Intergenic
1061226950 9:129285974-129285996 CCTTGTCTATAAAATGGGGATGG - Intergenic
1062208319 9:135349276-135349298 TCTTTTCTTTAAAATGGGGCTGG - Intergenic
1062363429 9:136198045-136198067 CCTTGTCTGCAAAATGTGGGTGG - Intronic
1185648923 X:1634603-1634625 TCCTCTCTTTAGAATGTGGAGGG + Intronic
1186257151 X:7734488-7734510 TGTTGTCCATAAAATGGGGATGG + Intergenic
1186481494 X:9899349-9899371 TCTTGTTTCAAAAAGGCGGATGG + Intronic
1187557368 X:20365736-20365758 TCTTGTCCCTGATATGTGCATGG + Intergenic
1188187598 X:27133784-27133806 ACCTGCCTCTAAGATGTGGAAGG - Intergenic
1190126761 X:47712324-47712346 TCCTGTCTCTGAGATGTGGATGG - Intergenic
1190320025 X:49174578-49174600 TCTTGTGTGTAAAATGTTCATGG + Intronic
1192549595 X:72043457-72043479 CCTTGTGTGTAAAATGGGGATGG - Intergenic
1193442736 X:81563434-81563456 TCTTGGCTCTAATAAATGGATGG + Intergenic
1195767770 X:108314777-108314799 TCCTATCTGTAAAATGAGGATGG + Intronic
1196494674 X:116310626-116310648 TCTTCTCTCTATAAGGTGCAAGG - Intergenic
1196816430 X:119668649-119668671 CCTCATCTATAAAATGTGGAGGG + Intronic
1197974020 X:132145947-132145969 CTTCGTCTCTAAAATGTGGAAGG - Intergenic
1199881920 X:151980645-151980667 TCTTGAGTCTGAAATGTGGGTGG + Intergenic
1201460382 Y:14216103-14216125 TCTGGCCTCTAAAATGGAGAAGG - Intergenic
1201471306 Y:14338142-14338164 TCTTGGCTCAGTAATGTGGATGG - Intergenic
1201643813 Y:16205493-16205515 TCTTGTTTCTAAATAGTGAAAGG - Intergenic
1201659002 Y:16379828-16379850 TCTTGTTTCTAAATAGTGAAAGG + Intergenic