ID: 1115895233

View in Genome Browser
Species Human (GRCh38)
Location 14:38078905-38078927
Sequence CCAAGAGCATCCACCTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115895227_1115895233 -10 Left 1115895227 14:38078892-38078914 CCCTGGCAAGACTCCAAGAGCAT No data
Right 1115895233 14:38078905-38078927 CCAAGAGCATCCACCTTTGGGGG No data
1115895226_1115895233 -1 Left 1115895226 14:38078883-38078905 CCATTGTTTCCCTGGCAAGACTC No data
Right 1115895233 14:38078905-38078927 CCAAGAGCATCCACCTTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115895233 Original CRISPR CCAAGAGCATCCACCTTTGG GGG Intergenic
No off target data available for this crispr