ID: 1115900389

View in Genome Browser
Species Human (GRCh38)
Location 14:38140749-38140771
Sequence GACCCAAACCTGCTGAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115900389_1115900394 13 Left 1115900389 14:38140749-38140771 CCCTTCTTCAGCAGGTTTGGGTC No data
Right 1115900394 14:38140785-38140807 CTTGCCTTATTAAGTATTGGTGG No data
1115900389_1115900396 19 Left 1115900389 14:38140749-38140771 CCCTTCTTCAGCAGGTTTGGGTC No data
Right 1115900396 14:38140791-38140813 TTATTAAGTATTGGTGGTCAAGG No data
1115900389_1115900392 10 Left 1115900389 14:38140749-38140771 CCCTTCTTCAGCAGGTTTGGGTC No data
Right 1115900392 14:38140782-38140804 CACCTTGCCTTATTAAGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115900389 Original CRISPR GACCCAAACCTGCTGAAGAA GGG (reversed) Intergenic
No off target data available for this crispr